ID: 1126558152

View in Genome Browser
Species Human (GRCh38)
Location 15:50013335-50013357
Sequence TTGGGCTGTGAAGGTGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126558145_1126558152 11 Left 1126558145 15:50013301-50013323 CCATAGCTCTTCTAGGGGGACAT 0: 1
1: 0
2: 1
3: 3
4: 85
Right 1126558152 15:50013335-50013357 TTGGGCTGTGAAGGTGACACTGG 0: 1
1: 0
2: 2
3: 10
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126558152 Original CRISPR TTGGGCTGTGAAGGTGACAC TGG Intronic
900364191 1:2304136-2304158 GTGGGCTGTGGGGGTGGCACTGG + Intronic
901642282 1:10698845-10698867 ATGGGCCAAGAAGGTGACACTGG - Intronic
902881415 1:19374232-19374254 TTATGCTGAGAAGGTCACACTGG - Intronic
903323697 1:22557147-22557169 AAGGGCTGTGGAGGTGACAATGG + Intergenic
906384451 1:45355374-45355396 TTGGACTGTGAGGGTAAAACTGG - Exonic
907308868 1:53528150-53528172 TTGGGCTGAAAAGGTGACAAAGG + Intronic
915205772 1:154269460-154269482 TGAGGCTGTGAAGGTGAAATGGG - Intronic
915566282 1:156715011-156715033 TTGGGCTGTGTAGGCTACAATGG - Intergenic
918872286 1:189991106-189991128 TTGGGCTGTGAAAATGGAACTGG - Intergenic
919754674 1:201059295-201059317 TAGTGCTGTGGAGGGGACACAGG + Exonic
920045352 1:203128934-203128956 CTGGGCGGTGAAGGTGAACCAGG + Exonic
1064099556 10:12451527-12451549 TTAGTCTGTGAAGCTGAGACAGG - Intronic
1065442008 10:25762584-25762606 TGGGGCTGTGAAAATGATACTGG + Intergenic
1069742036 10:70690953-70690975 GTGGGCTATGATGGTGACAGAGG + Intronic
1069866674 10:71507978-71508000 TTGGGCTCTGAAGATGTCCCAGG + Intronic
1070450187 10:76550393-76550415 TTGTACAGTGAAGGTGAAACAGG + Intronic
1070589263 10:77789943-77789965 GTGGGCTGTCAAGGAGACAGAGG + Intergenic
1071563509 10:86660124-86660146 TTGGGCTGGGAAGGAGAGGCTGG - Intronic
1072308033 10:94126922-94126944 TTGGGCTTTGAGTGTGACAATGG + Intronic
1073077108 10:100830992-100831014 CTGGGCTGGGAAGGTGTCCCAGG - Intergenic
1073245271 10:102086006-102086028 GTGAGCTGTGAACGTGCCACTGG + Intergenic
1074468929 10:113709205-113709227 TCGGGCTGGGAAGGTCACACTGG - Intronic
1076209006 10:128625698-128625720 TCTGGCTGTGCAGGGGACACAGG + Intergenic
1076296810 10:129391926-129391948 ATGGACTGTGGTGGTGACACTGG + Intergenic
1077316834 11:1923144-1923166 TAGGGCTGTCAAGGGGACACAGG - Intronic
1077425515 11:2474143-2474165 TGGGGCTGTGCTGGGGACACTGG + Intronic
1082718885 11:56648874-56648896 TTGGGCTGTCATAGTGACAGAGG + Intergenic
1082975182 11:59063700-59063722 TTGGCCTTTGAAGCTGAGACGGG - Intergenic
1082979618 11:59107440-59107462 TTGGCCTTTGAAGCTGAGACAGG - Intronic
1083900591 11:65641471-65641493 TTGGGCAGTGCAGGGGGCACAGG - Exonic
1084776235 11:71378410-71378432 GTCTGCTGTGAAGGCGACACTGG - Intergenic
1084938128 11:72598102-72598124 TTGGGCTGTGCACGGGACATAGG - Intronic
1086614202 11:88795285-88795307 CTGGGCTGTGAATCTGAAACTGG - Intronic
1087292872 11:96339493-96339515 CTGGGCTGTGAAGGCCACAAGGG + Intronic
1091929504 12:4383508-4383530 TTGGGCTCCTAAGGTCACACTGG - Intergenic
1091929646 12:4384625-4384647 TTTTGCTGTCAAGATGACACTGG - Intergenic
1093704759 12:22262343-22262365 TCGGGCTTTGAAAGTGACTCTGG - Intronic
1096042350 12:48528635-48528657 TTGGGCTCTGGAGGGGGCACTGG - Intronic
1097726323 12:63079441-63079463 TTTGGCTGTGAATGAGCCACTGG - Intergenic
1100302121 12:93317294-93317316 TTGGACTGTAAACCTGACACAGG - Intergenic
1102949289 12:117018841-117018863 TTTGGCTGTTAAGGAGACAAAGG - Intronic
1103627111 12:122227599-122227621 GTGGGCTGTGGTGGCGACACAGG - Intronic
1103743700 12:123108016-123108038 ATGGGCTTGGAAGGTGAAACAGG + Intronic
1104772298 12:131371051-131371073 TGGGGCTCTGATGGAGACACAGG - Intergenic
1107149020 13:37090810-37090832 GTGGGCTGTGAAGGAGAAGCAGG + Intergenic
1107786442 13:43962526-43962548 TTGTGCTGAGGAGGTGGCACTGG + Intergenic
1108516827 13:51211449-51211471 CTGGACTGAGGAGGTGACACAGG + Intergenic
1110555700 13:76856790-76856812 TTGGGGTGTAAAGGGGACAGGGG + Intergenic
1112148066 13:96723658-96723680 GTGGGCTGTGAATGCAACACAGG - Intronic
1115833858 14:37375262-37375284 GTGAGCTGTGATTGTGACACTGG - Intronic
1119505960 14:75173331-75173353 GTGAGCTGTGATGGTGCCACTGG + Intronic
1121235742 14:92390153-92390175 CTGGGCTCTGGAGGGGACACAGG - Intronic
1121413233 14:93762155-93762177 TTGGGCTGGGAAGGTGGGGCCGG - Intronic
1121503973 14:94462191-94462213 GTGGGCTGTGAAGGTCTCCCCGG - Intergenic
1122609606 14:102972807-102972829 TGCGGCTGTGCAGGTGACACTGG - Intronic
1124248917 15:28094997-28095019 TTGGGCCGAGCAGGTGACCCAGG - Intronic
1124530716 15:30503296-30503318 TTATGCTGTGGAGATGACACAGG + Intergenic
1124767944 15:32504399-32504421 TTATGCTGTGGAGATGACACAGG - Intergenic
1126558152 15:50013335-50013357 TTGGGCTGTGAAGGTGACACTGG + Intronic
1126859649 15:52871384-52871406 TTGGGCTGTGGAGGGGACCGTGG + Intergenic
1128223342 15:65983797-65983819 TGGGACTGGGAAGGTGTCACTGG + Intronic
1128632826 15:69282773-69282795 CTGGGCTGTGGCGGTCACACGGG + Intergenic
1128890923 15:71331194-71331216 TTGGCTTGTGATGGTGACAGAGG + Intronic
1131135718 15:89933597-89933619 GTGGGCTGTGAAGTTGCCAGAGG - Intergenic
1131985672 15:98041075-98041097 TTGGGCTTTTACTGTGACACTGG - Intergenic
1132171441 15:99660563-99660585 TTGGGCTCTGAATCTCACACAGG + Intronic
1132830869 16:1927431-1927453 TTGGGCTGGGGAGGTGGCATTGG + Intergenic
1134914678 16:18059865-18059887 TAGGGGTGTGAAAGTGAAACAGG - Intergenic
1135917015 16:26614352-26614374 TTTAGCTGTGAAGCTGACAGGGG + Intergenic
1138037086 16:53619060-53619082 TTGGGTTTTGGAAGTGACACGGG + Exonic
1138150234 16:54650136-54650158 TAGGGCTCTGAAGATGCCACGGG + Intergenic
1138376369 16:56566986-56567008 TTGACTTGTGAAGGTGACACGGG + Intronic
1138480489 16:57299584-57299606 TCGGGCTGTGAATGGGGCACTGG - Intergenic
1139034980 16:62934124-62934146 TTGGACTGTGCAGTTGAGACTGG + Intergenic
1139132049 16:64158403-64158425 TTGGGCTGTGGAGGGCACACTGG + Intergenic
1140530397 16:75660834-75660856 TTGGAGTATGGAGGTGACACAGG - Intronic
1140536507 16:75714756-75714778 ATGGGGTATGGAGGTGACACAGG - Intronic
1140722264 16:77782612-77782634 GAGGTCTGTGAAGGTGAGACAGG - Intergenic
1141731448 16:85825567-85825589 TTGGGATGTGCAGGTGGCTCGGG - Intergenic
1149917440 17:60623672-60623694 CAGAGCTGTGGAGGTGACACAGG + Exonic
1151340991 17:73470950-73470972 CAGGGCTGGGAAGGTAACACTGG + Intronic
1151406954 17:73894202-73894224 TTGGGCTGACAAAGGGACACCGG + Intergenic
1151495791 17:74457422-74457444 GTGGGCTGAGAAGGAGGCACGGG + Intergenic
1151524348 17:74653997-74654019 CTGTGCTCTGGAGGTGACACTGG + Intergenic
1151822996 17:76507140-76507162 CTGGGCTGAGCAGGTGACAGGGG - Intergenic
1152255732 17:79238416-79238438 ATGGGCTGAGAAGGTGAAGCAGG + Intronic
1152410399 17:80120175-80120197 ATGGGACGTGAAGGTGACATGGG - Intergenic
1152531664 17:80922686-80922708 TGGGGGTGTGAAGGTCAGACGGG - Intronic
1156563863 18:38161040-38161062 TTGGGATGTGATTGTGACAAGGG + Intergenic
1160254506 18:77236388-77236410 TTGGGAAGTGATGGTGACAAAGG - Intergenic
1161272767 19:3399039-3399061 TTGGGCTGTGACGCTGGCTCTGG + Intronic
1161959179 19:7514186-7514208 ATGGGTTGAGAAGGTGACATTGG - Intronic
1162468066 19:10854683-10854705 TTGTGCTGAGAAGGTGACTCTGG + Intronic
1164435193 19:28222710-28222732 TTGGGCAGTGAGGCTGTCACTGG - Intergenic
1164903465 19:31947694-31947716 CTGGGCTGTGATGGTGACGTAGG - Intergenic
1166039432 19:40192625-40192647 CTGGGCTGTGCAGGTGGCCCGGG + Exonic
1167277203 19:48545625-48545647 TCGGGCTCTGGAGGTGACAATGG + Intergenic
926766472 2:16326505-16326527 TTGGGCCTTGAAGGTGAGGCAGG - Intergenic
927454966 2:23241441-23241463 TTGGGCTGTGAAGGAAACAAAGG - Intergenic
929982444 2:46694242-46694264 TGGGGCTGTGAAGGACAGACAGG + Intergenic
934083835 2:88492687-88492709 TTACGATTTGAAGGTGACACTGG - Intergenic
936696495 2:114955480-114955502 TTCGGCTGTGAAGCTGTCAGAGG - Intronic
937111978 2:119373461-119373483 TTGGGCTGTGCAGCTCACTCCGG + Intergenic
937152459 2:119695430-119695452 CTGGGCTGTGAATGTCTCACAGG + Intergenic
938454078 2:131446355-131446377 ATAGGCTGTGGAGATGACACTGG + Intergenic
943427852 2:187758990-187759012 TTGGGCCTTGAAGGGAACACTGG - Intergenic
944449978 2:199833023-199833045 GTGAGCTGTGATGGTGCCACTGG - Intronic
1168788168 20:557486-557508 TTGGGCTTTGAAGGAGCCATGGG + Intergenic
1169386472 20:5154263-5154285 TTGGGCTGTGAAGTGTTCACTGG + Intronic
1170948531 20:20913124-20913146 TTGTGCTGAGAAGGTGACCTGGG + Intergenic
1172290308 20:33771304-33771326 GTGAGCTGTGATGGTGCCACTGG - Intronic
1172987395 20:39003213-39003235 ATGAGCTGTAAAGGTGTCACTGG - Intronic
1173534290 20:43797645-43797667 CTGGGTTGTGAAGGAGAAACAGG - Intergenic
1175454019 20:59096169-59096191 TGGGCCAGTGAAGGTGAGACTGG + Intergenic
1175886386 20:62293559-62293581 TTGGGAAGTGAAATTGACACGGG + Intronic
1176122393 20:63460080-63460102 CTGGGCTGGGATGGGGACACTGG - Intronic
1178969331 21:37157627-37157649 ATGGGCTGTGAACGTGAAAGTGG + Intronic
1179410787 21:41161588-41161610 CTGGGCTGTCAAGGGGTCACAGG + Intergenic
1181902320 22:26166905-26166927 GTAGGCTGTGAAGGTGAAATGGG + Intergenic
949762599 3:7487822-7487844 TGGGGTTGTGAGGGTGACTCTGG - Intronic
949997506 3:9629848-9629870 GTGGGCTGTGAAGCCGAGACGGG + Intergenic
953069644 3:39506407-39506429 TTGGGAGGTGAAGGGGACACTGG + Intronic
957127154 3:76176230-76176252 TTAGGCTGTGAAGGTGGCGGTGG - Intronic
957371678 3:79301815-79301837 TTGGGCTGTGAAGCTGACCTTGG + Intronic
958192564 3:90201579-90201601 TTTGGCTGTGTGGGTCACACAGG - Intergenic
959231756 3:103663197-103663219 TTGTGCTCAGAAGGTGAAACAGG - Intergenic
961305377 3:125955970-125955992 TCTGACTGTGAAAGTGACACTGG - Intergenic
963292342 3:143504419-143504441 ATGGGCTGTAGAGGTGGCACAGG + Intronic
964718726 3:159750631-159750653 TTTAGCTGTGAAGGACACACAGG - Intronic
969105666 4:4805426-4805448 CTGGGCTTTGAAGCTCACACAGG + Intergenic
969832200 4:9806960-9806982 GTGGGCTGAGAAGGGGACTCAGG - Intronic
969998240 4:11337143-11337165 TTTGGCTGTAAAAGTGAAACTGG + Intergenic
976621669 4:87134614-87134636 ATGGGATGTGATGGTGACATAGG - Exonic
977840591 4:101698341-101698363 TTGGGCACTGGAGGTGACATAGG - Intronic
978511508 4:109524348-109524370 TTGAGCTGAGAAGGTGACACTGG - Intronic
980063988 4:128162290-128162312 CTGGACTGTGAAGGTGCTACAGG - Exonic
982863429 4:160482058-160482080 TTGGGCTGTGGAGGAGCCCCCGG - Intergenic
982876535 4:160658710-160658732 TATGGTTGTGAAGGTGATACAGG + Intergenic
985330157 4:188823165-188823187 TTGGTCTTTGCAGGTGAGACTGG - Intergenic
986483665 5:8214087-8214109 TGAGGCTGTGAGGGAGACACTGG + Intergenic
987797078 5:22641496-22641518 TGGGCCTGTGAGGGTGACTCTGG - Intronic
990967522 5:61465018-61465040 GTGGGGTGTGCAGGTGACAAGGG + Intronic
994520781 5:100831869-100831891 AGGGGCTGGAAAGGTGACACAGG + Intronic
1002063079 5:176637921-176637943 TTGGGCTGGGATGGTGGCAATGG + Intronic
1002199259 5:177518051-177518073 CTGGGATGTGAAGGATACACAGG + Intergenic
1002199352 5:177518774-177518796 CTGGGATGTGAAGGATACACAGG + Intergenic
1002948311 6:1783866-1783888 TTGCGATGTGAAGGTTACTCTGG + Intronic
1005705967 6:28453463-28453485 TTGGGCTATGAATGTGTGACAGG - Intergenic
1005859528 6:29889703-29889725 TTGGGCTGGGAAGATGGCTCTGG - Intergenic
1007461683 6:42023933-42023955 TTAGGCTGTTATTGTGACACAGG - Intronic
1010477451 6:76305721-76305743 TTGGACAGAGCAGGTGACACAGG - Intergenic
1013251455 6:108338128-108338150 GTGAGCTGTGATGGTGCCACTGG + Intronic
1014553247 6:122813543-122813565 TTGGGCTGAGGAGGTGGCAGTGG + Intergenic
1016948600 6:149558039-149558061 TTTTGATATGAAGGTGACACTGG - Intergenic
1017079998 6:150659060-150659082 GACGGCTGTGAAGATGACACTGG - Intronic
1017783165 6:157732317-157732339 TGGGGCTGAGCAGGTGACCCAGG - Intronic
1018444715 6:163844863-163844885 TTGGACTTTGAAGGTGAGAAGGG + Intergenic
1019068902 6:169325596-169325618 ATGGGTTGTGAAGTGGACACAGG + Intergenic
1019217496 6:170453309-170453331 TTGGGATGAGAAGGTGAGAAAGG - Intergenic
1019662491 7:2232626-2232648 TTGGGCTGTGCTGGGGACAGCGG - Intronic
1020348409 7:7190272-7190294 CTGGGCTGAGAAGCTGACTCAGG + Intronic
1021523231 7:21557168-21557190 TTGGGCTGTGAGGACGGCACGGG - Intronic
1023857012 7:44190110-44190132 TTGGGCTGCGAAGGGGAGAGTGG - Intronic
1024175030 7:46830827-46830849 TTTTGCTGTTAAGGTGATACTGG - Intergenic
1025069226 7:55884397-55884419 TTGGGTTTTGGAGGTGAGACAGG - Intergenic
1025611079 7:63076120-63076142 TTGGGCTGTGTAAGTTTCACTGG + Intergenic
1026912769 7:74101116-74101138 TTGAGATGTGAAGGTGGCCCTGG + Intronic
1027440248 7:78211498-78211520 CTGGGCTGTGAGGGAGACCCTGG + Intronic
1030186101 7:106763813-106763835 TTGGGTTGAGAAGGTTACATGGG - Intergenic
1030731117 7:112990516-112990538 TTTGGCTCTGAAAGTGACAGGGG + Intergenic
1032416024 7:131736349-131736371 TTGGGCTGTGAACCACACACAGG - Intergenic
1034359251 7:150479728-150479750 TATGGCTGAGCAGGTGACACTGG + Intergenic
1034488498 7:151380881-151380903 TTAGCCTGTGCAGGTGACAGCGG - Intronic
1034588756 7:152120510-152120532 CTGGACTGTGTAGGTGACAGAGG - Intronic
1035323327 7:158048676-158048698 TTGTGATGTGATGGTGACAGTGG - Intronic
1036165205 8:6426265-6426287 TTTGGTTGTGGTGGTGACACAGG - Intronic
1038296776 8:26299204-26299226 TTAGGCTGTGATTGTGCCACTGG + Intronic
1040755805 8:50772545-50772567 TTGGGCTTTCAAGGTGATGCTGG + Intronic
1046531045 8:115445202-115445224 CTGAGCTGTGAAGTTTACACAGG - Intronic
1048815496 8:138330072-138330094 TTGGGGTGGGAAGGGGAGACTGG - Intronic
1049545754 8:143229764-143229786 TTGGTCTGAGCAGGTGACCCGGG - Intergenic
1055552499 9:77444648-77444670 TGGAGCTGTGAAGAAGACACTGG - Intronic
1056738206 9:89227538-89227560 TGGGGCTCTGAAGCTGCCACTGG - Intergenic
1057757532 9:97849831-97849853 TTGGGCTGAGAAGGAAACTCAGG - Intergenic
1058120034 9:101127976-101127998 TTGGGCTGTGTAGGTGATACTGG + Intronic
1060410665 9:123398108-123398130 CTGGGCTGTGAAGATTAAACAGG + Intronic
1189446952 X:41088624-41088646 TTGGGCAGTGAAGGTGAGGGGGG + Intronic
1189679667 X:43502625-43502647 TTGGGCTGTGGACTTGAAACTGG - Intergenic
1192329307 X:70161848-70161870 TTGGGCTGTGAGGGTGCAGCTGG - Intronic
1193699337 X:84743149-84743171 ATGGGATATGAAGGTGTCACTGG - Intergenic
1195677806 X:107520602-107520624 TTGAGCTGTGATGGTTCCACTGG + Intergenic
1195762926 X:108266309-108266331 TTGGCCTGTGATTGTGACTCTGG - Intronic
1197535005 X:127676647-127676669 TTTGTCTGTGAAGGTGATTCTGG + Intergenic
1197762731 X:130039119-130039141 CTGGCCTGTGGAGGTGATACAGG - Exonic
1200052824 X:153443959-153443981 TGGTGCTGTGAGGGTGACCCTGG - Intergenic
1200114622 X:153764725-153764747 GTGGCCTGTGAGGGTGACAGGGG + Intronic
1200305788 X:155024825-155024847 TTGGGCTATGATGGTACCACTGG + Intronic