ID: 1126560658

View in Genome Browser
Species Human (GRCh38)
Location 15:50040238-50040260
Sequence ACCCAGCTAGAAGAAAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126560658_1126560662 22 Left 1126560658 15:50040238-50040260 CCCTGGCTTTCTTCTAGCTGGGT 0: 1
1: 0
2: 1
3: 20
4: 218
Right 1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG 0: 1
1: 0
2: 1
3: 9
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126560658 Original CRISPR ACCCAGCTAGAAGAAAGCCA GGG (reversed) Intronic
900733637 1:4280585-4280607 ACCCAGCTTGAGAACAGCCAAGG + Intergenic
900980199 1:6041898-6041920 ACCCAGCGAGCCGAAGGCCAGGG + Intronic
901022681 1:6263008-6263030 TCCCAGCTAGCAGAAGGCCCAGG - Intergenic
903778102 1:25806002-25806024 TCCCAGTTGGAAGAAAGCCTGGG - Intronic
905552618 1:38855611-38855633 ACACAGGTAGCAGAAAGCTATGG + Intronic
908023025 1:59917779-59917801 ACCCAGGCAGAAAAAAGGCAGGG - Intronic
908328218 1:63044505-63044527 AAACAGCTTGAAGAAAGACAGGG - Intergenic
909770264 1:79413551-79413573 AGACAGATAGGAGAAAGCCATGG - Intergenic
911442994 1:97952534-97952556 ACCCAGCTACAAGAGACCCTGGG + Intergenic
912664829 1:111569589-111569611 ACCCAAGTAGAAGACAGCCTAGG - Intronic
912720564 1:112016445-112016467 ACCCAACTTGAGGAAAGGCAAGG - Intergenic
915296048 1:154922659-154922681 ACACAGCTACAAGAGAGACATGG - Intergenic
915298678 1:154939739-154939761 ATCCACCTAGATGACAGCCATGG + Intergenic
916063976 1:161121298-161121320 CCCAAGCCAGAAGAAAGCAAAGG + Exonic
916265421 1:162885752-162885774 ATCCAGCTAGAAGGAAAGCAGGG + Intergenic
920727722 1:208452143-208452165 ACACAGCTATATGAAAGCTAGGG - Intergenic
922975244 1:229778744-229778766 TCCCAGATAAATGAAAGCCAGGG + Intergenic
1062859088 10:796009-796031 ATCCAGATAGAAGAAATCCAGGG + Intergenic
1064020952 10:11808408-11808430 CCCCAAATAGAAGAATGCCATGG - Intergenic
1067019629 10:42783134-42783156 TCCCACCAAGAAGAAAGACAGGG + Intronic
1067061680 10:43081055-43081077 AGCCTGGGAGAAGAAAGCCAGGG + Intronic
1067791544 10:49292141-49292163 ACCCAACCACAAGAGAGCCAAGG + Intergenic
1067995869 10:51272650-51272672 ACCCAGCTGGGAAAAGGCCAAGG - Intronic
1068685864 10:59869468-59869490 AACCAGCAAGAAGTAAGCCTTGG + Intronic
1070719456 10:78746229-78746251 AGCCAGCTAGAAGAACAGCAGGG - Intergenic
1071472135 10:85991156-85991178 ACCCAGCCAGAAGGAAGCCAGGG - Intronic
1071506346 10:86233980-86234002 ACCCAGCAAGGAGGCAGCCAGGG - Intronic
1072966925 10:99981829-99981851 ACCCAGCAGGGAGAGAGCCAGGG - Intronic
1074954816 10:118378536-118378558 AACCAGCTAAAAGATTGCCAAGG - Intergenic
1075345596 10:121679759-121679781 ATCCAGGTAGAAGGAAGGCAGGG - Intergenic
1076243108 10:128925230-128925252 GCCCAGCCAGAAGAAAGGTATGG - Intergenic
1079256170 11:18833063-18833085 ATCCAGATACAAGAAATCCAAGG - Intergenic
1079619167 11:22532457-22532479 AACCAGCTAAAAGAAGGCAAAGG + Intergenic
1081164412 11:39789837-39789859 ACCCTGCAAGAAAAAAGGCAAGG + Intergenic
1083709417 11:64538994-64539016 ACCCAGATAGTAGGAATCCAGGG - Intergenic
1083793978 11:65003883-65003905 CCCCATCTAGAAGAAAGTCTGGG + Intergenic
1086008847 11:82073670-82073692 ACTGAGCTAGAAGAATGCAAAGG - Intergenic
1087686603 11:101272602-101272624 ACCCATTTAGAAGAAAGCCCTGG + Intergenic
1089138367 11:116267319-116267341 AGCCAGCTTGAAGAGAGCCCTGG + Intergenic
1089563692 11:119359091-119359113 GCCCATCCAGAAGAAAGCGAAGG + Exonic
1089754221 11:120674563-120674585 ACACAGCTTGGAGGAAGCCAAGG - Intronic
1090155924 11:124438850-124438872 GCCCAGCTAGGAGGAAGTCAGGG + Intergenic
1090775317 11:129959540-129959562 AACCAGATAGTAGATAGCCAAGG - Intronic
1090857571 11:130623688-130623710 AGCCAGCTAGAGGAAGGGCAGGG - Intergenic
1091586441 12:1819605-1819627 ACCAAGCTAGAGGGGAGCCAGGG - Intronic
1091820329 12:3471179-3471201 ACCCACCCAGAAGGAAGCCCTGG - Intronic
1092164939 12:6336818-6336840 TCCCAGCAGGAAGCAAGCCAAGG + Intronic
1093186579 12:16027091-16027113 ACCCATTTATAAGAAAGCCTCGG + Intronic
1096474723 12:51901308-51901330 ACTCAACCCGAAGAAAGCCAGGG + Intergenic
1096637388 12:52969403-52969425 CCCCAGCTTTAAGAAAGCCCAGG + Intergenic
1096780470 12:53988873-53988895 AGCCAGCTGGGGGAAAGCCAGGG + Intronic
1098432322 12:70433541-70433563 ACCTAGCTTCAAGAAAGCCTGGG + Exonic
1100231572 12:92613757-92613779 AAGCAGAGAGAAGAAAGCCATGG + Intergenic
1100271560 12:93029967-93029989 ACCCAGGAAGAAGAAAGGCCAGG - Intergenic
1101030611 12:100654551-100654573 ACCTAGCAAGAAGATAGCAAGGG - Intergenic
1102687281 12:114734763-114734785 ACCCAGACAGATGGAAGCCAAGG - Intergenic
1103133495 12:118488363-118488385 ACTCAGCTAGAAGAAATCTTGGG - Intergenic
1104472030 12:129036999-129037021 ACCCAGGGAGAAGAGGGCCATGG + Intergenic
1105529446 13:21204714-21204736 ATCCAGTGAGAAGAAAGCCATGG + Intergenic
1106030667 13:25999311-25999333 ACTCAGCTTGTAGAAACCCATGG - Intronic
1106925836 13:34612238-34612260 ACCCAGGCAGAAGAAAACAAGGG - Intergenic
1107439173 13:40409303-40409325 ACCCAGACAGAAGAAAGCTGTGG + Intergenic
1107966554 13:45603175-45603197 GCCCAGCTACAAGAAAAACATGG - Intronic
1108155720 13:47583090-47583112 AAAAACCTAGAAGAAAGCCAAGG + Intergenic
1110954400 13:81536046-81536068 TACCAGCTAGAAAAAAGCCCAGG + Intergenic
1111391989 13:87608499-87608521 ACCTAGCCAGAGGAAAGCCAGGG - Intergenic
1114300272 14:21370155-21370177 AGGCAGATAGAAGAAAGGCAGGG + Intronic
1114969654 14:28010345-28010367 ACACACCTTGAAGAAAGACATGG + Intergenic
1115431917 14:33329251-33329273 CTCCAGCTACATGAAAGCCAGGG - Intronic
1116495213 14:45551976-45551998 ATCCAGCTACAAGAAGGTCATGG - Intergenic
1118875137 14:69778122-69778144 TCCCAGCTAGAAGGAAGAAATGG + Intronic
1120148552 14:81006362-81006384 ACACAGCAAGAAGGAGGCCATGG - Intronic
1121597502 14:95176602-95176624 ACCCTACTAGAAGAAAACCTAGG - Intergenic
1122387424 14:101358634-101358656 ACCCAGATAGAAGAAAGTGTGGG - Intergenic
1123100126 14:105791989-105792011 ACCCTGCAAGGAGAGAGCCAGGG - Intergenic
1124065594 15:26340871-26340893 ACACAGGGAGCAGAAAGCCAGGG - Intergenic
1124911781 15:33928369-33928391 AGCAAGCTAAAAGAAAGCAAGGG + Intronic
1126560658 15:50040238-50040260 ACCCAGCTAGAAGAAAGCCAGGG - Intronic
1129484680 15:75858632-75858654 ACCAAGCAACAAGAAAGACAGGG - Intronic
1129814918 15:78543375-78543397 TCTCAGCTATAAGAGAGCCAGGG + Intronic
1130264625 15:82389156-82389178 ACCAAGCAACAAGAAAGACAGGG - Intergenic
1130507352 15:84557715-84557737 ACCAAGCAACAAGAAAGACAGGG + Intergenic
1130717113 15:86345899-86345921 AATCAGCAAGAAGAAGGCCAAGG - Intronic
1130864714 15:87922799-87922821 ACACATCTAGAAGAAAAACAGGG - Intronic
1132373001 15:101310828-101310850 ACCCAGCTGGCAGCCAGCCATGG + Intronic
1132746715 16:1439266-1439288 CCTCAGCCGGAAGAAAGCCACGG + Intronic
1136096718 16:27962252-27962274 ACCCAGCTAGAAGGGAGGCTGGG - Intronic
1142605909 17:1080969-1080991 AGCCACCTGGCAGAAAGCCAGGG + Intronic
1145786718 17:27598405-27598427 ACCCAGCCAGCAGGAGGCCAGGG + Intronic
1146473951 17:33146727-33146749 AACCAGCCAGCTGAAAGCCAAGG - Intronic
1151553115 17:74833316-74833338 CTTCAGCTAGAACAAAGCCATGG - Intronic
1153354085 18:4116872-4116894 ACACAGACAGAAGAAAGGCAGGG - Intronic
1154078570 18:11230640-11230662 TCCCAGCTTGAAGACAGTCAGGG - Intergenic
1154169940 18:12044150-12044172 CTCCAGCCAGCAGAAAGCCAGGG - Intergenic
1155294772 18:24374965-24374987 ACCAAGCTAGAGGAAACACAGGG + Intronic
1155638777 18:27987223-27987245 ACCACTGTAGAAGAAAGCCACGG + Intronic
1155676766 18:28439348-28439370 ATCCAGATATAAGAAATCCAGGG - Intergenic
1156853989 18:41760796-41760818 CCCCAGCTAACAGAAAGGCATGG - Intergenic
1156945134 18:42820568-42820590 AACCATTAAGAAGAAAGCCAGGG - Intronic
1157527071 18:48391864-48391886 ACCCAGCTTGTAGAAACTCAAGG + Intronic
1159642784 18:70882846-70882868 CCCCAGCTTGAAGGAAGCCCTGG + Intergenic
1161731078 19:5960966-5960988 ACCCAGAGAACAGAAAGCCAGGG + Intronic
1166976224 19:46606658-46606680 AGCAAGCTAGAAGAAATCCCTGG + Intronic
1167752272 19:51388210-51388232 ACACAGCTCGGACAAAGCCAGGG - Intergenic
924992210 2:321996-322018 CCCCAGATAGAAGGAAGCCATGG + Intergenic
928363184 2:30681797-30681819 ACTAAACTAGAAGACAGCCAAGG - Intergenic
928385724 2:30866148-30866170 ACACAGCTAAGTGAAAGCCAGGG - Intergenic
929288707 2:40165045-40165067 ATCCTGCCATAAGAAAGCCAAGG + Intronic
931115827 2:59165647-59165669 AGCCAGCCAGAACAAGGCCAAGG + Intergenic
932732623 2:74231899-74231921 AGCCACGTAGGAGAAAGCCAGGG + Intronic
936656540 2:114494687-114494709 ACCCAGCTACTCCAAAGCCATGG - Intronic
938633484 2:133196005-133196027 ACCCAGAAAGAAGGAAGCCATGG - Intronic
938920982 2:135994618-135994640 TCCCAAATAGAAGTAAGCCAGGG + Intergenic
941918063 2:170824728-170824750 AATCAGCTAGAAGAAACCCATGG + Intronic
944501289 2:200362658-200362680 ACCCAGGTAGAAGGAAGTAATGG + Intronic
945152276 2:206803732-206803754 ACAGAGCAAGAAGAAATCCAGGG - Intergenic
947260276 2:228213912-228213934 ACACAGATGGGAGAAAGCCAAGG + Intergenic
1169016804 20:2298917-2298939 TCCCAGGTGGAAGAAGGCCATGG - Intronic
1170932305 20:20780254-20780276 ACCCAGCAAGAGTGAAGCCAGGG + Intergenic
1172792501 20:37515570-37515592 CCCCAGGGAGAAGAAATCCAGGG + Intronic
1173720383 20:45253135-45253157 ACCCAGCAAGGAGGAAGCCTGGG - Exonic
1174538456 20:51270975-51270997 CCTCAGCTAGAGGAAAGCAATGG + Intergenic
1174665669 20:52255540-52255562 AAGCAGCTAGAAGGTAGCCAGGG + Intergenic
1175972112 20:62691952-62691974 AACCAGCTTGAGGAAAGGCAGGG + Intergenic
1178352917 21:31885654-31885676 ACACAGGAAGAAGACAGCCATGG - Intronic
1178497871 21:33102159-33102181 ACTGAGCAAGAAAAAAGCCAGGG + Intergenic
1181618604 22:24072043-24072065 GCCCAGAGAGAAGAGAGCCATGG - Intronic
1181747079 22:24962927-24962949 ACCCAGCCAGAAAAGAGTCACGG + Intronic
1182239603 22:28904828-28904850 ACTCAGCCTGAAGAAAGTCAAGG - Intronic
1182594011 22:31403908-31403930 AACCAGCTAGAATCAAGCCATGG - Intronic
1183085807 22:35486291-35486313 ACGCAGCAGGAAGAAAACCAGGG - Intergenic
949285820 3:2403057-2403079 CCAAAGCTAGAAGAAAGGCATGG - Intronic
949359269 3:3214606-3214628 ACCCAGAAAGAAGAAAGACTGGG + Intergenic
950203834 3:11062899-11062921 ACCCAGGCAGAAGGGAGCCAAGG + Intergenic
950485426 3:13270558-13270580 ACCCAGAGAGAATAAAGACAGGG - Intergenic
950515075 3:13459892-13459914 AAGCAGCTAGAAGAAAGGAAGGG + Intergenic
951050097 3:18084636-18084658 GCCCAGCTAGTTGACAGCCAAGG + Intronic
952891906 3:38048673-38048695 CTCCCGATAGAAGAAAGCCATGG - Intronic
953199944 3:40769640-40769662 CCCCAGCTAGAAGATTTCCAAGG - Intergenic
954468433 3:50672503-50672525 ACCCAGCCAGAACAAGGCAATGG + Intergenic
955335446 3:58081742-58081764 ACTCAACCCGAAGAAAGCCAGGG + Exonic
955405076 3:58620797-58620819 ACCCAGCTTGGGGAAGGCCAAGG + Intronic
956667693 3:71657639-71657661 TCCCAGCTAAAAGAAAACCCTGG + Intergenic
956730468 3:72192003-72192025 ACACAGCAAGACTAAAGCCATGG + Intergenic
959869205 3:111307207-111307229 ATCCAGCTAGAACCAATCCATGG - Intronic
960272484 3:115689994-115690016 ACAGAGCTACAAGAAAACCACGG - Intronic
960963171 3:123086068-123086090 ACCCATCCAGGAGGAAGCCAAGG - Intronic
961197904 3:125018789-125018811 AACCAGCTAGAAGAAGGGCCTGG + Intronic
961249552 3:125489177-125489199 ACCCTTCTAGAAAAAAGCAATGG + Intronic
967806907 3:193722606-193722628 ACCCAAGGAGAAGAAAGCCTGGG - Intergenic
968130915 3:196192385-196192407 TCTCAGCAAGAAGAAAACCAAGG - Intergenic
969937122 4:10693428-10693450 ACACAGGGAGAAGACAGCCATGG + Intergenic
970483812 4:16504492-16504514 ACCCAGCAATAAAAATGCCAGGG + Intronic
970738227 4:19199038-19199060 ACCCAGCAGGAAGGAAACCAAGG - Intergenic
971437938 4:26647722-26647744 ACTCAGCTGGGAGGAAGCCAGGG - Intronic
971642409 4:29152483-29152505 ATCCAGATAAAAGAAAGCAACGG - Intergenic
972961749 4:44461476-44461498 ACCCAGCAGGAAGGAAGCAAGGG + Intergenic
973645491 4:52947116-52947138 ACTCAGCTAGAAAAAAGTCTTGG + Intronic
973798013 4:54448767-54448789 ACCCAGCAGGAAGGAAGCCAAGG + Intergenic
977070701 4:92382287-92382309 ACCCATACAAAAGAAAGCCAGGG + Intronic
981229768 4:142339009-142339031 ACCCAGCAGGAAGACAGCAAAGG - Intronic
982932188 4:161422632-161422654 AGTCTGCTAGAAGAAAGCAAGGG - Intronic
985334649 4:188878700-188878722 ACACAACTAAAAGAAAGCCAAGG - Intergenic
985820558 5:2157333-2157355 ACCCAGGTAGAACAATCCCAAGG + Intergenic
986311244 5:6552626-6552648 AGTCAGCTAAAAGGAAGCCAAGG + Intergenic
989760753 5:45013402-45013424 ACTCAGAGAGAAGATAGCCACGG + Intergenic
990050109 5:51487533-51487555 ACCCAACTAGAATAGAGACACGG - Intergenic
990330537 5:54720941-54720963 AGCCAGCCAGAACAAAGCCGTGG + Intergenic
993624338 5:90206268-90206290 TCCCAGATAAAAAAAAGCCAAGG + Intergenic
994002914 5:94802616-94802638 AGGCAGCTGGAAGAAACCCAAGG + Intronic
994224149 5:97232581-97232603 ACCCAGATGGAAGGGAGCCATGG - Intergenic
996520683 5:124422370-124422392 ATCCAGGTACAAGAAGGCCAAGG + Intergenic
996906241 5:128604152-128604174 ACCCTCCTAAAAGAAAGACATGG - Intronic
999796019 5:154990530-154990552 ACCCAGCTGCAAGAAAGCTTGGG + Intergenic
1000162255 5:158609872-158609894 ACCCAGAGAGAAGAAAGACAAGG + Intergenic
1001270585 5:170308447-170308469 CCCTAGCTAGAAGACACCCAGGG - Intergenic
1003402561 6:5802937-5802959 ATCCAGTGAGAAGAAAGCCATGG - Intergenic
1003508686 6:6761759-6761781 ACCCACCTAGAAGAAAAACTCGG - Intergenic
1003881027 6:10479862-10479884 ACCTAGGTAGACGAATGCCATGG + Intergenic
1006835963 6:36999034-36999056 ACCCTTCCAGAAGAAAGCCTCGG + Intergenic
1012469982 6:99560816-99560838 ACCAAGCCAGAAGGAAGGCAAGG - Intronic
1015791474 6:136968394-136968416 TCCCAGCGGGGAGAAAGCCATGG - Intergenic
1016941800 6:149488543-149488565 ACACAGCAAGAGGAAAGCCGTGG - Intergenic
1018786477 6:167112321-167112343 ACACAGCCAGAAGATGGCCATGG + Intergenic
1019291655 7:253472-253494 AAACAGCAAGGAGAAAGCCAGGG - Intronic
1019619029 7:1980536-1980558 CTCCAGCTAGGAGAAAGCAAAGG + Exonic
1020532089 7:9350926-9350948 ACTCAGCTAGAAAACTGCCATGG - Intergenic
1021034782 7:15784792-15784814 ACCCAGGTAGTAGTACGCCATGG + Intergenic
1022753416 7:33257318-33257340 GACCAGGCAGAAGAAAGCCAGGG - Exonic
1024728786 7:52231584-52231606 ACACAGGCAGAAGACAGCCATGG + Intergenic
1027842218 7:83327170-83327192 ACCCAACTGGAAGACAGACAGGG + Intergenic
1028315799 7:89401111-89401133 ACCCAGCTAGCACAAAGCAATGG + Intergenic
1029645302 7:101851436-101851458 AACCAGGAAGAACAAAGCCATGG - Intronic
1031363223 7:120871802-120871824 AACCTGCAAGAAGCAAGCCAGGG + Intergenic
1033186989 7:139236252-139236274 CCCCTACTAGAAGAAAGGCATGG + Intronic
1033208160 7:139440040-139440062 ACACAGGGAGAAGACAGCCAAGG - Intergenic
1033552692 7:142462396-142462418 ACCCAGCAAGAAGGGAGCCATGG + Intergenic
1033555009 7:142481688-142481710 ACCCAGCAAGAAAGGAGCCAAGG + Intergenic
1033557201 7:142499354-142499376 ACCCAGCAAGAAGGGAGCCATGG + Intergenic
1033559611 7:142519220-142519242 ACCCAGCAAGAAGGCAGCCAAGG + Intergenic
1033696673 7:143795736-143795758 ACCCAGCTAGCAGCAAGGCGAGG + Intergenic
1034194242 7:149233861-149233883 GCTCAGTTAGAAGAAACCCAGGG + Intergenic
1036165128 8:6425523-6425545 ACCCAGGTAGATGAAATTCAGGG + Intronic
1036679590 8:10861418-10861440 TCCCAGCAAGAAGAAAATCAGGG + Intergenic
1037587226 8:20286046-20286068 AAGCATCTAGAAGAAAACCAAGG + Intronic
1037739519 8:21596380-21596402 AGACAGCTAGTAGGAAGCCAGGG + Intergenic
1037746165 8:21646664-21646686 ACTCACCTAGAGGAATGCCACGG + Intergenic
1037924414 8:22833211-22833233 ACCCAATTAGAAGAAATCCCTGG + Intronic
1039379151 8:37068495-37068517 GTCCAGCAAGAAGAGAGCCATGG + Intergenic
1039532823 8:38278892-38278914 GCCCAGCTAGAAGAAAGCTTAGG - Intronic
1040722653 8:50344999-50345021 ACACAGGGAGAAGCAAGCCAAGG + Intronic
1041040687 8:53843233-53843255 GCACAGGTAGAAGGAAGCCAGGG + Exonic
1042163438 8:65921587-65921609 ACCCATCAAGGAGAAAGCCAGGG - Intergenic
1043028168 8:75097851-75097873 ACTGAGAGAGAAGAAAGCCAAGG - Intergenic
1043797721 8:84566419-84566441 AGCAAGCTACAACAAAGCCAAGG + Intronic
1045418419 8:101990301-101990323 ACCCAGCTTTGAGGAAGCCAGGG + Intronic
1047930742 8:129726350-129726372 ACCCAGCAAGGAGAAAGACATGG + Intergenic
1049536971 8:143186959-143186981 ACCCAGCTAGACCCCAGCCAGGG - Intergenic
1049969310 9:807625-807647 ACCCAGCAGGGAGAAAACCAGGG - Intergenic
1050270780 9:3942401-3942423 ACCCAAAGAGAAGAAAGGCATGG + Intronic
1050308822 9:4332412-4332434 ACTCAGCTATAAGGAAGGCAGGG - Intronic
1052794568 9:32911460-32911482 ACCGAAAGAGAAGAAAGCCAAGG - Intergenic
1055746633 9:79454073-79454095 TCCCAGCTAGAATAAAGCTCTGG + Intergenic
1057317037 9:93976113-93976135 TCCCAGTTAAAAGGAAGCCAGGG - Intergenic
1057552885 9:96065018-96065040 AGCCAGAGAGAAGGAAGCCAGGG - Intergenic
1058533253 9:105927989-105928011 ACCACGTTAGAAGAAACCCAAGG - Intergenic
1059262854 9:112995227-112995249 TCCCAGCTTGAAGACAGGCAGGG - Intergenic
1059901009 9:118925560-118925582 ACACAGCTAGAAAAATGACATGG + Intergenic
1060770738 9:126329941-126329963 GCCCAGCAAGCAGAAGGCCAAGG - Intronic
1060915929 9:127390703-127390725 AAGCGGTTAGAAGAAAGCCAAGG + Exonic
1061001875 9:127907273-127907295 ACCCAGTGAGAGGAGAGCCAGGG - Intergenic
1061553231 9:131349941-131349963 ACCCAGCTGGAAATCAGCCATGG + Intergenic
1061875898 9:133543841-133543863 TCCCAGCTAGAAAGAAACCAAGG - Intronic
1062038284 9:134392414-134392436 ACCCACCTAGAAAGATGCCAAGG - Intronic
1187603362 X:20858011-20858033 ACCCAGCCAGAAGAAAAACAAGG + Intergenic
1187748404 X:22433758-22433780 ACCCTGGTAGTAGAAAGCAAAGG + Intergenic
1191192100 X:57678563-57678585 CGCCAACGAGAAGAAAGCCAAGG - Intergenic
1196713220 X:118785514-118785536 ACTAAGCTAGAAGAAACACAGGG - Intronic
1199659533 X:150034948-150034970 ACCCAGATAGAAGAAAACAGTGG + Intergenic
1200024591 X:153246320-153246342 ACCCAGTTAGATGAATGACATGG - Intergenic