ID: 1126560659

View in Genome Browser
Species Human (GRCh38)
Location 15:50040239-50040261
Sequence AACCCAGCTAGAAGAAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126560659_1126560662 21 Left 1126560659 15:50040239-50040261 CCTGGCTTTCTTCTAGCTGGGTT 0: 1
1: 0
2: 2
3: 10
4: 214
Right 1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG 0: 1
1: 0
2: 1
3: 9
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126560659 Original CRISPR AACCCAGCTAGAAGAAAGCC AGG (reversed) Intronic
900980198 1:6041897-6041919 AACCCAGCGAGCCGAAGGCCAGG + Intronic
903210831 1:21817282-21817304 AACACAGGAAGAAGGAAGCCTGG + Intronic
903643994 1:24879846-24879868 AGGCTAGATAGAAGAAAGCCAGG - Intergenic
903663560 1:24993366-24993388 AACACACCTAGCAGAACGCCTGG + Intergenic
903778103 1:25806003-25806025 CTCCCAGTTGGAAGAAAGCCTGG - Intronic
905230152 1:36510186-36510208 AGCCCAGCTTGAAGGAAGCAAGG + Intergenic
906087539 1:43148649-43148671 GACCCAGCAGGAGGAAAGCCAGG + Intronic
907862267 1:58364854-58364876 AACCCAGCTAGGTGAGATCCTGG - Intronic
908023026 1:59917780-59917802 AACCCAGGCAGAAAAAAGGCAGG - Intronic
908845761 1:68322814-68322836 GACCCAGCTACAAGAAAACTGGG + Intergenic
910855546 1:91691607-91691629 AAACCAGGAAGAAGAAAGGCAGG + Intronic
911442993 1:97952533-97952555 AACCCAGCTACAAGAGACCCTGG + Intergenic
912521392 1:110247503-110247525 AATATATCTAGAAGAAAGCCAGG - Intronic
912732074 1:112116005-112116027 AACACAGATAGAAGAAGCCCAGG + Intergenic
915357519 1:155264417-155264439 GAACCAGGTAGAAGAATGCCAGG + Intronic
916507940 1:165444968-165444990 AGCCCAAGTTGAAGAAAGCCGGG - Exonic
917137001 1:171797563-171797585 AAACCACTTAGAAGAATGCCTGG - Exonic
919218799 1:194598283-194598305 AACCCAGCTAGCACAAAGAGGGG - Intergenic
920688757 1:208129914-208129936 AAGCCAGGTAGAAGGAAGACAGG - Intronic
920727723 1:208452144-208452166 AACACAGCTATATGAAAGCTAGG - Intergenic
920986947 1:210899682-210899704 AAACCACCTAGTAGAATGCCTGG - Intronic
1062859087 10:796008-796030 CATCCAGATAGAAGAAATCCAGG + Intergenic
1063883534 10:10554440-10554462 AACACAGCTGGAAGTAGGCCTGG - Intergenic
1064735612 10:18378990-18379012 AAGTCTGCTGGAAGAAAGCCCGG - Intronic
1067079286 10:43204285-43204307 GCCCCAGCCAGAAGCAAGCCAGG + Intronic
1071472136 10:85991157-85991179 GACCCAGCCAGAAGGAAGCCAGG - Intronic
1071506347 10:86233981-86234003 AACCCAGCAAGGAGGCAGCCAGG - Intronic
1072966926 10:99981830-99981852 AACCCAGCAGGGAGAGAGCCAGG - Intronic
1073748428 10:106496268-106496290 TACACAGCATGAAGAAAGCCTGG + Intergenic
1074003993 10:109400678-109400700 AATGCAACTATAAGAAAGCCTGG - Intergenic
1074794280 10:116925330-116925352 AACCCAGTTAGAAGGCAGTCAGG - Intronic
1075771826 10:124944941-124944963 AACACAGACAGAAGATAGCCCGG - Intronic
1079871321 11:25801680-25801702 AGCACAGCTAGAATAAAGCAGGG - Intergenic
1080321098 11:31010223-31010245 CACTCAGCAAGAAGACAGCCAGG - Intronic
1080902673 11:36510405-36510427 ACCCGAGCAGGAAGAAAGCCAGG - Intergenic
1083709418 11:64538995-64539017 AACCCAGATAGTAGGAATCCAGG - Intergenic
1083793976 11:65003882-65003904 GCCCCATCTAGAAGAAAGTCTGG + Intergenic
1084302033 11:68258365-68258387 AAGGCAGGGAGAAGAAAGCCCGG + Intergenic
1084887919 11:72223067-72223089 AACCCAGCTGGAGCAGAGCCTGG - Intergenic
1087306430 11:96494743-96494765 AATCCAACCAGATGAAAGCCAGG + Intronic
1087852984 11:103054664-103054686 AAGCCAGTCAGAAGAAATCCTGG - Intergenic
1088803459 11:113329200-113329222 AGCCCATCTGGAAGATAGCCTGG - Intronic
1090857572 11:130623689-130623711 AAGCCAGCTAGAGGAAGGGCAGG - Intergenic
1096474722 12:51901307-51901329 AACTCAACCCGAAGAAAGCCAGG + Intergenic
1098432321 12:70433540-70433562 TACCTAGCTTCAAGAAAGCCTGG + Exonic
1100501800 12:95181446-95181468 AACTTAGCTAGAAGGAATCCAGG + Intronic
1101821110 12:108184887-108184909 GACAGAGCTACAAGAAAGCCTGG - Intronic
1102148245 12:110670672-110670694 AACACAGCTGACAGAAAGCCAGG + Intronic
1102525920 12:113512315-113512337 GGCCCAGAGAGAAGAAAGCCTGG - Intergenic
1102805173 12:115773500-115773522 AATCCAGTTAGCACAAAGCCTGG - Intergenic
1103133496 12:118488364-118488386 GACTCAGCTAGAAGAAATCTTGG - Intergenic
1103186710 12:118964329-118964351 AAACCAGCAAGAAGAAGGCAGGG - Intergenic
1104131788 12:125900902-125900924 ACCCCAGGAAGAAGAAAGACAGG - Intergenic
1106570767 13:30925106-30925128 GACCCATGTAGAAGGAAGCCAGG + Exonic
1106925837 13:34612239-34612261 AACCCAGGCAGAAGAAAACAAGG - Intergenic
1107495607 13:40922704-40922726 AGCCCACTAAGAAGAAAGCCTGG - Intergenic
1108668009 13:52652196-52652218 AGCCCACTAAGAAGAAAGCCTGG + Intergenic
1108783997 13:53872350-53872372 AACCCAACGGGAAGAAAACCAGG - Intergenic
1108951233 13:56097169-56097191 TCCCCAGATAGGAGAAAGCCAGG - Intergenic
1109367254 13:61371767-61371789 AACCCAGGTTGAAGAACGCTGGG - Intergenic
1111391990 13:87608500-87608522 CACCTAGCCAGAGGAAAGCCAGG - Intergenic
1111441169 13:88284233-88284255 AGTGCAGCTAGAATAAAGCCAGG + Intergenic
1114300271 14:21370154-21370176 AAGGCAGATAGAAGAAAGGCAGG + Intronic
1115320009 14:32069549-32069571 AAACCAGGAAGAAGGAAGCCTGG + Intergenic
1115431918 14:33329252-33329274 ACTCCAGCTACATGAAAGCCAGG - Intronic
1116475319 14:45332559-45332581 CTCCCAGCTAGAAGAAGGCATGG - Intergenic
1118185345 14:63532728-63532750 AACCCAGCTAGTGGTAAGCTAGG + Intronic
1121408550 14:93733988-93734010 AACCCACCTAGAAGGAGGCTGGG - Intronic
1122313839 14:100814041-100814063 TACCCAGCAAGAAGCAGGCCTGG - Intergenic
1122387425 14:101358635-101358657 GACCCAGATAGAAGAAAGTGTGG - Intergenic
1123100127 14:105791990-105792012 AACCCTGCAAGGAGAGAGCCAGG - Intergenic
1126560659 15:50040239-50040261 AACCCAGCTAGAAGAAAGCCAGG - Intronic
1129653386 15:77507102-77507124 ATCCCAGCTTGAAGACAGTCAGG - Intergenic
1130086707 15:80783786-80783808 AACCAAGCTTGAACAAAGCCTGG - Intronic
1130864715 15:87922800-87922822 AACACATCTAGAAGAAAAACAGG - Intronic
1131897884 15:97053639-97053661 AGCACAGCTAGAATAAAGCAGGG - Intergenic
1133743014 16:8665585-8665607 TACCCAGCTTGAAGAAAGCCTGG + Intergenic
1134899795 16:17927149-17927171 ACCCCAGCTGGAAGACTGCCAGG + Intergenic
1136096719 16:27962253-27962275 CACCCAGCTAGAAGGGAGGCTGG - Intronic
1137589295 16:49683731-49683753 AAAGCAGCTACAAGACAGCCTGG + Intronic
1137741119 16:50775584-50775606 AACACAGTTTGAAAAAAGCCTGG - Intronic
1138659440 16:58508795-58508817 AGCCCTGGGAGAAGAAAGCCTGG + Intronic
1140188027 16:72791732-72791754 AAGCCAGCTAGACATAAGCCAGG - Intronic
1142605908 17:1080968-1080990 AAGCCACCTGGCAGAAAGCCAGG + Intronic
1143537540 17:7550128-7550150 TCCCCAGACAGAAGAAAGCCAGG + Exonic
1148972878 17:51499773-51499795 AACCAAGCTAGATGAAAGGTTGG - Intergenic
1149276967 17:55052150-55052172 CTCCCCACTAGAAGAAAGCCAGG + Intronic
1149539557 17:57458766-57458788 ATCCCACCTTGAACAAAGCCTGG - Intronic
1150419298 17:65016756-65016778 AACAAAGCTAGAAGAAAACATGG - Intronic
1153855805 18:9145238-9145260 ATCCCAGCTACAAGACAGGCTGG - Intronic
1154490456 18:14918047-14918069 AGCCCAGCAAGAAGAAAGCGGGG + Intergenic
1155569487 18:27176081-27176103 AAGGCAGCTTGAAGAAAGCCAGG + Intronic
1155727859 18:29112214-29112236 GACACTGCAAGAAGAAAGCCAGG - Intergenic
1156245453 18:35293589-35293611 AGCCCAGCGAGGAGAGAGCCAGG + Intergenic
1158749106 18:60238352-60238374 AGCCCAGAAAGAAGAAAACCAGG + Intergenic
1158950585 18:62491190-62491212 AGCACAGCTAGAACAAAGCACGG + Intergenic
1158987491 18:62833476-62833498 AACACAGGTAGAAGAAACTCTGG - Intronic
1164740049 19:30569286-30569308 ATCCTAGCTAGAGGAAAGTCTGG + Intronic
1166010731 19:39940203-39940225 AAACCATGGAGAAGAAAGCCTGG - Intergenic
925004706 2:432889-432911 AAGCAAGCTAGAAAACAGCCCGG + Intergenic
925068091 2:945104-945126 CAGCCAGCTAGAAGCAACCCTGG - Intergenic
928853658 2:35779820-35779842 AACACAGGAAGCAGAAAGCCTGG - Intergenic
930842077 2:55858441-55858463 AACCAGGCTAGAGGAAAACCTGG - Intergenic
933367270 2:81368570-81368592 AATTCAACCAGAAGAAAGCCAGG + Intergenic
933584088 2:84161215-84161237 AATCCAGCTAGAAGAATGGTTGG + Intergenic
935247845 2:101234757-101234779 ACCCCATCTTGAATAAAGCCTGG + Intronic
937037511 2:118794152-118794174 ATCCCAGCTGGAAGGAAACCTGG + Intergenic
940494964 2:154416004-154416026 ATGCAAGCTAGAAGAAAGCAGGG + Intronic
940629635 2:156221419-156221441 AAGCCAGAGAGAAGAAGGCCAGG + Intergenic
941954466 2:171190617-171190639 AAACTTGCTAGAGGAAAGCCTGG + Intronic
942026317 2:171913996-171914018 TACCAAGCTCTAAGAAAGCCTGG - Intronic
943838890 2:192552329-192552351 AGGCCAGTTGGAAGAAAGCCTGG - Intergenic
945258515 2:207822892-207822914 AAACCAGCTAGAGGACAGCTGGG - Intergenic
945703791 2:213203957-213203979 AACACAAATAGAAGATAGCCAGG - Intergenic
947718401 2:232352976-232352998 AGCCCTGCCAGAAGAAGGCCTGG + Intergenic
948226770 2:236317501-236317523 AACCCAGCTAAAAGTAACCTAGG + Intergenic
1170149481 20:13214731-13214753 AAGCCAGCTTGTAAAAAGCCTGG + Intergenic
1170381426 20:15764042-15764064 AACCAAACTGGAAGAAAGGCTGG + Intronic
1170416450 20:16147982-16148004 AAACCACCTAGAGGAAAACCTGG + Intergenic
1170932304 20:20780253-20780275 AACCCAGCAAGAGTGAAGCCAGG + Intergenic
1173583981 20:44167840-44167862 CACCTAGCTAGAAGAATGCATGG - Intronic
1173720384 20:45253136-45253158 CACCCAGCAAGGAGGAAGCCTGG - Exonic
1173971230 20:47153952-47153974 AAGCCAGCTAGAACAGTGCCTGG - Intronic
1174540274 20:51283942-51283964 AACCAAGCTAGCAGAAAGGAAGG - Intergenic
1175383164 20:58577466-58577488 CACCCGGCCAGAAGACAGCCAGG + Intergenic
1175972111 20:62691951-62691973 AAACCAGCTTGAGGAAAGGCAGG + Intergenic
1177528467 21:22329399-22329421 AGCACAGCTAGAATAAAGCAGGG - Intergenic
1178497870 21:33102158-33102180 AACTGAGCAAGAAAAAAGCCAGG + Intergenic
1180175858 21:46088403-46088425 AACCCAGCAAGAAAAGAGACAGG + Intergenic
1182630773 22:31683596-31683618 AATACAGTTAGAAGAGAGCCAGG - Exonic
1184563906 22:45279765-45279787 ATCCCAGCTACTAGAAAGGCTGG + Intergenic
949359268 3:3214605-3214627 AACCCAGAAAGAAGAAAGACTGG + Intergenic
950319484 3:12036705-12036727 AGTACAGCTAGAAGGAAGCCAGG - Intronic
950503142 3:13377052-13377074 AACCCAGTACGGAGAAAGCCAGG + Intronic
951778073 3:26332491-26332513 AAAGCAGTAAGAAGAAAGCCTGG + Intergenic
952330303 3:32358603-32358625 AACACAGAAAGAACAAAGCCAGG - Intronic
954247803 3:49345463-49345485 AAGGGAGCTAGAAGAAAACCTGG + Intergenic
954688975 3:52385856-52385878 AAAGAAGCTAGAAGAAAGGCAGG + Intronic
955335445 3:58081741-58081763 AACTCAACCCGAAGAAAGCCAGG + Exonic
956429566 3:69171920-69171942 AAACCAGCTGGAAGACAACCTGG - Exonic
958039939 3:88215354-88215376 CACACAGGTAGAAGAAAGCAAGG + Intergenic
958259746 3:91366727-91366749 AACACAGTTAGGAGAAATCCTGG + Intergenic
958858637 3:99418406-99418428 AACCCAGCTATTAGAAACACTGG - Intergenic
959263623 3:104111831-104111853 AAGCCAACTACATGAAAGCCAGG - Intergenic
960262908 3:115588625-115588647 TTCCCAGCTAGGAGAGAGCCTGG + Intergenic
960358264 3:116679478-116679500 AGTCTAGCTAGAAGAAAGCCAGG + Intronic
960942425 3:122943473-122943495 AAGCCAGCTGGGAGAAATCCCGG + Exonic
961640215 3:128360393-128360415 GACCCAGCTGGAAGAATCCCGGG - Intronic
965978528 3:174657145-174657167 AACCCAGCTACTAGAGAGGCTGG - Intronic
966923397 3:184629175-184629197 CACCCAGGCAGAAGGAAGCCAGG + Intronic
967806908 3:193722607-193722629 AACCCAAGGAGAAGAAAGCCTGG - Intergenic
970483811 4:16504491-16504513 AACCCAGCAATAAAAATGCCAGG + Intronic
970836963 4:20420874-20420896 GATACAGCAAGAAGAAAGCCAGG + Intronic
971314336 4:25554716-25554738 AACCCACCTAGAAGAAGTGCTGG + Intergenic
972961748 4:44461475-44461497 AACCCAGCAGGAAGGAAGCAAGG + Intergenic
973192585 4:47402535-47402557 AACCCAGCTAGACCACTGCCAGG + Intronic
973720399 4:53718126-53718148 AACTTAGCTATAAGAAAGGCTGG + Intronic
978763766 4:112383118-112383140 ATGCCAGATAGAAGAGAGCCTGG + Intronic
982287142 4:153747169-153747191 AACACAGCTAGAAGGAAGCCAGG - Intronic
983163642 4:164448160-164448182 AACACAGATAGAGGGAAGCCAGG - Intergenic
986428027 5:7654175-7654197 CATCCAGCGAGAGGAAAGCCAGG + Intronic
987403859 5:17505184-17505206 AAACCAACTAGAAGAAAACAGGG - Intergenic
987411328 5:17617929-17617951 AAACCAACTAGAAGAAAACAGGG - Intergenic
987413755 5:17641248-17641270 AAACCAACTAGAAGAAAACAGGG - Intergenic
990656571 5:57963108-57963130 AACCTAGCTGGAAGAGAGTCTGG + Intergenic
990826363 5:59903624-59903646 AAACCAGCTAAAATAATGCCTGG - Intronic
990935503 5:61144014-61144036 AATCCAGGTAGAAAAAAGGCAGG - Intronic
991525820 5:67556661-67556683 AACACAACTAGAAGAAAACATGG - Intergenic
997369738 5:133350923-133350945 AACTTAGCTATAAGAAAGGCTGG + Intronic
997690875 5:135826745-135826767 CACACAGCTAGCAGACAGCCGGG + Intergenic
998724009 5:144988173-144988195 AAAACACCTAGAAGAAAACCTGG + Intergenic
999196344 5:149784125-149784147 AACCCAAGTAGAAGAAAGAAGGG - Intronic
999614389 5:153406658-153406680 GAGCCACCTAGAAGAAAGCTGGG - Intergenic
999796018 5:154990529-154990551 CACCCAGCTGCAAGAAAGCTTGG + Intergenic
1001257484 5:170195171-170195193 AACCCTGCCAGAATAAGGCCAGG - Intergenic
1002479959 5:179493439-179493461 AACACAACTAGGAGAAAACCTGG + Intergenic
1002512361 5:179730555-179730577 AGCTCAGCTAGAAGAAAGTGAGG - Exonic
1002949771 6:1798513-1798535 ATTCCAGCTACGAGAAAGCCTGG - Intronic
1004011120 6:11688487-11688509 AACACAGCTGGAGGAAAGCTGGG + Intergenic
1004238603 6:13898098-13898120 AACCCAAGCAGCAGAAAGCCTGG - Intergenic
1004554030 6:16678492-16678514 ATCCCAGCCAAAAGACAGCCAGG - Intronic
1005021107 6:21419560-21419582 AACCAGGCTCGAGGAAAGCCGGG - Intergenic
1009184017 6:60552404-60552426 AACACAGTTAGGAGAAATCCTGG - Intergenic
1010394451 6:75374794-75374816 AAACCAGCTAGATGAGACCCAGG + Intronic
1010664833 6:78616667-78616689 GACCAAGCTAGAAGAAAGGAAGG - Intergenic
1012256550 6:97039524-97039546 AAAATAGCTAGAAGACAGCCGGG + Intronic
1012791502 6:103703805-103703827 AAACCTGCTAGAATAATGCCAGG - Intergenic
1012871945 6:104683197-104683219 AACCAAGCAACGAGAAAGCCAGG + Intergenic
1013667172 6:112360712-112360734 AGCCCAGCTGGAAAAAGGCCAGG + Intergenic
1014559270 6:122871380-122871402 AACCCAGCCAGAATAAAAGCAGG - Intergenic
1016286108 6:142474666-142474688 AAGCCAGGGAGAAGAAAGGCTGG - Intergenic
1017931539 6:158959600-158959622 AGCACAGCTAGAAGGAAGCCAGG - Intergenic
1020686121 7:11297756-11297778 AACCCAGAGAGATTAAAGCCTGG + Intergenic
1025975219 7:66364297-66364319 AACCCAGCTAGAATAATATCTGG - Intronic
1027842217 7:83327169-83327191 AACCCAACTGGAAGACAGACAGG + Intergenic
1028452682 7:91003551-91003573 ACCCCAGATAAAAGAAACCCAGG - Intronic
1030148068 7:106376520-106376542 ATCCCAGCTAGAAGACAATCAGG + Intergenic
1031363222 7:120871801-120871823 AAACCTGCAAGAAGCAAGCCAGG + Intergenic
1031388846 7:121188175-121188197 AACCCAGTGAGAAGAAATCAGGG + Intronic
1031773476 7:125876317-125876339 AACCCAGATATTAGAAAACCTGG - Intergenic
1031901541 7:127416859-127416881 AGCCCTGCTAGAAGATAGCAGGG + Intronic
1031991980 7:128204477-128204499 GTCCCAGCTCGAAGACAGCCAGG + Intergenic
1032800010 7:135310333-135310355 AACCCACCTAGGAGAAAAACGGG + Intergenic
1034194241 7:149233860-149233882 AGCTCAGTTAGAAGAAACCCAGG + Intergenic
1035093128 7:156330939-156330961 AAACCAGCCAGAAGAAGGCACGG + Intergenic
1035282413 7:157786252-157786274 AAACCAGCAAGACTAAAGCCAGG - Intronic
1036679589 8:10861417-10861439 ATCCCAGCAAGAAGAAAATCAGG + Intergenic
1037739518 8:21596379-21596401 AAGACAGCTAGTAGGAAGCCAGG + Intergenic
1040481093 8:47827782-47827804 CAGCCACCTAGAATAAAGCCAGG + Intronic
1042163439 8:65921588-65921610 CACCCATCAAGGAGAAAGCCAGG - Intergenic
1045418418 8:101990300-101990322 AACCCAGCTTTGAGGAAGCCAGG + Intronic
1046496822 8:115024850-115024872 AACCCAGAGAGAAGGAAACCAGG - Intergenic
1047200187 8:122758726-122758748 AACACAGATAGAGTAAAGCCCGG - Intergenic
1047630997 8:126708115-126708137 AACCATGCTAGAAGAAAGACTGG + Intergenic
1050595360 9:7199523-7199545 AACCCAGGTAAAAGAATGACTGG + Intergenic
1053563032 9:39215857-39215879 AGCCATCCTAGAAGAAAGCCGGG + Intronic
1054134115 9:61403198-61403220 AGCCATCCTAGAAGAAAGCCGGG - Intergenic
1056395837 9:86180369-86180391 AACCCAGCAAGCACAAAGGCTGG + Intergenic
1057686223 9:97237459-97237481 AGCCCACTAAGAAGAAAGCCTGG + Intergenic
1060459382 9:123835224-123835246 ATCCTAGCTAGATGAACGCCTGG + Intronic
1061264394 9:129496989-129497011 AACCCAGGAAGAAGAAAGGAAGG + Intergenic
1061527693 9:131180769-131180791 AACCAAACAAGAAGACAGCCGGG + Intronic
1187192151 X:17045284-17045306 AACCCAGTTAAAAAAAATCCCGG + Intronic
1188936467 X:36182273-36182295 AACCTAGCTGGAGGAAAGACTGG + Intergenic
1191769193 X:64737572-64737594 AACCCAGCTAGAATATAAACAGG - Intergenic
1195407812 X:104535873-104535895 AACATACCTAGAAGAAAGCATGG - Intergenic
1200836893 Y:7740775-7740797 AAACCAGCAGGAAGAAAACCAGG - Intergenic