ID: 1126560656

View in Genome Browser
Species Human (GRCh38)
Location 15:50040237-50040259
Sequence CCCAGCTAGAAGAAAGCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 409}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126560656_1126560662 23 Left 1126560656 15:50040237-50040259 CCCCTGGCTTTCTTCTAGCTGGG 0: 1
1: 0
2: 3
3: 22
4: 409
Right 1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG 0: 1
1: 0
2: 1
3: 9
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126560656 Original CRISPR CCCAGCTAGAAGAAAGCCAG GGG (reversed) Intronic
900135945 1:1117006-1117028 CCCAGCTAGGAGAGGGCCCGGGG - Intergenic
900201295 1:1407801-1407823 CCCAGCTACTAGGAAGGCAGAGG - Intergenic
901022679 1:6263007-6263029 CCCAGCTAGCAGAAGGCCCAGGG - Intergenic
903627604 1:24742733-24742755 CTTAGCTAGGAGGAAGCCAGGGG - Intergenic
903778100 1:25806001-25806023 CCCAGTTGGAAGAAAGCCTGGGG - Intronic
903987238 1:27237223-27237245 CCCAGCTACTAGGAAGGCAGAGG - Intronic
904287422 1:29461432-29461454 GGCAGCCAGAAGGAAGCCAGAGG - Intergenic
904293525 1:29503015-29503037 CCGAGCCAGAGGAAAGCCTGTGG - Intergenic
904504598 1:30940358-30940380 CCCAGCTACTTGAAAGCCTGAGG + Intronic
904734449 1:32619993-32620015 CCCAGCTACTCGAAAGCCTGAGG - Intronic
904768695 1:32869534-32869556 CCCAGGCAGAATAAAGCCTGCGG + Intronic
905344306 1:37301025-37301047 CCCAAGTAGAAGCCAGCCAGAGG - Intergenic
905426924 1:37893195-37893217 CCCAGCTACCAGAGAGCCTGAGG - Intronic
906462988 1:46051374-46051396 CCCAGCTAGTGGGAAGCCTGAGG - Intronic
908023023 1:59917778-59917800 CCCAGGCAGAAAAAAGGCAGGGG - Intronic
908328217 1:63044504-63044526 AACAGCTTGAAGAAAGACAGGGG - Intergenic
908440727 1:64151312-64151334 CCCAGCAAGGAGGAAGCCAGAGG + Intronic
908654064 1:66369282-66369304 CAGAGCTAGGAGAAATCCAGAGG - Intronic
909244098 1:73255055-73255077 CCCAGCTACACGGAAGCCTGAGG - Intergenic
910429200 1:87144497-87144519 CCCAGCTGGAACAAAGCAGGAGG + Intronic
910642016 1:89473657-89473679 CCCAGCTGGGAGAATACCAGTGG - Intergenic
911098155 1:94072793-94072815 CCCAGTTAGAAGGCAGGCAGTGG - Intronic
911246990 1:95529195-95529217 TCCAGTTAGAACATAGCCAGTGG - Intergenic
911279856 1:95911188-95911210 CCCAACTAAAAGAATTCCAGAGG - Intergenic
911354136 1:96795509-96795531 CCCAGGTATAAGAAAGCAAGAGG + Intronic
912521301 1:110246700-110246722 CACAGGTGGAGGAAAGCCAGGGG - Intronic
913709600 1:121469477-121469499 CCAAGCCAGAAGAGAGGCAGAGG - Intergenic
913978761 1:143488734-143488756 CCCAGCCTGAGGAAAGCCGGGGG + Intergenic
914073170 1:144314382-144314404 CCCAGCCTGAGGAAAGCCGGGGG + Intergenic
914105984 1:144651978-144652000 CCCAGCCTGAGGAAAGCCGGGGG - Intergenic
914744876 1:150494249-150494271 CCCAGCTACAAAAAAGGCTGAGG + Intronic
915382532 1:155454650-155454672 CCCAGCTACAAGAGAGGCTGAGG + Intronic
915510191 1:156382715-156382737 ACCAGATAGAGGAAAGGCAGGGG - Intronic
916063978 1:161121299-161121321 CCAAGCCAGAAGAAAGCAAAGGG + Exonic
916265422 1:162885753-162885775 TCCAGCTAGAAGGAAAGCAGGGG + Intergenic
916543078 1:165776144-165776166 CCCAGCTACTTGAGAGCCAGAGG + Intronic
917750410 1:178048257-178048279 CCCAGCTACTAGAAAGGCTGAGG + Intergenic
918532281 1:185537171-185537193 CCCAGCTATGTGAAAGCCAGAGG - Intergenic
919359158 1:196568478-196568500 CCCAGCTACACGGAAGCCTGAGG + Intronic
920341506 1:205278010-205278032 CCCAACTAGAAAAAGGACAGAGG - Intergenic
920431311 1:205921020-205921042 CTCAGATAGAGGCAAGCCAGGGG - Intronic
920727721 1:208452142-208452164 CACAGCTATATGAAAGCTAGGGG - Intergenic
920788499 1:209065496-209065518 CCCAGCCAGAAGAAACTCATTGG - Intergenic
921287499 1:213622325-213622347 CCCTGATAGCAGAAAGCCACTGG - Intergenic
922340739 1:224652965-224652987 CCCAGCTGGAGGAAGGCCACCGG + Intronic
1063032849 10:2253512-2253534 TCCAGCTAGAAGGAAGCTACTGG - Intergenic
1064020950 10:11808407-11808429 CCCAAATAGAAGAATGCCATGGG - Intergenic
1064054846 10:12088697-12088719 CCCAGCTAGTAGAGAGGCTGAGG - Intronic
1064443801 10:15375837-15375859 CCCAGCTACTAGAAAGGCTGAGG - Intergenic
1066236038 10:33485679-33485701 CCCAGGTCAAAGAAAGACAGAGG + Intergenic
1066478726 10:35774019-35774041 CACAGCAAGAAGCAACCCAGAGG + Intergenic
1066651859 10:37664039-37664061 CACAGCTAGAATAATGCAAGAGG + Intergenic
1067104780 10:43359077-43359099 CCCAGCTAGTCGAAAGGCTGAGG - Intergenic
1068111599 10:52686798-52686820 CCCAGCTACATGGAAGTCAGAGG + Intergenic
1068989855 10:63139123-63139145 CCCAGCTACAAGGAAGGCTGAGG - Intronic
1069275182 10:66581848-66581870 CACATGTAGAAGAAAGACAGTGG - Intronic
1069744116 10:70704020-70704042 CACAGCTTGATTAAAGCCAGAGG + Intronic
1069898650 10:71694682-71694704 CCCAGAGAGTAGAAAGCTAGAGG + Intronic
1070719455 10:78746228-78746250 GCCAGCTAGAAGAACAGCAGGGG - Intergenic
1071506344 10:86233979-86234001 CCCAGCAAGGAGGCAGCCAGGGG - Intronic
1072048449 10:91680374-91680396 TCCAGCTAACAGAAAGCCCGTGG - Intergenic
1072966923 10:99981828-99981850 CCCAGCAGGGAGAGAGCCAGGGG - Intronic
1073146099 10:101282876-101282898 CCCAGCTTCAAAATAGCCAGTGG + Intergenic
1073951172 10:108811583-108811605 CACAGCTAGAACAAAGCAGGTGG - Intergenic
1075227747 10:120644960-120644982 ACCAGCTAGAGAAAAGCAAGAGG + Intergenic
1077293596 11:1813286-1813308 CCCAGCCATAACAAAGCAAGGGG + Intergenic
1078397113 11:10991006-10991028 CCCAGCTCAAAGACAGTCAGAGG - Intergenic
1079081077 11:17414251-17414273 ACCAGCTAGAGAAAAGGCAGCGG + Intronic
1079639999 11:22793156-22793178 CCCAGCTACTAGAGAGCCTGAGG + Intronic
1079888093 11:26014823-26014845 CCCTGCTAGAAAAATGACAGAGG + Intergenic
1080344276 11:31305773-31305795 AGCAGCTAGAAGAAAGCAAGAGG + Exonic
1081188955 11:40080266-40080288 TCTAGATAGAACAAAGCCAGAGG + Intergenic
1081979434 11:47257482-47257504 CCAAGCTGGTAGAAATCCAGGGG - Intronic
1083106520 11:60363504-60363526 CCCAGCTATAAGAAAGCATATGG - Intronic
1083793980 11:65003884-65003906 CCCATCTAGAAGAAAGTCTGGGG + Intergenic
1083911208 11:65711328-65711350 CCCAGCTACTAGAGAGCCTGAGG + Intergenic
1084022806 11:66427849-66427871 CCCAGCTACATGAGAGCCTGAGG + Intergenic
1084162805 11:67359342-67359364 CCCAGCTACAAGGAAGGCTGAGG - Intronic
1084437140 11:69149792-69149814 CCCAGCTAGTCTGAAGCCAGGGG + Intergenic
1085269687 11:75262976-75262998 CCCACCGAGCAGAGAGCCAGCGG - Intergenic
1085466200 11:76725072-76725094 CCTAGATAGGAGAAAGCAAGCGG - Intergenic
1087100279 11:94357109-94357131 CACAGCTAGAATAAAGCAGGTGG + Intergenic
1087118735 11:94550647-94550669 ATCAGATAGAAGAAAGGCAGAGG + Intronic
1088237712 11:107742873-107742895 CCCAGCTACTAGAAAGGCTGAGG + Intergenic
1088304797 11:108396206-108396228 CCCAGCTAGTTGAAAGGCTGAGG - Intronic
1089322829 11:117638059-117638081 CCCAGCTTGAAGAAAGCCACAGG - Intronic
1089756538 11:120691693-120691715 CCATGCCAGAAGAAAGCCACTGG - Intronic
1090054610 11:123411761-123411783 CCCAGCTAGTAGAGAGGCTGAGG - Intergenic
1090246854 11:125222240-125222262 CCCAACTGGAAGAGAGCAAGGGG - Intronic
1090413324 11:126523719-126523741 GCCAGCTACAAGGAAGGCAGCGG - Intronic
1091102366 11:132886891-132886913 CCCCGCTCGCAGAATGCCAGTGG + Intronic
1091631883 12:2168120-2168142 CACAGCTTAAAGAAAGGCAGAGG + Intronic
1091689447 12:2585603-2585625 CCCAGTGGAAAGAAAGCCAGTGG + Intronic
1093887722 12:24481714-24481736 CACAGCTAGCAGAGATCCAGGGG + Intergenic
1094066609 12:26368111-26368133 CCAAGCTCGAAGAAAAGCAGTGG - Intronic
1095667525 12:44819785-44819807 TCCAGCATGAACAAAGCCAGCGG + Intronic
1095861597 12:46923878-46923900 CCCAGATAGAAGAGATGCAGAGG + Intergenic
1096193118 12:49632837-49632859 AGCAGCTAGAAAAAAGCCAAAGG - Exonic
1096408858 12:51362951-51362973 CCCAGCTAGATGAGAGGCTGAGG - Intronic
1097354408 12:58585414-58585436 CCAAGCCAGAAGACAGCCAGTGG + Intronic
1098248938 12:68548698-68548720 CAAAGCCAGAAGAAAGACAGTGG + Intergenic
1098784469 12:74733253-74733275 GCCAGCAAGAAGAAAGGCAAAGG - Intergenic
1098968687 12:76824725-76824747 CCCAGCTAGTAGGGAGGCAGAGG + Intronic
1098999656 12:77164552-77164574 CCCAGCAAGAAGAAGAGCAGTGG - Intergenic
1099457769 12:82885007-82885029 CCCAGCTACAAGAGAGGCTGAGG - Intronic
1101068554 12:101048770-101048792 CAGAGCTAGAAGAAAGCTAAAGG - Intronic
1101710261 12:107258090-107258112 CCCAGCTACTAGAAAGGCTGAGG + Intergenic
1102016307 12:109650175-109650197 AACAGCTAAAAGGAAGCCAGAGG + Intergenic
1102096668 12:110246748-110246770 CCCAGGGAGAGGCAAGCCAGGGG - Intergenic
1102600397 12:114025365-114025387 CCCAGCTAGGAGCAAGTCACAGG - Intergenic
1103120296 12:118374266-118374288 CCCAGCTACTAGAAAGGCTGAGG + Intergenic
1103133494 12:118488362-118488384 CTCAGCTAGAAGAAATCTTGGGG - Intergenic
1104595714 12:130118829-130118851 CCCAGCGAGAAGTAAGACATTGG - Intergenic
1105220572 13:18322662-18322684 CCCAGCCTGAGGAAAGCCGGCGG - Intergenic
1108774781 13:53752251-53752273 CCCAGTGAGGAGAAAGCCAATGG - Intergenic
1109488821 13:63067177-63067199 CCCATCAAGCAGAAAGCCAATGG - Intergenic
1110690314 13:78424640-78424662 CCCAGCTACTCGAAAGCCTGAGG + Intergenic
1113868827 13:113545943-113545965 CCAAGCAGGAAGGAAGCCAGTGG + Intronic
1114057843 14:18989761-18989783 CCCAGCTAGTAGAGAGGCTGAGG - Intronic
1114104704 14:19411992-19412014 CCCAGCTAGTAGAGAGGCTGAGG + Intronic
1115209941 14:30957040-30957062 CCCAGCTACCCGAAAGCCTGAGG + Intronic
1119266710 14:73267008-73267030 CCCAACCAGCAGAGAGCCAGTGG - Intronic
1123142730 14:106096680-106096702 CACAGCTAGAATAAAGCAGGTGG - Intergenic
1123218382 14:106833204-106833226 CACAGCTAGAATAAAGCAGGTGG - Intergenic
1124662336 15:31560345-31560367 CCCAAGAAGAATAAAGCCAGAGG - Intronic
1126035331 15:44539874-44539896 CCCAGCTACTAGAAAGGCTGAGG - Intronic
1126280169 15:46938263-46938285 CCCAGCTGTGAGAATGCCAGGGG - Intergenic
1126560656 15:50040237-50040259 CCCAGCTAGAAGAAAGCCAGGGG - Intronic
1126940130 15:53758119-53758141 CCCAGCTACTAGGAAGCCTGAGG - Intronic
1127574183 15:60273828-60273850 CACAGCTAGAATAAAGCAGGCGG - Intergenic
1128102523 15:65014741-65014763 CCCAGCTACTAGAAAGGCTGAGG - Intronic
1128311714 15:66635108-66635130 CCCAGCAAGGGGAATGCCAGTGG - Intronic
1128332530 15:66765165-66765187 GCCAGCGAGGAGAAAGCGAGTGG + Intronic
1128384491 15:67137872-67137894 CCCAGACAGAAGAAATCCAAAGG - Intronic
1128584362 15:68834829-68834851 CTCAGAGAGAAGAAATCCAGAGG - Intronic
1129067640 15:72920449-72920471 CCCATCTTGAAGAAAGGCAGAGG - Intergenic
1129217384 15:74108017-74108039 CCCTCTTAGGAGAAAGCCAGAGG + Intronic
1129464288 15:75715254-75715276 CCCAGCTAGCAACAAGGCAGGGG - Intergenic
1129470463 15:75750833-75750855 CCCTCCTGGGAGAAAGCCAGAGG - Intergenic
1129720961 15:77877758-77877780 CCCAGCTAGCAACAAGGCAGGGG + Intergenic
1131346781 15:91656670-91656692 CCCAGCTAAGGGAAAGCCACTGG + Intergenic
1132295809 15:100733454-100733476 CCCACCAAGAAGACATCCAGTGG + Intergenic
1133428310 16:5712731-5712753 TCCAGCTGCAAGGAAGCCAGTGG + Intergenic
1133444322 16:5847054-5847076 CCCTGCTACAAGAGAGCTAGTGG - Intergenic
1133577260 16:7105048-7105070 CTCAGCTAGAAGAATGTAAGTGG - Intronic
1134439782 16:14292410-14292432 CCCAGCTACTTGAAAGGCAGAGG - Intergenic
1134615324 16:15646932-15646954 CCCAGCTAGTCGAAAGGCTGAGG + Intronic
1135198042 16:20410616-20410638 CCCAGCTACTAGGAAGCCTGGGG + Intronic
1135759273 16:25123721-25123743 CCCAGCTACAAGAAAGGCTGAGG - Intronic
1138822780 16:60281620-60281642 TCCAGCTACTAGAAAGGCAGAGG - Intergenic
1139292809 16:65873629-65873651 CACAGCTAGAATAAAGCAGGTGG - Intergenic
1139470772 16:67177013-67177035 ACCAGCTACCTGAAAGCCAGGGG - Intronic
1140032719 16:71351188-71351210 CAGAGCTGTAAGAAAGCCAGAGG - Intergenic
1140083127 16:71769165-71769187 CCCAGCTACAAGGAAGGCTGAGG + Intronic
1140332129 16:74068599-74068621 CCCAGATAGAACAAAAACAGAGG + Intergenic
1140843190 16:78861250-78861272 CCCAGCTTGAAGTCAGGCAGAGG - Intronic
1142605910 17:1080970-1080992 GCCACCTGGCAGAAAGCCAGGGG + Intronic
1142884753 17:2905645-2905667 CCCAGCCAGGAGGAAGCCGGGGG + Intronic
1143330651 17:6132518-6132540 CGCAGCTAGCAGACAGACAGGGG - Intergenic
1143708003 17:8713750-8713772 CCCAGCTACTAGGAAGCCTGAGG + Intergenic
1143723690 17:8831212-8831234 CCCAGCTAGTCGAAAGGCTGAGG + Intronic
1143938685 17:10514891-10514913 CCGATCTAGAAGAAAAACAGTGG + Exonic
1147196455 17:38769989-38770011 CCGAAGTAGAAGAAAGGCAGTGG + Intronic
1147372093 17:39999438-39999460 CCCAGCTACTAGGAAGCCTGAGG + Intergenic
1147501195 17:40965258-40965280 CCCAGCTACTAGAGAGGCAGAGG + Intronic
1148764774 17:50031076-50031098 CCCAGCTAGTAGAGAGGCTGAGG + Intergenic
1149802362 17:59581641-59581663 CCCAGCTACTTGAAAGCCTGAGG + Intronic
1149844130 17:59993849-59993871 CCCAGCTACTTGAAAGCCTGAGG - Intergenic
1153224160 18:2885118-2885140 AACAGCTTGAAGAAAGCCACAGG + Exonic
1153569659 18:6456351-6456373 CCCAGCTACTAGAAAGACTGAGG - Intergenic
1153960446 18:10135700-10135722 CCCAGCTAAAGGAAAGCTGGGGG + Intergenic
1155294774 18:24374966-24374988 CCAAGCTAGAGGAAACACAGGGG + Intronic
1155351445 18:24911480-24911502 CCCAGATGGAAAAAAGACAGAGG + Intergenic
1156945133 18:42820567-42820589 ACCATTAAGAAGAAAGCCAGGGG - Intronic
1156973564 18:43188433-43188455 ACCTTCTAGAAGAAAGTCAGTGG + Intergenic
1157330671 18:46701569-46701591 CACAGCAAGAAGAAGGCCATTGG + Intronic
1157478345 18:48037319-48037341 CCCAGCCAGATGATAGGCAGTGG - Intronic
1157598124 18:48876132-48876154 CCCAGCCAGAGGGAACCCAGAGG + Intergenic
1157811754 18:50702044-50702066 CCCAGCTACCAGAAAGGCTGAGG + Intronic
1158532678 18:58277568-58277590 CCCACTGAGAAGCAAGCCAGAGG - Intronic
1158611069 18:58941576-58941598 CCCAGCTACTAGAAAGGCTGAGG - Intronic
1158950587 18:62491192-62491214 CACAGCTAGAACAAAGCACGGGG + Intergenic
1159642786 18:70882847-70882869 CCCAGCTTGAAGGAAGCCCTGGG + Intergenic
1161251578 19:3283464-3283486 CCCAGCTACAAGGAAGGCTGAGG - Intronic
1161757424 19:6144479-6144501 CGCAGCTAGGAGAAAGTCATTGG + Intronic
1161923702 19:7285332-7285354 CCCAGCTACTAGAAAGGCTGAGG + Intronic
1164656314 19:29924582-29924604 CCCAGCTCTAGGAGAGCCAGGGG + Intronic
1165810261 19:38607741-38607763 CGGGGCTAGAAGAAAGGCAGGGG + Intronic
1165872942 19:38986078-38986100 GCCAGCTAGACCAAAGCCACTGG - Intergenic
1166645363 19:44527599-44527621 CCCTGTGAGAAGAAAGCCAGAGG - Intronic
1166914049 19:46182249-46182271 CCCAGCTACCAGGAAGCCTGTGG + Intergenic
1166930465 19:46298542-46298564 CCCAGCTAGAGGAAGGGAAGGGG - Intronic
1167899677 19:52610394-52610416 CCCAGCTACAAGAGAGGCTGAGG - Intronic
926320978 2:11748193-11748215 CCCAGCCAGAAGGAAGTCTGTGG + Intronic
926786057 2:16519430-16519452 CCCTGTTAAAAGAAAGCCAAAGG - Intergenic
926876508 2:17486427-17486449 CCCAACTGCAAGAAAGCTAGGGG + Intergenic
928004417 2:27551003-27551025 CCCAGCTAGTAGAAAGGCTGAGG - Intronic
928699365 2:33883182-33883204 CGCAGCTAGAACAAAGCAGGTGG + Intergenic
929507687 2:42541145-42541167 CCCAGCTACTAGAAAGGCTGAGG - Intronic
930100723 2:47600946-47600968 CCCAGCTGGCAGAATGCCTGGGG - Intergenic
930699266 2:54443079-54443101 CCCAGCTACTAGAAAGACTGAGG + Intergenic
933432209 2:82197358-82197380 ACCAGAAAGAAGAAAACCAGTGG + Intergenic
934183484 2:89649813-89649835 CCCAGCCTGAGGAAAGCCGGGGG + Intergenic
934850555 2:97697841-97697863 CCCAGCTACTAGAAAGGCTGAGG - Intergenic
934934737 2:98456925-98456947 CAAAGAGAGAAGAAAGCCAGTGG + Intronic
935075045 2:99733262-99733284 CCCAGCTACTAGAAAGGCTGAGG + Intronic
936519481 2:113202544-113202566 CCCAGCTGGGAGGCAGCCAGAGG - Exonic
937030160 2:118732225-118732247 CTCATCTAGTAGAAAGGCAGGGG - Intergenic
937155131 2:119713716-119713738 CCCAGCTACTTGAAAGGCAGAGG + Intergenic
937503664 2:122511967-122511989 GCCAGCTAGCAGTGAGCCAGTGG + Intergenic
938126812 2:128680227-128680249 CCAAGCCAGGAGAAAGCCAGAGG + Intergenic
938405895 2:131032966-131032988 CCCAGCTACGAGAAAGACTGAGG - Intronic
938475911 2:131613054-131613076 CCCAGCTAGTAGAGAGGCTGAGG - Intergenic
938633482 2:133196004-133196026 CCCAGAAAGAAGGAAGCCATGGG - Intronic
938949408 2:136243174-136243196 CCCAGCTTTTAGAAAGGCAGAGG + Intergenic
941224290 2:162827006-162827028 CTCAGGAAGAAGAAACCCAGTGG + Intronic
942160471 2:173180558-173180580 CCCAGCTACTAGAAAGGCTGAGG + Intronic
942481762 2:176395604-176395626 TCCAGGGAGAAAAAAGCCAGGGG - Intergenic
942741660 2:179187516-179187538 CCCAGCTAGTCGAAAGGCTGAGG + Intronic
944687372 2:202129333-202129355 CCCACCTAGTAGAGAGCCTGAGG - Intronic
944747998 2:202677399-202677421 AGCAGCAAGAAGAAATCCAGTGG - Intronic
945152275 2:206803731-206803753 CAGAGCAAGAAGAAATCCAGGGG - Intergenic
945198108 2:207256190-207256212 CCCATCTGGCTGAAAGCCAGAGG + Intergenic
946280911 2:218664820-218664842 GCCAGCAAGAAGAACGCAAGCGG - Exonic
947773349 2:232688209-232688231 CCCAGCTACAAGGAAGGCCGAGG + Intergenic
948274109 2:236695136-236695158 CCCAGCTAGAAGCATCCCAATGG - Intergenic
948493049 2:238326282-238326304 CTCAGAAAGGAGAAAGCCAGAGG - Intronic
948806559 2:240455729-240455751 CCCTCCTGGAAGAATGCCAGGGG - Intronic
948811213 2:240479333-240479355 CCAAGCAAGATCAAAGCCAGGGG + Intergenic
1169744347 20:8928358-8928380 CCCAGCCAGTAGAGAGTCAGAGG - Intronic
1169830248 20:9817029-9817051 CCCAGCTACAAGGAAGGCTGAGG + Intronic
1171089437 20:22270008-22270030 CACAGCTAGAAAAAAGCAGGTGG - Intergenic
1171094392 20:22317392-22317414 CCCAGCTACTAGGAAGCCTGAGG + Intergenic
1171841736 20:30221817-30221839 CCCAGCTACTCGAGAGCCAGAGG + Intergenic
1172143068 20:32737413-32737435 CCCAGCTACTAGAAAGGCTGAGG + Intronic
1172965272 20:38829888-38829910 CCCAGCTCCAAGGAACCCAGAGG + Intronic
1174297953 20:49562296-49562318 CACAGCCAGGAGAAAGGCAGGGG - Intronic
1174418317 20:50382638-50382660 CCCTGCTACAAGAAATCCAGAGG + Intergenic
1174538457 20:51270976-51270998 CTCAGCTAGAGGAAAGCAATGGG + Intergenic
1174665670 20:52255541-52255563 AGCAGCTAGAAGGTAGCCAGGGG + Intergenic
1177778596 21:25598348-25598370 CCCAGCTACTAGAAAGGCTGAGG + Intronic
1177801207 21:25830744-25830766 CAGAGCTAGCAGGAAGCCAGAGG - Intergenic
1177922112 21:27164994-27165016 CACAGTCAGAAGAAAGCCTGAGG + Intergenic
1178208237 21:30495127-30495149 CCCAGCTATAAGAAAGGTATAGG - Intergenic
1178318894 21:31589911-31589933 CCCAGCTAGTTGAGAGGCAGAGG + Intergenic
1178497872 21:33102160-33102182 CTGAGCAAGAAAAAAGCCAGGGG + Intergenic
1178561918 21:33645799-33645821 CTCAGAGAGAAGGAAGCCAGTGG - Intronic
1178859808 21:36279300-36279322 CCCAGCTACATGGAAGCCTGAGG + Intronic
1179223847 21:39434631-39434653 CCCAGCTAAATGAAAGGCTGAGG - Intronic
1179544055 21:42102681-42102703 GCCAGGGAGAAGCAAGCCAGTGG + Exonic
1180220527 21:46355474-46355496 CGGAGTTAGAAGAAAGCCACAGG + Exonic
1180476328 22:15712373-15712395 CCCAGCTAGTAGAGAGGCTGAGG - Intronic
1181318632 22:21987777-21987799 ACCAGCTAGTACAAAGCCACAGG + Intergenic
1182093950 22:27614016-27614038 CTCACCTACAAGAAAACCAGAGG + Intergenic
1183085806 22:35486290-35486312 CGCAGCAGGAAGAAAACCAGGGG - Intergenic
1183160681 22:36110887-36110909 CCCAGTGAGAAGAAAGACAGTGG - Intergenic
1184009335 22:41735075-41735097 CCCAGCTACTAGAAAGGCTGAGG - Intronic
1184563909 22:45279767-45279789 CCCAGCTACTAGAAAGGCTGGGG + Intergenic
949285819 3:2403056-2403078 CAAAGCTAGAAGAAAGGCATGGG - Intronic
950485424 3:13270557-13270579 CCCAGAGAGAATAAAGACAGGGG - Intergenic
951050099 3:18084637-18084659 CCCAGCTAGTTGACAGCCAAGGG + Intronic
951334947 3:21409120-21409142 CCCACCTAAAAGGAATCCAGAGG + Intergenic
952417885 3:33106139-33106161 CCCAGCTATATGAAAGGCTGAGG - Intergenic
952680861 3:36089881-36089903 CCCAGCTACAAGGAAGGCTGAGG + Intergenic
952891905 3:38048672-38048694 TCCCGATAGAAGAAAGCCATGGG - Intronic
952943426 3:38459915-38459937 CCAAGCTTGAAGCAGGCCAGGGG - Intronic
953488716 3:43328484-43328506 CCCAGCTAGCAGGAAGCCTAAGG - Intronic
954641928 3:52105810-52105832 ACCCCCTAGATGAAAGCCAGAGG - Intronic
954779368 3:53047090-53047112 CACAGCAAGAAGAAAGTCTGGGG + Intronic
956660772 3:71595085-71595107 CTTAGCTAGAAGAAAGGCATAGG + Intergenic
959682160 3:109108071-109108093 CCCAGCTACTGGAAAGGCAGAGG + Intronic
959740575 3:109714623-109714645 CCCAGCTACATGAAAGGCTGAGG - Intergenic
960104920 3:113785322-113785344 CCCAGCTAGTTGAAAGGCTGAGG + Intronic
960981999 3:123238036-123238058 CCCAGCTACTAGAAAGGCTGAGG + Intronic
961190613 3:124958116-124958138 CCCAGCAACAAGAAAGGCTGTGG - Intergenic
963077358 3:141359459-141359481 CCCAGCAAGAAGGAAGGAAGAGG + Intronic
964652229 3:159025099-159025121 TCCAGATATAAGAAATCCAGAGG - Intronic
965542232 3:169881789-169881811 CCAAGGTAGAGGAAAGGCAGAGG - Intergenic
965628652 3:170707902-170707924 CCAAGGAAGAAGAAAACCAGTGG + Intronic
966610566 3:181863812-181863834 CCCAGCTAGTTGGAAGCCTGAGG + Intergenic
966972459 3:185057588-185057610 CCCAGCTAAAAGGGAGGCAGAGG + Intergenic
967806905 3:193722605-193722627 CCCAAGGAGAAGAAAGCCTGGGG - Intergenic
968414840 4:422170-422192 CCCAGCTAGTAGGAAGGCTGAGG - Intergenic
969614342 4:8243637-8243659 CCCAGCTACTAGAAAGGCTGAGG - Intergenic
969744696 4:9060909-9060931 CCCAGCTAGAACACAGCCCCAGG + Intergenic
970483814 4:16504493-16504515 CCCAGCAATAAAAATGCCAGGGG + Intronic
971241821 4:24896116-24896138 CTCAGCAAGAAGCAAGCAAGAGG - Intronic
971437937 4:26647721-26647743 CTCAGCTGGGAGGAAGCCAGGGG - Intronic
971847820 4:31943744-31943766 CCCAGCTACATGAAAGACTGAGG - Intergenic
972073762 4:35057130-35057152 CACAGCTAGAATAAAGCAGGCGG + Intergenic
972844397 4:42970397-42970419 TCCAGGTAGAAGTCAGCCAGAGG - Intronic
973798015 4:54448768-54448790 CCCAGCAGGAAGGAAGCCAAGGG + Intergenic
974070362 4:57118002-57118024 CCCTGCTGTAAGAAAGCCACAGG - Intergenic
975184772 4:71388662-71388684 CCCAGCTACTAGAGAGGCAGTGG - Intronic
975404331 4:73971992-73972014 TGCAGCTAGAAGAAATACAGAGG + Intergenic
976347160 4:84017409-84017431 AACAGCTAGAAGTAAGGCAGAGG - Intergenic
978763768 4:112383120-112383142 GCCAGATAGAAGAGAGCCTGGGG + Intronic
978825659 4:113020300-113020322 CCCAGCTACTAGAAAGGCTGAGG - Intronic
980572522 4:134639098-134639120 CGCAGCTTGAAGATAGCTAGAGG - Intergenic
980729521 4:136809189-136809211 CACAGCAAGAAGACAGCCATTGG - Intergenic
981076119 4:140594178-140594200 TCCAGATACAAGAAATCCAGAGG - Intergenic
981225352 4:142287943-142287965 CACAGCTAGAAGGCAGCCACTGG - Intronic
982708827 4:158739350-158739372 CCCAGCTACAAGAGAGGCTGAGG - Intergenic
982747575 4:159120968-159120990 CCCAGCTAGTAGGGAGGCAGAGG - Intronic
983778267 4:171635992-171636014 CCCAGCTACTTGAGAGCCAGAGG + Intergenic
984211481 4:176854559-176854581 CCCAGCTACTAGAAAGGCTGAGG - Intergenic
986018924 5:3782751-3782773 CCCTGCTAGCAGAATGCCACAGG - Intergenic
986075287 5:4330592-4330614 CCCAGCTTGAAGGCAGGCAGAGG - Intergenic
989967272 5:50479086-50479108 CCAAGCCAGAAGAGAGGCAGAGG + Intergenic
990639174 5:57762336-57762358 CTCAGCCAGAGGACAGCCAGAGG + Intergenic
992126262 5:73645264-73645286 CCCAGCTACTAGAAAGACAGAGG - Intronic
992861262 5:80912911-80912933 CCCAGCTACTAGAAAGCCAGAGG - Intergenic
993527029 5:88977601-88977623 CCCAGCTACATGGAAGCCTGAGG + Intergenic
993624340 5:90206269-90206291 CCCAGATAAAAAAAAGCCAAGGG + Intergenic
994216549 5:97144181-97144203 CCCAGCTACTAGAAAGCCTAAGG - Intronic
994439625 5:99785509-99785531 ACCAACTATAAGAAAGTCAGGGG + Intergenic
994782730 5:104113266-104113288 CCCAGCTACTAGAAAGGCTGAGG - Intergenic
996017800 5:118560208-118560230 CCTGGCTAGATGAAAGCCTGTGG - Intergenic
996603430 5:125293037-125293059 CTAAGCTCGAAGAAAGCCTGAGG + Intergenic
997567191 5:134897361-134897383 CCCAGCTACTAGAAAGGCTGAGG - Intronic
998744604 5:145244067-145244089 CCCAGCTACTCGAAAGCCTGAGG - Intergenic
998807785 5:145935693-145935715 CACAGCTAGCAGAAGGCAAGTGG - Intergenic
999125971 5:149246045-149246067 CCCAGCTACATGCAAGCCTGAGG + Intronic
1000162257 5:158609873-158609895 CCCAGAGAGAAGAAAGACAAGGG + Intergenic
1000446041 5:161322349-161322371 CCCAGCTACAAGGGAGGCAGAGG - Intronic
1001158215 5:169291216-169291238 CCCGGCTAAGAGAAAGCAAGTGG + Intronic
1001270583 5:170308446-170308468 CCTAGCTAGAAGACACCCAGGGG - Intergenic
1001507336 5:172290119-172290141 CCCAGCTACTAGAAAGGCTGAGG - Intergenic
1003268485 6:4587366-4587388 CCCTGCAAGAACAGAGCCAGAGG - Intergenic
1004594156 6:17083050-17083072 CCCAGCTACAAGGAAGTCTGAGG + Intergenic
1006019312 6:31108441-31108463 CCCAGCTAGAGGGAAGGCTGAGG - Intergenic
1006472324 6:34235954-34235976 CCGAGCGAGAAGGAAGCCAAAGG - Intergenic
1006648489 6:35532032-35532054 CCCAGCTACAAGGAAGGCTGAGG + Intergenic
1011722137 6:90168236-90168258 CCCAGCTACATGGAAGCCTGAGG + Intronic
1012002243 6:93667459-93667481 TGCAGCTAGAACAAAGCAAGAGG + Intergenic
1012615249 6:101269351-101269373 CCCAGTCAGAACAAAGCCAAAGG + Intergenic
1013242145 6:108256112-108256134 CCCAGCTAGTAGAGAGGCTGAGG + Intronic
1014442103 6:121486077-121486099 CCCAGCTACATGAAAGGCTGAGG - Intergenic
1015439715 6:133233773-133233795 GACTGCTAGAAGGAAGCCAGAGG - Intergenic
1016467082 6:144336352-144336374 GCCAGCCAGAAGACAGGCAGTGG + Intronic
1016778354 6:147930848-147930870 CACAGCTAGAACAAAGCAGGTGG - Intergenic
1019389220 7:776437-776459 CACAGCAAGAAGCAAGGCAGAGG + Intronic
1019677121 7:2320606-2320628 CCCAGCTACACGAAAGGCTGAGG + Intronic
1021670348 7:23029308-23029330 CCCAGCTACTAGAGAGGCAGAGG + Intergenic
1021716743 7:23468905-23468927 CCCCTCCTGAAGAAAGCCAGGGG - Intronic
1023406455 7:39838467-39838489 CCCAGCTAGTAGACAGGCTGAGG - Intergenic
1023426945 7:40046884-40046906 CCCAGCTGCTAGAAAGCCTGAGG + Intronic
1024263748 7:47590885-47590907 CCCAGCTACTCGGAAGCCAGAGG + Intergenic
1024492741 7:50004173-50004195 CACAGCTAGAACAAAGCAGGTGG + Intronic
1024620605 7:51154216-51154238 CACACATAGAAGGAAGCCAGAGG + Intronic
1025252660 7:57362234-57362256 CCCTGCTACAAGAAATCCAGAGG - Intergenic
1026056010 7:66984361-66984383 CCCAGCTACTAGAAAGGCTGAGG - Intergenic
1026303235 7:69117456-69117478 CCCAGCTACATGAAAGGCTGAGG + Intergenic
1027006302 7:74696440-74696462 CCCAGCTACTAGAAAGGCTGAGG - Intronic
1027166639 7:75839281-75839303 CCCAGCTACAAGAGAGGCTGAGG - Intergenic
1027264403 7:76486108-76486130 CCCAGCTCCAAGAAAACCAAAGG - Intronic
1027315773 7:76984222-76984244 CCCAGCTCCAAGAAAACCAAAGG - Intergenic
1028085191 7:86627677-86627699 CCCAGCTAGTAGGAAGGCTGAGG - Intergenic
1028542566 7:91959406-91959428 CCCAGCTAGTTGAAAGGCTGAGG - Intronic
1028615840 7:92765963-92765985 CCGAGCTAGAAGCAAGCTGGAGG + Intronic
1030279507 7:107757797-107757819 CCCAGCAAGAAAAAAACCAACGG - Intronic
1031798006 7:126202163-126202185 CCCAGCTAGTAGGGAGGCAGAGG + Intergenic
1032453371 7:132053570-132053592 CCAAACTAGAAGAAAGCAAAAGG - Intergenic
1032625331 7:133585807-133585829 CCCAGCTAAAAGGGAGGCAGAGG - Intronic
1033552694 7:142462397-142462419 CCCAGCAAGAAGGGAGCCATGGG + Intergenic
1033557203 7:142499355-142499377 CCCAGCAAGAAGGGAGCCATGGG + Intergenic
1033559613 7:142519221-142519243 CCCAGCAAGAAGGCAGCCAAGGG + Intergenic
1034194243 7:149233862-149233884 CTCAGTTAGAAGAAACCCAGGGG + Intergenic
1035929096 8:3761904-3761926 CCCAGAAAAAAGAGAGCCAGAGG - Intronic
1035999717 8:4588095-4588117 TCTAGCTAGAGGGAAGCCAGAGG - Intronic
1037060876 8:14507885-14507907 CCCAGCTACCAGAAAGGCTGAGG - Intronic
1037348941 8:17928745-17928767 CCCAGCTACAAGAGAGGCTGAGG - Intronic
1038829468 8:31041297-31041319 CCCAGCTCAAAGACAGGCAGAGG + Intronic
1039085708 8:33777553-33777575 CCCAGCTACAAGGAAGGCTGAGG - Intergenic
1039702881 8:39979467-39979489 CTCAGCTACAAGAAAGGCTGAGG - Intronic
1040083959 8:43319964-43319986 CCCAGCTAGTAGAGAGACTGAGG - Intergenic
1040356198 8:46620820-46620842 AGCAGCTAGAACAAAGCAAGTGG - Intergenic
1040876034 8:52153372-52153394 AGCTGCTAGATGAAAGCCAGGGG - Intronic
1042163436 8:65921586-65921608 CCCATCAAGGAGAAAGCCAGGGG - Intergenic
1042367696 8:67955448-67955470 CCCAGGAAGAACAAAGGCAGAGG - Intronic
1042708254 8:71685526-71685548 CCCAGCTAGAAGGAAGCCACTGG + Intergenic
1043292379 8:78618932-78618954 CCCAGCTACTAGAAAGGCTGAGG - Intergenic
1046158251 8:110322604-110322626 CCCAGCTACTAGAAAGGCTGAGG + Intergenic
1047449622 8:124953167-124953189 CCCAGCTACAAGGAAGGCTGAGG + Intergenic
1047544305 8:125800576-125800598 CTCAGCTAGAAGTAAGTCATAGG - Intergenic
1048618461 8:136105244-136105266 CCCAGCAAAAAAAAAGCAAGAGG - Intergenic
1050216031 9:3324846-3324868 CCCAGCTACAAGGAAGGCTGAGG + Intronic
1050524238 9:6531621-6531643 CCCAGCTACAAGAAAGTGTGGGG - Intergenic
1051768049 9:20545900-20545922 CCCAGCTACGAGAAAGACTGAGG + Intronic
1052445155 9:28552243-28552265 CCAATCTAGAAGAAAGGTAGAGG - Intronic
1053400213 9:37812747-37812769 CCCAGCTACACAAAAGGCAGAGG - Intronic
1053855900 9:42339270-42339292 CCCAGCTAGTAGAGAGGCTGAGG - Intergenic
1054162123 9:61680971-61680993 CCCAGGATGAAGAAAGGCAGGGG - Intergenic
1054864231 9:69983548-69983570 CCCAGCAGGGAGACAGCCAGAGG - Intergenic
1055791062 9:79923678-79923700 CCCAGCTTGCAGACAGCCTGTGG + Intergenic
1057206187 9:93174177-93174199 CCCAGCTACTCGAAAGCCTGAGG - Intergenic
1057317035 9:93976112-93976134 CCCAGTTAAAAGGAAGCCAGGGG - Intergenic
1059014271 9:110497208-110497230 CCCAGGTAAAAGAAAGGCAATGG - Intronic
1059513553 9:114871494-114871516 ACAAGCTAGAAGAAAGAGAGTGG + Intergenic
1060440224 9:123632079-123632101 CCCAGTTAAAAGAATCCCAGAGG + Intronic
1060633266 9:125179097-125179119 CCCAGCTACTCGAAAGGCAGAGG + Intronic
1061276232 9:129570603-129570625 CCCAGCTACCAGAATGACAGAGG + Intergenic
1061875896 9:133543840-133543862 CCCAGCTAGAAAGAAACCAAGGG - Intronic
1203528829 Un_GL000213v1:117045-117067 CCCAGCCAGTAGAAAGGCTGAGG + Intergenic
1186254780 X:7706947-7706969 CCCATCCAGAAGAGAACCAGAGG + Intergenic
1186312906 X:8339652-8339674 CCCAGCTACAAGAGAGGCTGAGG + Intergenic
1187852795 X:23607606-23607628 GCCAGCTAGATGAAAGGCAATGG + Intergenic
1187933676 X:24315756-24315778 CCCAGCTACAAGGAAGGCTGAGG - Intergenic
1187975304 X:24699058-24699080 ACCAGCCAGAAGTAATCCAGTGG - Intronic
1188127759 X:26391289-26391311 CGCAGCTAGAATAAAGCAGGCGG - Intergenic
1188165409 X:26856945-26856967 CCCAGATAGAACAAAAACAGAGG + Intergenic
1188174370 X:26970591-26970613 CCCATCAAGAAGGAAGTCAGAGG + Intergenic
1190160490 X:48028421-48028443 CCCAGCCAGTTGAAAGCCTGAGG - Intronic
1190226396 X:48549149-48549171 CCCAGCTACTTGAAAGCCTGAGG - Intronic
1190914970 X:54804674-54804696 CTCACCTAAAAGAAATCCAGAGG + Intergenic
1191652869 X:63560703-63560725 ACCAGCTAGCAGGACGCCAGGGG - Intergenic
1192301707 X:69911290-69911312 CCTAGAAAGCAGAAAGCCAGAGG - Intronic
1194077990 X:89420438-89420460 AGCAGCTAGAACAAAGCTAGAGG - Intergenic
1194410108 X:93546845-93546867 CACAGCTAGAACAAAGCAGGTGG - Intergenic
1194861155 X:99000283-99000305 CCCATCCAGAAGAAATCCAGTGG + Intergenic
1195663883 X:107410513-107410535 GCCAGCTAGAACAAAGCAGGTGG - Intergenic
1196282238 X:113835245-113835267 CCCAGCTACTAGAGAGGCAGAGG + Intergenic
1197522328 X:127513959-127513981 CCCAGCTACATGAAAGGCTGAGG + Intergenic
1199489500 X:148382764-148382786 GCCAGCTAGAAGAAAACCGCTGG + Intergenic
1200172205 X:154085322-154085344 CCCAGCTACAAGAGAGCCTGAGG + Intronic
1200430637 Y:3075992-3076014 AGCAGCTAGAACAAAGCTAGAGG - Intergenic
1200685458 Y:6254665-6254687 CCCAGGTAGAAGCAAGCCTCAGG + Intergenic
1200990987 Y:9345906-9345928 CCCAGGTAGAAGCAAGCCTCAGG + Intergenic
1200993646 Y:9366199-9366221 CCCAGGTAGAAGCAAGCCTCAGG + Intronic
1200996308 Y:9386517-9386539 CCCAGGTAGAAGCAAGCCTCAGG + Intergenic
1200998823 Y:9455072-9455094 CCCAGGTAGAAGCAAGCCTCAGG + Intergenic
1201001478 Y:9475381-9475403 CCCAGGTAGAAGCAAGCCTCAGG + Intronic
1201004143 Y:9495683-9495705 CCCAGGTAGAAGCAAGCCTCAGG + Intergenic
1201006799 Y:9515995-9516017 CCCAGGTAGAAGCAAGCCTCAGG + Intergenic
1201009451 Y:9536301-9536323 CCCAGGTAGAAGCAAGCCTCAGG + Intergenic