ID: 1126559448

View in Genome Browser
Species Human (GRCh38)
Location 15:50027156-50027178
Sequence GGGTGCACACATATGGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126559448_1126559454 -3 Left 1126559448 15:50027156-50027178 CCCTACCCCATATGTGTGCACCC 0: 1
1: 0
2: 1
3: 11
4: 176
Right 1126559454 15:50027176-50027198 CCCAAAGCACCCAGTGCACCTGG 0: 1
1: 0
2: 0
3: 17
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126559448 Original CRISPR GGGTGCACACATATGGGGTA GGG (reversed) Intronic
902395917 1:16132494-16132516 GTGGGCACAGATATGGGGGAAGG + Intronic
905060718 1:35137006-35137028 GGGTGCAGAGATAAGGGGTCAGG + Intergenic
905119036 1:35667606-35667628 CGGTGCATACACATGGGGCAGGG - Intergenic
905904003 1:41604628-41604650 GGGTGCTGACATATGGTGTCTGG - Intronic
906074965 1:43045403-43045425 GTGTGGAAACAGATGGGGTATGG + Intergenic
909035294 1:70589447-70589469 GGGTGCAGAAATAAGGGGTTGGG - Intergenic
909793143 1:79700895-79700917 GGGTGCAGAGATATGAGGTTGGG + Intergenic
911456245 1:98127838-98127860 AGGTGCAAACAGATGTGGTACGG + Intergenic
912364682 1:109123196-109123218 AGGGGCATACATATGGGGGATGG + Intronic
915474735 1:156146991-156147013 GGTGGCACGCATATGGGGGAGGG + Intergenic
919476184 1:198035711-198035733 GGGTGCAGAGATATGAGGTTGGG - Intergenic
921701358 1:218272308-218272330 GGGTGCACATGGATGGGGGAGGG - Intergenic
923769745 1:236927957-236927979 GTGTCCACTCATATGGGGGAGGG + Intergenic
923962616 1:239102476-239102498 GGGTGCAGAAATAAGGGGTTGGG - Intergenic
1063189311 10:3678831-3678853 GGGTGCACATATGGGGTGTAAGG - Intergenic
1063218810 10:3947671-3947693 GGCTGCACATAAATGGGGCAGGG + Intergenic
1063509790 10:6634248-6634270 GGGTGCAGAGATATGAGGTTGGG + Intergenic
1063509800 10:6634290-6634312 GGGTGCAGAGATATGAGGTTGGG + Intergenic
1063527867 10:6801745-6801767 GGGTGCAGAGATATGAGGTTGGG + Intergenic
1068592529 10:58865659-58865681 GGGTGCAGAGATATGAGGTTGGG + Intergenic
1070255927 10:74813316-74813338 GGGTGCACTCAGATGGAGAAAGG + Intergenic
1071897909 10:90085658-90085680 GGGTGCAGAAATAAGGGGTAGGG + Intergenic
1072036420 10:91566878-91566900 GGGTGTACCCATAGCGGGTAAGG - Intergenic
1072038588 10:91586667-91586689 GTGTGAACAGATTTGGGGTAAGG + Intergenic
1073077783 10:100835569-100835591 GGGTGCACTCAGATGGGGAAGGG + Intergenic
1076996004 11:297893-297915 GGGTGGACACACGTGGGGTTGGG + Intergenic
1083049832 11:59767176-59767198 GGGGGCACACTTGAGGGGTAGGG + Intronic
1085461958 11:76699508-76699530 GGGGGCACACATCTGAGGCAGGG - Intergenic
1087098916 11:94346781-94346803 GGGCGCAGAGATATGAGGTAGGG - Intergenic
1087098924 11:94346823-94346845 GGGTGCAGAGATATGAGGTCAGG - Intergenic
1089329353 11:117679000-117679022 GATGGCACACATATGGGGGAGGG + Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1092789515 12:12059387-12059409 GGGTGCAGAGATATGAGGTTGGG - Intronic
1093700601 12:22215999-22216021 GGGTGCACAGAAAAGGGGAATGG - Intronic
1097542388 12:60956632-60956654 GGGTGCAGAGATAAGGGGTAGGG + Intergenic
1098628885 12:72704443-72704465 GGGTGCAGAAATAAGGGGTAGGG - Intergenic
1098980385 12:76949758-76949780 GGGTGCACACTGGTGGGGGAAGG + Intergenic
1099188524 12:79540940-79540962 GGGTGCAGAAATAAGGGGTTGGG - Intergenic
1099188539 12:79541005-79541027 GGGTGCAGAGATATGAGGTTGGG - Intergenic
1100217507 12:92467638-92467660 AGGTGCTCACAGGTGGGGTAAGG + Intergenic
1103364800 12:120374053-120374075 GGTTACACACATGTGGGGTCAGG - Intergenic
1107075403 13:36317547-36317569 GGGTGCAGAAATAAGGGGTCAGG - Intronic
1107220470 13:37973776-37973798 GGGTGCAGAGATAAGGGGTTGGG + Intergenic
1107446530 13:40474417-40474439 GGGTGAACAGATATGGAGGATGG + Intergenic
1107791204 13:44004151-44004173 GGCTGAACACATATGGGATGTGG - Intergenic
1109249122 13:59997153-59997175 GGGTGCAAACATATGGTAGAAGG - Intronic
1111301850 13:86359416-86359438 GGGTGCAGAGATATGAGGTTGGG - Intergenic
1111459019 13:88517427-88517449 GGGTGCAGAAATAAGGGGTTGGG + Intergenic
1111631878 13:90853186-90853208 GGGTGCAGAAATAAGGGGTCGGG + Intergenic
1113933292 13:113979976-113979998 GGGTGCACACACATGGGAGGAGG - Intronic
1113933353 13:113980325-113980347 AGGTGCACACATGTGGGAGAAGG - Intronic
1113946832 13:114049029-114049051 GGGTGCATTCCTATGGGGTCGGG - Intronic
1114545101 14:23494196-23494218 GGATGCGCACATGTGGGGTGGGG - Intronic
1120901355 14:89578564-89578586 GAGTGAACACATTTGGGGTGGGG - Intronic
1123412524 15:20072408-20072430 GTGTTTACACATATGGGGTTTGG + Intergenic
1123521866 15:21079521-21079543 GTGTTTACACATATGGGGTTTGG + Intergenic
1126559448 15:50027156-50027178 GGGTGCACACATATGGGGTAGGG - Intronic
1129034291 15:72640345-72640367 GGGTGCTCACACATGGGGCACGG - Intergenic
1129215591 15:74096871-74096893 GGGTGCTCACACATGGGGCACGG + Intergenic
1129732727 15:77941200-77941222 GGGTGCTCACACATGGGGCACGG + Intergenic
1130854892 15:87832219-87832241 GGGTGCAGAGATATGAGGTTGGG - Intergenic
1130862407 15:87902919-87902941 GGGTGCAGACATGTAGGGTGGGG - Intronic
1130947647 15:88561052-88561074 GGGTGCAGACATAAGAGGTCAGG + Intergenic
1131540071 15:93268393-93268415 GGCTGCACAGATTTGGGGTTTGG + Intergenic
1131705867 15:94995373-94995395 AGGTGTACAAATATGGGGAAGGG - Intergenic
1132262821 15:100441349-100441371 GGGTGCAGAGATAAGGGGTCGGG - Intronic
1138759288 16:59522250-59522272 GGGTGCAGAGATATGAGGTTGGG + Intergenic
1138804730 16:60079779-60079801 GGGTGCAGAGATATGAGGTTGGG - Intergenic
1139426160 16:66881019-66881041 GGGGGCACCCAGCTGGGGTACGG + Intronic
1140141487 16:72262316-72262338 GGGTGCACAGATTTGCTGTAGGG - Intergenic
1140476354 16:75241173-75241195 GTGTTTACACATATGGGGTTTGG + Intronic
1142510079 17:387390-387412 GGGTGCACACGTGTGGAGTGAGG - Intergenic
1142510093 17:387444-387466 GGGTGCACACGTGTGGAGTGAGG - Intergenic
1142510107 17:387498-387520 GGGTGCACACGTGTGGAGTGAGG - Intergenic
1142510121 17:387552-387574 GGGTGCACACGTGTGGAGTGTGG - Intergenic
1142510135 17:387605-387627 GGGTGCACACGTGTGGAGTGAGG - Intergenic
1142510149 17:387658-387680 GGGTGCACACGTGTGGAGTGCGG - Intergenic
1146123105 17:30211952-30211974 GGGTGCCCTCGTTTGGGGTATGG + Intronic
1146630334 17:34464959-34464981 GGGAGCACACATATGGGGGATGG - Intergenic
1155697189 18:28697691-28697713 GGGTGCAGAGATATGAGGTTGGG + Intergenic
1157713841 18:49868830-49868852 AGGTGCCCCCATTTGGGGTAAGG - Intronic
1158850724 18:61493584-61493606 GTGGGCACACATGTGGGGTCAGG - Intronic
1161501895 19:4620788-4620810 GGGTGCACAGACTTGGGGTGAGG + Intergenic
1163487109 19:17594534-17594556 GGGTGCAAAAATAAGGGGTTGGG - Intergenic
1164459401 19:28434447-28434469 GGGTGCAGAAATAAGGGGTTGGG + Intergenic
1165494265 19:36142491-36142513 GGGTGCACGTATGTGGGGCATGG - Intronic
1166048781 19:40245743-40245765 GGGTGGACATAGATGGGTTATGG - Intronic
1166499106 19:43328062-43328084 GGGTGCAGACATAAGAGGTTGGG + Intergenic
1166859010 19:45798886-45798908 GGGTGGACACAGATTGGGTGGGG + Intronic
1168308217 19:55447653-55447675 GGCTGCATCCATTTGGGGTAAGG + Intergenic
925544367 2:5002075-5002097 GGGTGCAGAAATAAGGGGTCAGG - Intergenic
926918794 2:17918812-17918834 AGGTGTACACAAATGGGCTATGG + Intronic
927706107 2:25297423-25297445 GGGTGCAGGCCTATGGGGTGGGG - Intronic
928838923 2:35581631-35581653 GGGTGTGCACATGTCGGGTAGGG + Intergenic
931761591 2:65422246-65422268 GGGTTCTCATATTTGGGGTAGGG - Intronic
932295656 2:70621629-70621651 GGGTGCAGAGATATGAGGTTGGG - Intronic
933012883 2:77089345-77089367 GGGTGCAGAGATATGAGGTTGGG - Intronic
933897945 2:86827643-86827665 GGGTAGACAAATATGGGGCAGGG + Intronic
933967189 2:87439755-87439777 GGGAGAACACATGTGGGGTTAGG + Intergenic
936326606 2:111510740-111510762 GGGAGAACACATGTGGGGTTAGG - Intergenic
937434274 2:121867362-121867384 GGGGGCACTCAGCTGGGGTATGG + Intergenic
938498736 2:131818684-131818706 GGGTGCTCACAGATGGGGATGGG + Intergenic
940676009 2:156724809-156724831 GGGTGCAGAGATATGAGGTTGGG + Intergenic
940852301 2:158700158-158700180 AGGTGCACATCTTTGGGGTATGG - Intergenic
943413111 2:187565089-187565111 GGGTGCAGAAATAAGGGGTCGGG + Intronic
947746007 2:232507696-232507718 ATGTGCACACACATGGGGGAAGG + Intergenic
948570252 2:238913267-238913289 GGGTGCAGACATGTGGGGTGAGG + Intergenic
1177102512 21:16915123-16915145 GGGTGCAGAAATAAGGGGTTGGG - Intergenic
1177119377 21:17122562-17122584 GGGTGCAGAAATAAGGGGTAGGG - Intergenic
1179315041 21:40236479-40236501 GGGTACAAATACATGGGGTAAGG + Intronic
1180615572 22:17123695-17123717 GGGTCCACCCATGTGGGGCAGGG + Intronic
1180790589 22:18573580-18573602 GGGTGATCACACATGGGGTGTGG - Intergenic
1181231149 22:21421735-21421757 GGGTGATCACACATGGGGTGTGG + Intronic
1182078411 22:27511131-27511153 GTGTGCACAGATATGGGAGAGGG + Intergenic
950926331 3:16745461-16745483 GGGTGCAGAGATATGAGGTCAGG - Intergenic
953724867 3:45388953-45388975 GGGAGCAAAGATCTGGGGTAGGG - Intronic
959439371 3:106358121-106358143 GGGTGCACATATATTGGCTGTGG + Intergenic
960995666 3:123338626-123338648 GGGTGCACAGAACTGGGATAGGG + Intronic
961244369 3:125438498-125438520 AAGTGCACACATATTGGGTGAGG + Intergenic
963684148 3:148415447-148415469 GGGTGCAGAAATAAGGGGTCGGG - Intergenic
964125692 3:153231522-153231544 GGGTGCAGAGATAAGGGGTCAGG + Intergenic
964591766 3:158371375-158371397 GGGTTCACAAAAAAGGGGTATGG - Intronic
965070120 3:163908505-163908527 AGGTGCACAGATAAGGGGTCGGG - Intergenic
965626516 3:170688055-170688077 GGGTGCAGAGATATGAGGTTGGG + Intronic
966763166 3:183434902-183434924 ATGTGCACACATGGGGGGTAGGG + Intergenic
966806132 3:183809000-183809022 GGTTTCAAACATTTGGGGTAAGG + Intronic
968993199 4:3928428-3928450 GGGTGCAGAGATAAGAGGTAGGG - Intergenic
969264848 4:6057674-6057696 GGGTGCACACAGAGGTGGGAGGG - Intronic
970854241 4:20634937-20634959 GGGTGCAGAGATAAGGGGTCAGG + Intergenic
972644446 4:40954330-40954352 GGGTGCACAAATGTTGGGGAAGG - Intronic
974745920 4:66075478-66075500 GGGTGCACACACATTGGCTTAGG + Intergenic
975865273 4:78718477-78718499 GGGTGCAGAAATAAGGGGTTGGG + Intergenic
975865312 4:78718647-78718669 GGGTGCAGAGATATGAGGTTGGG + Intergenic
977010137 4:91625188-91625210 GGGTGCAGAAATAAGGGGTCGGG - Intergenic
977013110 4:91659243-91659265 GGGTGCAGAAATATGAGGTTGGG + Intergenic
977062696 4:92276135-92276157 GGGTGCAGAGATATGAGGTTGGG + Intergenic
977225549 4:94388188-94388210 GGGTGCAGAGATAAGGGGTTGGG + Intergenic
979773489 4:124558912-124558934 GGGTGCACATATCTGGGTAAAGG + Intergenic
982084137 4:151817199-151817221 GGGTGCAGAGATATGAGGTTGGG + Intergenic
982227916 4:153182640-153182662 GGGTGCACACAAATATGGAATGG + Intronic
982535264 4:156601389-156601411 GGGTGCAGAAATAAGGGGTCAGG - Intergenic
983452167 4:167924040-167924062 GGGTGCAGAGATATGAGGTCGGG - Intergenic
983659360 4:170117327-170117349 GGGTGCAGAGATATGAGGTTGGG - Intergenic
986667767 5:10118078-10118100 GGGTGCCCACTTTTGGGTTATGG - Intergenic
987755607 5:22095743-22095765 GGGTGCAGAGATAAGGGGTCGGG - Intronic
994106950 5:95959964-95959986 GTGTGCACACTTATGGGGTGGGG + Intronic
994779203 5:104069200-104069222 GGGTGCAGAGATATGAGGTTGGG + Intergenic
994989366 5:106979494-106979516 GGGTGCAGAAATAAGGGGTCGGG - Intergenic
1000935852 5:167302619-167302641 GGGTGCAGAGATAAGGGGTCAGG + Intronic
1001331687 5:170766840-170766862 GGGTGCAGAGATATGAGGTTGGG + Intronic
1004836831 6:19540030-19540052 GGGTGCAGAAATAAGGGGTTGGG - Intergenic
1005014844 6:21366111-21366133 GGGTGCAGAAATAAGGGGTTGGG + Intergenic
1012315637 6:97780687-97780709 GGGTGCAGAAATAAGGGGTCGGG - Intergenic
1012774748 6:103484877-103484899 GGGTGTACACACCTGGGATATGG + Intergenic
1014555663 6:122840953-122840975 GGGTGCAGAAATAAGGGGTTGGG - Intergenic
1015269488 6:131324530-131324552 GGGTGCAGAAATAAGGGGTCGGG - Intergenic
1019427020 7:982730-982752 GGGTGCACACGGATGGGGTTTGG + Intergenic
1019611419 7:1938703-1938725 AGGTGCACACACATGGGCCAGGG + Intronic
1020532896 7:9358023-9358045 GGGTGCAGAAATAAGGGGTCGGG + Intergenic
1020541312 7:9463133-9463155 GGGTGCAGAAATAAGGGGTTGGG + Intergenic
1021266671 7:18532935-18532957 GGGTGAACACATATGGGTACAGG - Intronic
1026608295 7:71834786-71834808 TGGGGCACATATATGGTGTATGG + Intronic
1031525401 7:122817991-122818013 GGGTGCAGAAATAAGGGGTCGGG - Intronic
1031777166 7:125918731-125918753 GGGTGCAGAAATAAGGGGTTGGG - Intergenic
1033176371 7:139127587-139127609 GTGGGCACACATAAGGGGTTGGG + Intergenic
1036071105 8:5441249-5441271 GGGTGCACAGATAAGAGGTCAGG + Intergenic
1045197281 8:99944744-99944766 GGGTGCAGAGATATGAGGTTGGG - Intergenic
1045950079 8:107841566-107841588 GGGGGCAAACATATGGGATTTGG - Intergenic
1046386521 8:113514117-113514139 GGGTGCAGAAATAAGGGGTCAGG + Intergenic
1048097404 8:131311174-131311196 GGGTGCAGAGATATGAGGTTGGG - Intergenic
1052517031 9:29495062-29495084 GGGTGCACACATGAGGGGAGGGG + Intergenic
1055809833 9:80138343-80138365 GGGTGCAGAGATATGAGGTTGGG - Intergenic
1056779839 9:89541139-89541161 GGGTGCCCAGATATGTGGTCAGG - Intergenic
1057234655 9:93348696-93348718 GGGTGCAGAAATAAGGGGTCGGG - Intergenic
1061720943 9:132550999-132551021 CAGTGAACACATTTGGGGTAGGG + Intronic
1189279201 X:39809340-39809362 GGGCGCACAGAGATGGGGGAGGG - Intergenic
1190627084 X:52346544-52346566 GGGTGCACAGCTATAGGGTGAGG + Intergenic
1190700943 X:52989587-52989609 GGGTGCACAGCTGTGGGGTGAGG - Intronic
1191208334 X:57857433-57857455 GGGTGCATATATATTTGGTATGG - Intergenic
1191695547 X:63986054-63986076 GGGTGCACACTTATCGGCTGTGG - Intergenic
1191833139 X:65436443-65436465 GTGTCCACACATATTGGGTGAGG + Intronic
1194934909 X:99937268-99937290 TGGTGAGCACATGTGGGGTAAGG + Intergenic
1195979990 X:110567356-110567378 GGCTGCAGAAATATGGGGCAGGG - Intergenic
1196165364 X:112531707-112531729 GGGTGCAGAAATAAGGGGTTGGG - Intergenic
1196330638 X:114467855-114467877 GGGTGCAGAAATAAGGGGTCGGG - Intergenic
1197361009 X:125504131-125504153 GAGTGCCCAGATCTGGGGTAGGG + Intergenic
1198598255 X:138259795-138259817 GGGTGCAGAAATAAGGGATAGGG - Intergenic
1198599571 X:138268912-138268934 GGGTGCAGAGATATGAGGTTGGG + Intergenic
1201921589 Y:19239694-19239716 GGAAGCACACATATGGTGTTGGG + Intergenic