ID: 1126558150

View in Genome Browser
Species Human (GRCh38)
Location 15:50013326-50013348
Sequence GATGGCCTTTTGGGCTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 347}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126558145_1126558150 2 Left 1126558145 15:50013301-50013323 CCATAGCTCTTCTAGGGGGACAT 0: 1
1: 0
2: 1
3: 3
4: 85
Right 1126558150 15:50013326-50013348 GATGGCCTTTTGGGCTGTGAAGG 0: 1
1: 0
2: 2
3: 18
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126558150 Original CRISPR GATGGCCTTTTGGGCTGTGA AGG Intronic
901217264 1:7561751-7561773 CATGGCCTGTTGGGCTGGGGAGG - Intronic
901280132 1:8027016-8027038 GAGGGACTTTGGGACTGTGAGGG + Intergenic
903047317 1:20574619-20574641 GAAGGCCTTTTGGCCTGAGGAGG - Intergenic
903909503 1:26712212-26712234 GATGTCCCTTTTGCCTGTGATGG + Intronic
904572530 1:31477613-31477635 ACTGGCCTTTTGGGTTGTGTGGG - Intergenic
904978388 1:34476225-34476247 GATGGCCTTTAAGGCTGGGCTGG + Intergenic
905125640 1:35714348-35714370 GTTGGCTTTCTGGGATGTGAAGG - Exonic
907384888 1:54119630-54119652 GATGGACATTTGGGCTGTTCGGG - Intergenic
907503601 1:54901581-54901603 GATGGCCTTTTGACCTTTTAGGG + Intergenic
908387907 1:63659838-63659860 GATGCCCTTGGGAGCTGTGAGGG + Exonic
909266374 1:73563423-73563445 CATGGCCTTTTGGGGGATGAGGG + Intergenic
909551055 1:76898520-76898542 GATGGCCTTTTGACCTTTTAGGG + Intronic
909793009 1:79700065-79700087 GATGGCCTTTTGACCTTTTAGGG + Intergenic
915284057 1:154841830-154841852 GATGGCCTATTGGGAGGTCATGG + Intronic
915515129 1:156408251-156408273 GAAGGCCTCCTGGGTTGTGAGGG - Intronic
917790189 1:178494467-178494489 GAAGGGCTTCTGGGCTGTGCAGG + Intergenic
918154968 1:181835914-181835936 ACTGGCCTTTTGGGCTGTGTGGG + Intergenic
919408040 1:197209038-197209060 ACTGGCCTTTTGGGCTGTGTGGG - Intergenic
919639494 1:200035053-200035075 GATGGGTTTTTCGGCTGGGAGGG + Intronic
920896011 1:210049917-210049939 CTTGGCCTTCTGGACTGTGATGG + Intronic
922049567 1:221976827-221976849 GATGGCCTTTTGACCTTTTAGGG + Intergenic
922154103 1:223028127-223028149 GATGGCCTTTTGACCTTTTAGGG + Intergenic
923075173 1:230603219-230603241 GATGGCCTTTTGACCTTTTAGGG - Intergenic
923458720 1:234188378-234188400 ACTGGCCTTTTGGGTTGTGCGGG + Intronic
924153078 1:241148980-241149002 GATGCCCTGTTGGAGTGTGAAGG - Intronic
924896214 1:248339950-248339972 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1064663844 10:17630566-17630588 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1065396384 10:25243085-25243107 GATGGCCTTAAGGGCCGTGGTGG - Intronic
1065916336 10:30357407-30357429 GGTGGGCTTTGGGGCTGTGGGGG - Intronic
1067083741 10:43227542-43227564 GATGGGCTTTGGGCCTGGGAAGG + Intronic
1068173194 10:53422362-53422384 GCTGGCCTTTTGGGCTGTGTAGG - Intergenic
1070474895 10:76820559-76820581 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1071870581 10:89789817-89789839 ACTGGCCTTTTGGGCTGCGTGGG - Intergenic
1072620369 10:97075388-97075410 AATTGCCTTTTGGGCTCTGTAGG + Intronic
1072783682 10:98266774-98266796 GCTGGCCTTGTGGGATGTGTAGG - Intronic
1073180943 10:101582832-101582854 GATGGCCTGCTGGGTTGTCAGGG + Exonic
1073212529 10:101817105-101817127 GATGGACTTTTTGGTAGTGAGGG - Intronic
1073308635 10:102523479-102523501 GCTGTGCTTTTGGCCTGTGATGG + Intronic
1073426315 10:103457702-103457724 GAGGCCCTGTTGGGATGTGATGG - Intronic
1074811011 10:117105052-117105074 GATGTGGTTCTGGGCTGTGAAGG - Intronic
1075248665 10:120846839-120846861 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1077107461 11:848338-848360 GATGGCCTTGTGGGCCTTCAGGG + Intronic
1077603132 11:3587965-3587987 GATAGCCTTTGGGTCTCTGATGG + Intergenic
1077828022 11:5831563-5831585 GCTGGCCTTTCGAGCTGTGTGGG - Intronic
1077883319 11:6367771-6367793 GATGGCCTTTTGACCTTTCAGGG - Intergenic
1078734694 11:14009241-14009263 CTGGGCCTTTTGGGCTGTTAAGG - Intronic
1078893657 11:15579378-15579400 GATGGCTTTTTGGTCTGTGATGG + Intergenic
1079447429 11:20569779-20569801 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1079727104 11:23890902-23890924 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1080027946 11:27632798-27632820 GACGGCCTTTTGAGCTTTTAGGG + Intergenic
1080227324 11:29975372-29975394 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1080273195 11:30472500-30472522 GATGGACACTTGGGTTGTGAAGG - Intronic
1084259020 11:67962505-67962527 GATAGCCTTTGGGTCTCTGATGG + Intergenic
1084813735 11:71632669-71632691 GATAGCCTTTGGGTCTCTGATGG - Intergenic
1085942914 11:81227264-81227286 GATGGCTTTTTAGCCTATGAAGG - Intergenic
1086125340 11:83343838-83343860 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1086863751 11:91954933-91954955 GATGGCCTAAAGGGCTATGAGGG + Intergenic
1087839574 11:102907828-102907850 GACGGCCTTTTGACCTGTTAGGG + Intergenic
1089157430 11:116413373-116413395 GATGGCCTGTGGGCCTGGGAGGG - Intergenic
1089349063 11:117811272-117811294 GATGGCCTTTTGACCTTTTAGGG - Intronic
1090107635 11:123869347-123869369 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1090213201 11:124937650-124937672 AATGGCCTCTTTGCCTGTGATGG + Intergenic
1091713871 12:2762418-2762440 GTAGGCCTTTTGCTCTGTGAAGG + Intergenic
1091811900 12:3406286-3406308 CTTGGCCTCTTGGCCTGTGATGG + Intronic
1092124607 12:6066307-6066329 GATGCCCTTTTCAGCTTTGATGG - Intronic
1092430337 12:8403513-8403535 GATAGCCTTTGGGTCTCTGATGG + Intergenic
1092723751 12:11465892-11465914 GATGGCCTTTTGACCTTTTAGGG + Intronic
1093578785 12:20765366-20765388 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1093584550 12:20820724-20820746 GATGGCCTTTTGACCTTTTAGGG + Intronic
1094316089 12:29138747-29138769 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1098402213 12:70087389-70087411 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1098439689 12:70504553-70504575 GCTGGTGTTTTGGGCTGTGGGGG + Intergenic
1098500577 12:71187371-71187393 AATAGCCTTTTTGGCTGTGTGGG + Intronic
1099859140 12:88206449-88206471 CAAGGCCTTTTTGGCTTTGATGG + Intergenic
1100658014 12:96667656-96667678 GTAGGCCTTTGGGTCTGTGATGG + Intronic
1101155637 12:101925034-101925056 GGTTGCCTTTTGGGCGGGGAGGG - Intronic
1102261471 12:111445888-111445910 TATGCCCTTTTGGGCTGAGGTGG + Intronic
1102289936 12:111691294-111691316 GATGGTGTTTTGTGGTGTGAGGG + Intronic
1103977157 12:124710575-124710597 AATGGCCTCCTGGGCTGTGGCGG - Intergenic
1105258931 13:18764389-18764411 GCTGCCCTTATGGGCTGTGCTGG + Intergenic
1106114041 13:26801722-26801744 AGTGGCAGTTTGGGCTGTGATGG + Intergenic
1106943411 13:34800633-34800655 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1108814094 13:54268847-54268869 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1108952979 13:56116140-56116162 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1109109017 13:58292590-58292612 CTTGGCCTTTGGGCCTGTGATGG - Intergenic
1111302015 13:86360396-86360418 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1111362145 13:87190175-87190197 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1113324303 13:109267333-109267355 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1114670349 14:24407786-24407808 GCTGGCCTTTTGGGTGGCGAGGG + Intronic
1115068468 14:29294392-29294414 CTAGGCCTCTTGGGCTGTGATGG - Intergenic
1116952880 14:50895161-50895183 GATGGCCTTTTGACCTTTTAGGG - Intronic
1117183103 14:53212855-53212877 GATAGCCTTTTGGGAGGAGAAGG + Intergenic
1119726466 14:76924624-76924646 GATGGCTTGTTGGGGGGTGATGG - Intergenic
1120539599 14:85736722-85736744 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1120752741 14:88212973-88212995 GCTGGCTCTTTGGGGTGTGATGG + Intronic
1121035608 14:90700914-90700936 AGTGTCCTTTTGGACTGTGAAGG - Intronic
1121618280 14:95328493-95328515 GATGGATCTTTGGGCTGTGTTGG - Intergenic
1121977671 14:98420653-98420675 GATGGACTATTGGTCTTTGATGG + Intergenic
1122040965 14:98987189-98987211 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1123191776 14:106578810-106578832 GATGGACTTGTCGGCTGAGATGG + Intergenic
1125258033 15:37789270-37789292 CATGGCTTTTTGCGCTGTCATGG + Intergenic
1125481677 15:40085380-40085402 GGTGGCATTTAGGGCTGTGCTGG + Intergenic
1126122765 15:45268291-45268313 GATTGCCTTTTTGGCTGTGTTGG + Exonic
1126558150 15:50013326-50013348 GATGGCCTTTTGGGCTGTGAAGG + Intronic
1127851150 15:62913043-62913065 GATTGCCCTTTTGCCTGTGATGG + Intergenic
1129439028 15:75566222-75566244 CTAGGCCTTTTGGGATGTGATGG - Intronic
1129773978 15:78222034-78222056 GATGGACATTTGGGTTGTGTGGG - Intronic
1130015108 15:80180275-80180297 GAGGGCCCTTGGGGCTGTGTGGG - Intronic
1131182459 15:90249823-90249845 TAAGACCCTTTGGGCTGTGACGG - Intronic
1131601301 15:93851477-93851499 GATGGACTTTGGGACTGAGAAGG - Intergenic
1132340377 15:101074527-101074549 GACGGCCTTTTGGGCTTTTAGGG - Intronic
1133365848 16:5209356-5209378 GATAGCCTTTGGGTCTCTGATGG - Intergenic
1133555277 16:6900781-6900803 AATGGCATTGTGTGCTGTGAAGG - Intronic
1137787228 16:51149885-51149907 GGCGGCATTTTGGGGTGTGAAGG - Intronic
1139373341 16:66481566-66481588 GGGGGCCTAGTGGGCTGTGAGGG - Exonic
1139636138 16:68259701-68259723 GTTGGCCTCTGGGGCTGTCATGG + Exonic
1139943084 16:70620186-70620208 GATGGCCTTTTGACCTTTTAGGG + Intronic
1139943754 16:70624504-70624526 GATGGCCTTTTGACCTTTTAGGG + Intronic
1144719952 17:17462293-17462315 GATGGCCTCTTGCACTGTGGGGG + Intergenic
1144776581 17:17787901-17787923 GATGGTGTTGGGGGCTGTGAGGG + Intronic
1146597863 17:34185264-34185286 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1148632604 17:49123080-49123102 GATGTTCCTTTGGGCTGTCAGGG + Intergenic
1150485594 17:65541268-65541290 CATGGTTTTTTGGGTTGTGATGG - Intronic
1152107220 17:78337658-78337680 AATGGCCCAATGGGCTGTGAAGG + Intergenic
1152540308 17:80971364-80971386 GATGGCCTTCTGGGGAGTGAGGG - Intergenic
1153171310 18:2319128-2319150 GTTGGCCTCTTGGCCTGTGCCGG - Intergenic
1154297855 18:13165852-13165874 ACTGGCCTTTTGGGCTGTGTAGG + Intergenic
1154348679 18:13565321-13565343 GACGGGCCTTTGTGCTGTGAGGG + Intronic
1155049749 18:22136293-22136315 GATGGCCTTTTGGTTTGGGATGG + Intergenic
1155175964 18:23301358-23301380 GAAGGCATTTTGGAGTGTGATGG + Intronic
1155697051 18:28696820-28696842 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1156302210 18:35845863-35845885 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1157573695 18:48730270-48730292 GAGGGCCTCCTGGGGTGTGAGGG + Intronic
1157719376 18:49912092-49912114 GATGGCCTTTTTGTCTGTGTTGG + Exonic
1164018348 19:21273394-21273416 ACTGGCCTTTTGGGTTGTGTGGG - Intronic
1164194657 19:22945668-22945690 GAGAGCCTTTTGGGCTGAGTGGG + Intergenic
1164459264 19:28433608-28433630 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1165113089 19:33513437-33513459 GATGGCCTTTGGGACTGTCCAGG - Intronic
1165497037 19:36159124-36159146 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1165510351 19:36263203-36263225 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1166498975 19:43327221-43327243 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1167384272 19:49155036-49155058 GATGGTCTCTAGGGCTGTGGAGG + Exonic
928030227 2:27771733-27771755 GGGGGCCTTTTGGCCGGTGACGG + Exonic
928827691 2:35440838-35440860 GATGGCCTTTTGACCTTTTAGGG + Intergenic
929455075 2:42059686-42059708 TATGGCCTGTGGGGCTCTGAGGG + Intergenic
929920977 2:46171342-46171364 GGTGGCCTCTTGCACTGTGAGGG + Intronic
930166377 2:48207423-48207445 GATGGTCATTTGGGGTGAGATGG + Intergenic
930955064 2:57194958-57194980 GATGGCCTTTTGACCTTTTAGGG - Intergenic
931026426 2:58117131-58117153 GATGGCCTTTTGACCTTTTAGGG + Intronic
931850393 2:66245920-66245942 GATGGCCTTTTGACCTTTTAGGG - Intergenic
932358849 2:71088762-71088784 GATGGCCTTTTGACCTTTTAGGG + Intergenic
932384925 2:71323490-71323512 ACTGGCCCTTTGGGTTGTGAGGG - Intronic
933397927 2:81755072-81755094 CTTGGCCTCTTGGCCTGTGATGG + Intergenic
934233397 2:90207513-90207535 GATGGCCTTCCTGGCTTTGAAGG - Intergenic
934622752 2:95825527-95825549 TCTGGCCTTTTGAGTTGTGAGGG + Intergenic
937339146 2:121079870-121079892 GAGGGGCTTTGGGGCTGTAATGG + Intergenic
939460767 2:142493578-142493600 GATGGCCTTTTGACCTTTAAGGG + Intergenic
941353351 2:164461106-164461128 GATGGCCTTTTGACCTTTTAGGG - Intergenic
941456218 2:165714214-165714236 GATGGCCTTTTGACCTTTTAGGG + Intergenic
941935926 2:170981379-170981401 GATGGCCTTTTGACCTTTTAGGG + Intergenic
943450098 2:188035208-188035230 GATGGCCTTTTGACCTTTTAGGG - Intergenic
943806617 2:192132412-192132434 GATGGCCTTTTGACCTTTTAGGG - Intronic
943835368 2:192509451-192509473 GATGGCCTTTTGACCTTTTAGGG - Intergenic
946018514 2:216622922-216622944 AATGGCAGTGTGGGCTGTGAGGG + Intergenic
946215064 2:218177750-218177772 GATGGCCTTTTGACCTTTTATGG + Intergenic
946871794 2:224091595-224091617 GATGGCCTTTTGACCTTTTAGGG + Intergenic
946891328 2:224280337-224280359 GATTGGCTGTTGGGCTGAGATGG - Intergenic
947817281 2:233046452-233046474 CAGTGCCTTTTGGGGTGTGAAGG - Intergenic
948390650 2:237608947-237608969 GATGGCCTTTTGACCTTTTAGGG - Intergenic
948786499 2:240355541-240355563 CATGGCCCTCTGGGCTGGGAGGG - Intergenic
1169678163 20:8178599-8178621 GATAGTTTCTTGGGCTGTGAAGG + Intronic
1170158776 20:13292088-13292110 GATGGGGTTTTGGGCAGTGGGGG - Intronic
1170162852 20:13332851-13332873 TTTGGCCTTTGGGGCTGTCAGGG + Intergenic
1170820735 20:19754864-19754886 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1173101877 20:40095333-40095355 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1174311319 20:49657286-49657308 TTTGGACTTTTGGGCTGGGATGG - Intronic
1175985558 20:62762669-62762691 GGTGGGCGTTTGAGCTGTGAGGG - Exonic
1177032708 21:16002143-16002165 AATGGCCAGTTGGGATGTGATGG + Intergenic
1182036733 22:27204384-27204406 GATTGCCCATTGGCCTGTGAAGG - Intergenic
1185036020 22:48477312-48477334 GATGGCCTTCTGGGGTGTCCTGG + Intergenic
949162131 3:894387-894409 GATGGCCTTTTGACCTTTTAGGG + Intergenic
949377344 3:3405170-3405192 ACTGGCCTTTCGGGCTGTGTGGG + Intergenic
949827407 3:8179008-8179030 GATGGCCTTTTGACCTTTTAGGG - Intergenic
950013495 3:9740344-9740366 GCTGCTCATTTGGGCTGTGATGG + Intronic
951318699 3:21218809-21218831 GATGGTCTTTCTGGCAGTGAGGG + Intergenic
952284621 3:31956426-31956448 GATGGCCTTTTGGCCGGGCATGG + Intronic
953825738 3:46250012-46250034 GATGGCCTTTTGACCTTTTAGGG + Intronic
954969300 3:54638201-54638223 GATGGCCTTTTGACCTTTTAGGG + Intronic
957073969 3:75587035-75587057 GATAGCCTTTGGGTCTCTGATGG + Intergenic
958149361 3:89670587-89670609 CTTGGCCTTTGGGCCTGTGATGG - Intergenic
959009767 3:101061416-101061438 ACTGGCCTTTTGGGCTGTATGGG - Intergenic
961003820 3:123391352-123391374 GATGTCCTTGAGGGCTGTGCAGG + Intronic
961280118 3:125759694-125759716 GATAGCCTTTGGGTCTCTGATGG - Intergenic
961874287 3:130009878-130009900 GATAGCCTTTGGGTCTCTGATGG + Intergenic
963468578 3:145712363-145712385 GATGGCCTTTTGACCTTTTAGGG - Intergenic
963520411 3:146355517-146355539 GATGGCCTTTTGACCTTTTAGGG - Intergenic
965823061 3:172704156-172704178 GATGTGCTTTTGGGCTGTGTGGG - Intronic
966105119 3:176325343-176325365 GATGGCCTTTTGACCTTTTAGGG + Intergenic
966232884 3:177669558-177669580 GATGGCCTTTTGACCTTTTAGGG + Intergenic
967370821 3:188743949-188743971 GATGACGTTTTAGGCTGTGAGGG + Intronic
967604730 3:191432118-191432140 GAAGGCCCTTTGTACTGTGAGGG + Intergenic
967876207 3:194270018-194270040 GAGGGCTTTTTCGGCTGTGGGGG - Intergenic
968540623 4:1166510-1166532 GGTGGCCTGATGGGCTGCGAGGG + Intergenic
969052761 4:4385132-4385154 GCTGGCCTTTTGTGCTGTCTTGG - Exonic
970998551 4:22296004-22296026 TATGGCCTGTAGGGATGTGAGGG + Intergenic
971180525 4:24325201-24325223 GATGGCCTTTTGACCTTTTAGGG - Intergenic
971200105 4:24502999-24503021 GATGGCCTTTTGACCTTTTAGGG - Intergenic
972097346 4:35364579-35364601 ACTGGCCTTTTGGGCTGTGTGGG - Intergenic
973108234 4:46367523-46367545 GTTTGCCATTTGTGCTGTGAAGG - Intronic
973703927 4:53563477-53563499 CTTGGCCTTTGGGTCTGTGATGG - Intronic
976791250 4:88880813-88880835 ACTGGCCTTTTGGGCTGCGTGGG + Intronic
977075243 4:92442684-92442706 GATGGCCTTTTGACCTTTTAGGG + Intronic
978001155 4:103557486-103557508 GATGGCCTTTTGACCTTTTAGGG + Intergenic
981525172 4:145701095-145701117 GATGGCCTTTTGACCTTTTAGGG - Intronic
983023836 4:162711090-162711112 GATGGCCTTTTGACCTTTTAGGG - Intergenic
983055450 4:163095076-163095098 GATGGCCTTTTGACCTTTTAGGG - Intergenic
983643434 4:169965523-169965545 AATGGACGTTTGGGCTTTGATGG + Intergenic
985107692 4:186514999-186515021 GATGGTCTTTTGAGCTTGGAAGG + Intronic
985160189 4:187035995-187036017 GGTGGTTTTCTGGGCTGTGAGGG + Intergenic
985672853 5:1215000-1215022 GATGGGCTTGTGGGCAGAGAGGG + Intronic
986193502 5:5517541-5517563 GATGGCCTTTTGACCTTTTAGGG - Intergenic
986555080 5:9002295-9002317 GATGGCCTTTTGACCTTTTAGGG + Intergenic
986923171 5:12713015-12713037 GCTGGCCTGTATGGCTGTGAGGG + Intergenic
987436474 5:17900837-17900859 GATGGGCATTTGGGCTGGGCTGG + Intergenic
987487468 5:18540296-18540318 GATGGCCTTTTGACCTTTTAGGG - Intergenic
987498160 5:18672581-18672603 GATGGCCTTTTGACCTTTTAGGG + Intergenic
988835434 5:35027917-35027939 GCAGGCCCTTTGGCCTGTGAGGG + Intronic
990458489 5:56011969-56011991 GGAGGGCATTTGGGCTGTGACGG + Intergenic
993587338 5:89747011-89747033 GCTGGTATTTTGGGCTGTGGGGG + Intergenic
994532578 5:100987976-100987998 GATGGCCTTTTGACCTTTTAGGG + Intergenic
995690997 5:114825528-114825550 CTAGGCCTTTGGGGCTGTGATGG + Intergenic
995920951 5:117311300-117311322 AATGGACTTTGGGGATGTGAAGG + Intergenic
996203294 5:120701313-120701335 GATGGCCTTTTGACCTTTTAGGG + Intergenic
996528019 5:124499020-124499042 GATGGCCTTTTGACCTTTTAGGG - Intergenic
996684990 5:126270007-126270029 GATGGTGTTTGGGGGTGTGAAGG + Intergenic
998031783 5:138876682-138876704 GTTGGCCTTTTTGGTTCTGAGGG + Intronic
998567708 5:143230906-143230928 GATGTCCTTTTGGGATTTGTGGG + Intergenic
999308818 5:150538284-150538306 CATGGGCTTTTAGGCTGAGATGG + Intronic
999670676 5:153956790-153956812 GATGGCCTTTGGGGCATTTAGGG - Intergenic
1000259849 5:159577189-159577211 GATGGCCAATTAGGCTGTGTGGG + Intergenic
1001173373 5:169442820-169442842 GACGGCCATTGGGTCTGTGAAGG - Intergenic
1001745779 5:174091241-174091263 GATGGCCCTCTGGGCTGAGGGGG + Intronic
1002541808 5:179911226-179911248 CATGGACTCCTGGGCTGTGAAGG + Intergenic
1003386554 6:5672993-5673015 AAAGACCTTTGGGGCTGTGAAGG + Intronic
1004419162 6:15452535-15452557 GCAGGACTTTGGGGCTGTGAAGG + Intronic
1006077603 6:31544051-31544073 GATAGCCATTTGGGCTGTTTAGG + Intronic
1006186995 6:32187132-32187154 GGGGGCCTTTTGGGGTGAGAGGG - Intronic
1006309504 6:33248036-33248058 GATGTCCTCATGGGCTGTAACGG - Intergenic
1007362798 6:41370827-41370849 GACAGCCCTTTGTGCTGTGAAGG - Intergenic
1007500967 6:42296615-42296637 GTTTGGCTTTTGGGCTTTGAGGG - Intronic
1008023847 6:46611188-46611210 TATGGCCTTTTGGCATGTGAAGG + Intronic
1008231194 6:48986647-48986669 ACTGGCCTTTTGGGCTGTGTGGG + Intergenic
1008244248 6:49150757-49150779 GCTGGTGTGTTGGGCTGTGAGGG + Intergenic
1009377218 6:62987693-62987715 GGGGGCCTTTTGGGATGTGGGGG + Intergenic
1010826948 6:80486160-80486182 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1011367932 6:86602086-86602108 GATGGCCTTTTGGCCTTTTGAGG + Intergenic
1011718287 6:90129446-90129468 CATGGCCTGTTGGGAGGTGAGGG - Intronic
1012689540 6:102294913-102294935 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1015269623 6:131325390-131325412 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1015271338 6:131340862-131340884 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1015898047 6:138035802-138035824 TATGGCCTTTTGTGTTTTGATGG - Intergenic
1016114178 6:140261133-140261155 GACGGCCTTTTGGCCTTTTAGGG + Intergenic
1016248827 6:142017795-142017817 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1016535793 6:145106872-145106894 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1016650329 6:146454138-146454160 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1016682387 6:146845489-146845511 CTAGGCCTTTTGGCCTGTGATGG + Intergenic
1016853232 6:148641787-148641809 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1017779370 6:157704396-157704418 GATGGCCTTTTGACCTTTTAGGG + Intronic
1018495438 6:164342453-164342475 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1018703402 6:166445725-166445747 GATGCCCTGTCTGGCTGTGACGG + Intronic
1019255222 7:45541-45563 GCCTGCCTTTGGGGCTGTGAAGG - Intergenic
1021977931 7:26027909-26027931 GATGGCCTTTTGACCTTTCAGGG + Intergenic
1022854745 7:34303615-34303637 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1023698923 7:42874330-42874352 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1024051587 7:45627288-45627310 GATGGCCTTTGGGGCTTTCAAGG - Intronic
1024675265 7:51632440-51632462 AATGATCTTTTGGTCTGTGAAGG + Intergenic
1026646448 7:72174782-72174804 CATGGAATTTTGGGGTGTGATGG + Intronic
1027440246 7:78211489-78211511 GATGGACTCCTGGGCTGTGAGGG + Intronic
1028529660 7:91824788-91824810 ACCGGCCTTTTGGGCTGTGTGGG - Intronic
1028690142 7:93641848-93641870 GATGGCCTTTTGAACTTTTAGGG - Intronic
1028887572 7:95951301-95951323 CATGACCTTTTAGGCTGTAAGGG - Intronic
1028889545 7:95971836-95971858 GATGCCCTTTGGAGCTGAGAAGG + Intronic
1029185735 7:98737189-98737211 GATGGACAGGTGGGCTGTGATGG - Intergenic
1030751536 7:113237301-113237323 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1031004634 7:116457471-116457493 GATGGCCTTTTGACCTTTTAGGG - Intronic
1031163135 7:118193134-118193156 GATAGTCTTTTAGGCTTTGAAGG + Intergenic
1032084809 7:128878426-128878448 GATAGGCTTTTGGGCTTTCAGGG - Intronic
1036070962 8:5440386-5440408 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1036241475 8:7085191-7085213 GATAGCCTTTGGGTCTCTGATGG - Intergenic
1036260361 8:7234940-7234962 GATAGCCTTTGGGTCTCTGATGG + Intergenic
1036306254 8:7604583-7604605 GATAGCCTTTGGGTCTCTGATGG - Intergenic
1036312398 8:7693496-7693518 GATAGCCTTTGGGTCTCTGATGG + Intergenic
1036357099 8:8052568-8052590 GATAGCCTTTGGGTCTCTGATGG - Intergenic
1036831259 8:12021900-12021922 GATAGCCTTTGGGTCTCTGATGG + Intergenic
1036901470 8:12672689-12672711 GATAGCCTTTGGGTCTCTGATGG + Intergenic
1039049039 8:33476250-33476272 AATAGCCTTCTGGGCTATGAGGG + Intronic
1041791458 8:61700289-61700311 GTTTGCCTTTGGGGCTGTGCTGG - Intronic
1043353708 8:79389829-79389851 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1043365772 8:79531672-79531694 CGTGGCCTTTTGGGGTGTGGGGG - Intergenic
1043401391 8:79888590-79888612 AATGGCCTTTTGTGCTGAAAAGG + Intergenic
1043708673 8:83385109-83385131 TATGGCCTTTTGTGGTGTTAAGG - Intergenic
1044258651 8:90093929-90093951 GATGGCCTTTTGACCTTTTAGGG + Intronic
1044417046 8:91949956-91949978 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1044921952 8:97177067-97177089 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1045644745 8:104287921-104287943 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1045994169 8:108343173-108343195 ATTGGCCTTTTGGGTTGTGTGGG + Intronic
1048728461 8:137412025-137412047 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1048831029 8:138477699-138477721 GATGCCCTTTTGGTCAGTGGTGG + Intronic
1049599352 8:143499887-143499909 GCGGGCCTCCTGGGCTGTGAGGG - Intronic
1050923079 9:11230352-11230374 GATGTTCCTTTGGGCTGTCAGGG + Intergenic
1051052589 9:12950308-12950330 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1051215508 9:14793570-14793592 AATGGCCATATAGGCTGTGAAGG - Intronic
1051849322 9:21489424-21489446 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1052894564 9:33735086-33735108 ACTGGCCCTTTGGGTTGTGAGGG + Intergenic
1056061124 9:82885745-82885767 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1056437275 9:86587033-86587055 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1057377956 9:94541815-94541837 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1057516047 9:95722269-95722291 GATGGCTGTTTGGTCTGTTATGG - Intergenic
1057817153 9:98304198-98304220 CATGGCCTGCTGGGCTTTGAGGG + Intronic
1057982047 9:99672152-99672174 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1058026241 9:100144416-100144438 GATGGCCTTTTGACCTTTTAGGG + Intronic
1059234821 9:112751943-112751965 CATGGCCATTTCAGCTGTGAAGG + Intronic
1059520067 9:114932642-114932664 GAAGGCCTGTGGGGCTGAGAAGG + Intergenic
1059574586 9:115475347-115475369 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1060748978 9:126156316-126156338 GATGGGCCCTAGGGCTGTGAGGG - Intergenic
1061179918 9:129019058-129019080 GAAGGACTTTTGGGGTGTGATGG + Intronic
1061583023 9:131549049-131549071 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1062038792 9:134394803-134394825 GGGGGCCTCTTGGGCTGGGAGGG + Intronic
1185858467 X:3556850-3556872 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1185952479 X:4451992-4452014 GTTGGCATGTTGGGCTGTGGGGG - Intergenic
1185991023 X:4893578-4893600 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1187086560 X:16048409-16048431 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1187191605 X:17040909-17040931 GATGGGCTTTGTGGTTGTGAAGG + Intronic
1187487535 X:19718932-19718954 GATGGCTGTCTGGGCTGTGTAGG - Intronic
1190748047 X:53338195-53338217 TCTGGCCTTTTGGGTTGTTATGG + Intergenic
1190798723 X:53769400-53769422 TCTGGCCTTTTGGGTTGTTATGG + Intergenic
1193329884 X:80223919-80223941 GATTCCCTTTTGGCCTGTGGTGG + Intergenic
1193941461 X:87683878-87683900 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1194186284 X:90777041-90777063 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1194308574 X:92276784-92276806 GATGGCCTTTTGACCTTTTAGGG + Intronic
1194367071 X:93024922-93024944 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1194596715 X:95867964-95867986 GCTGGTGTGTTGGGCTGTGAAGG - Intergenic
1194660649 X:96625993-96626015 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1195084157 X:101398498-101398520 GATGGCCCTCTGGGCTATCATGG - Exonic
1195291196 X:103433277-103433299 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1195734215 X:107996385-107996407 ACTGGCCTTTTGGGCTGTGTGGG + Intergenic
1195908714 X:109868936-109868958 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1196073048 X:111545906-111545928 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1196165510 X:112532605-112532627 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1196299976 X:114041972-114041994 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1196341752 X:114605023-114605045 GATGGCCTTTTGACCTTTTAGGG + Intronic
1196533574 X:116816185-116816207 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1196572466 X:117281148-117281170 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1196773888 X:119321487-119321509 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1196966723 X:121064632-121064654 ACTGGCCTTTTGGGCTGCGTGGG - Intergenic
1197184370 X:123570311-123570333 ACTGGCCTTTTGGGCTGTGTGGG + Intergenic
1197284252 X:124577323-124577345 CATGGTCTGTTGGGCTATGATGG - Intronic
1197933041 X:131714035-131714057 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1198599433 X:138268030-138268052 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1198753270 X:139956488-139956510 GATGACCTTTTTGGATATGATGG + Exonic
1199051532 X:143242193-143242215 CAAGGCCTTTGGGCCTGTGATGG + Intergenic
1199183193 X:144882632-144882654 GATGGCATTTTTGCTTGTGATGG - Intergenic
1199310099 X:146311686-146311708 CATGGCCTCTGGGCCTGTGATGG + Intergenic
1200532874 Y:4359118-4359140 GATGGCCTTTTGACCTTTTAGGG + Intergenic
1200611178 Y:5328503-5328525 GATGGCCTTTTGACCTTTTAGGG + Intronic
1200659580 Y:5943170-5943192 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1200675289 Y:6141178-6141200 GATGGCCTTTTGACCTTTTAGGG - Intergenic
1201744724 Y:17359498-17359520 GAAGGGCTTTTCTGCTGTGATGG + Intergenic