ID: 1126560662

View in Genome Browser
Species Human (GRCh38)
Location 15:50040283-50040305
Sequence TAGCCACAGCTGCTACAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126560658_1126560662 22 Left 1126560658 15:50040238-50040260 CCCTGGCTTTCTTCTAGCTGGGT 0: 1
1: 0
2: 1
3: 20
4: 218
Right 1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG 0: 1
1: 0
2: 1
3: 9
4: 118
1126560656_1126560662 23 Left 1126560656 15:50040237-50040259 CCCCTGGCTTTCTTCTAGCTGGG 0: 1
1: 0
2: 3
3: 22
4: 409
Right 1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG 0: 1
1: 0
2: 1
3: 9
4: 118
1126560659_1126560662 21 Left 1126560659 15:50040239-50040261 CCTGGCTTTCTTCTAGCTGGGTT 0: 1
1: 0
2: 2
3: 10
4: 214
Right 1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG 0: 1
1: 0
2: 1
3: 9
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126560662 Original CRISPR TAGCCACAGCTGCTACAAAC AGG Intronic
901084596 1:6602879-6602901 TAGGCACCGCTGCTATAAATAGG + Intronic
902053395 1:13581617-13581639 TAACAGCAGCTGCTACATACTGG - Intergenic
902797441 1:18808672-18808694 TGCCCACAGCTGGTAGAAACAGG + Intergenic
906604883 1:47161525-47161547 CAGCCACAGCTCTTACCAACTGG + Intergenic
907196667 1:52692751-52692773 CAGTGATAGCTGCTACAAACTGG - Exonic
907639907 1:56177907-56177929 TATCCAGAGCTGCCCCAAACTGG - Intergenic
910631558 1:89360683-89360705 TAGCAACAGCAACAACAAACAGG - Intergenic
912412624 1:109489017-109489039 CAGCCACCGCTGCTACAACCTGG - Exonic
913227576 1:116713556-116713578 GAGCCACAGCTGCTGACAACAGG + Intergenic
917041259 1:170808652-170808674 AAGCCACTCCTGCTGCAAACTGG - Intergenic
918153109 1:181815647-181815669 GAGCCACAGTTCCTACAGACTGG + Intergenic
919207695 1:194437879-194437901 TTGCCACAGCTGCTACACCTTGG + Intergenic
920575736 1:207059076-207059098 TAAGCACACCTGCTACAACCAGG - Intronic
921893179 1:220372859-220372881 GAGCCACAGATGCTATCAACAGG - Intergenic
921919790 1:220654993-220655015 TAGCAATAGCTCCTACAAAAGGG - Intronic
922724689 1:227917418-227917440 TGGCCACAGCTCCTACTAAGAGG - Intergenic
924042156 1:239994402-239994424 TATTCACAGCTGCTCCAAATTGG - Intergenic
1064629127 10:17291503-17291525 TATCCAAAGCTGCTAAAAAGAGG - Intergenic
1069680584 10:70282604-70282626 TTGCCACAGCTGCCTCATACTGG + Intronic
1069991826 10:72321009-72321031 TAACCCCAGCCGGTACAAACAGG + Intergenic
1071049444 10:81428639-81428661 TATCCCCAGCTGCCACATACTGG - Intergenic
1074012271 10:109494550-109494572 TAACCACAGCAGCACCAAACGGG + Intergenic
1075414038 10:122249427-122249449 TGGCCCCAGCTGCCACCAACTGG - Intronic
1075702973 10:124481285-124481307 TAGTGACAGCTACTACAAAAAGG - Intronic
1081629343 11:44678082-44678104 AAGCCAATGCTGCTACCAACAGG + Intergenic
1085386314 11:76160244-76160266 TAGCCTCAGCTGCTCCAGACCGG - Intergenic
1086759379 11:90608379-90608401 TAGCAACAACTGCAACAAAAAGG - Intergenic
1089130704 11:116209741-116209763 AAGCCACAGCTGCTACAGGGAGG - Intergenic
1090409369 11:126497026-126497048 TAGCCAGAGCAGCTGCATACAGG + Intronic
1093920030 12:24849282-24849304 TGGCCACACCTGCTGCCAACTGG - Intronic
1096030695 12:48411459-48411481 GAGCCACAGCAGCTTCAAACTGG - Intergenic
1096913714 12:55009873-55009895 TGGCCACAGCTGGTACCCACAGG + Intergenic
1111169678 13:84509282-84509304 TAGCCACAATTGCCACAAAAAGG - Intergenic
1111386938 13:87539589-87539611 TAGCCATAGGGGCTACAAATGGG + Intergenic
1115510245 14:34131215-34131237 CAGCCACAGCAGCTACAAAGGGG - Intronic
1115695831 14:35897897-35897919 TAGCCACTGCTGCTGCCACCAGG - Intronic
1117622687 14:57603664-57603686 GAGCCACAGCTGTAACAATCTGG - Intronic
1125146060 15:36469982-36470004 CAGGCAGAGCTGCTACAAGCAGG + Intergenic
1126374679 15:47985291-47985313 TATCCACAGCTGCTGCAGCCAGG - Intergenic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1126864488 15:52922325-52922347 GAGCCACAGCAGATACAAAGAGG + Intergenic
1127659641 15:61088394-61088416 AAGCCACAGCTGCAAGAAACGGG + Intronic
1131640497 15:94287676-94287698 AAGCTACAGCTTCGACAAACAGG + Intronic
1136361837 16:29785626-29785648 CATGCACAGCCGCTACAAACGGG + Intergenic
1147608127 17:41785753-41785775 CAGCCACAGCTACTGGAAACTGG + Intronic
1147648688 17:42049970-42049992 TGGACAGAGCTGCTATAAACAGG + Intronic
1150102626 17:62437599-62437621 TGGCCAAAGCTGATTCAAACAGG - Intronic
1157914315 18:51649915-51649937 TAGCGTCAGCTGCTATAACCTGG - Intergenic
1158653643 18:59308984-59309006 TAGCCACAGCTGGTGATAACTGG + Intronic
1163976351 19:20856729-20856751 CATTCACAGCTGCTACAAAGAGG + Intronic
1166281579 19:41797713-41797735 TGGCTACAGCTGGTACAAAGGGG + Exonic
1166406775 19:42527254-42527276 TGGCTACAGCTGGTACAAAGGGG - Exonic
1166420383 19:42631951-42631973 TGGCCACAACTGGTACAAAGGGG - Intronic
1167810893 19:51829257-51829279 TAGCCACAGCCCCGACAAGCTGG + Intergenic
928312306 2:30221072-30221094 TGGCCACAGCTGCTACTCAGTGG + Intergenic
930284705 2:49413369-49413391 AAGCCCCACCTACTACAAACAGG - Intergenic
930408089 2:50987844-50987866 TTTCTGCAGCTGCTACAAACTGG - Intronic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
933083404 2:78023552-78023574 TAGCCACTGCTGCTGCCACCAGG - Intergenic
933346050 2:81086944-81086966 TACCCACAGGTGCTACTCACTGG + Intergenic
935563447 2:104582105-104582127 TAGAGACACCAGCTACAAACTGG + Intergenic
938983961 2:136554857-136554879 TAGCCAGGGCTGCAGCAAACAGG + Intergenic
941505250 2:166336163-166336185 TAGCCAAACCTGCTAGAAAGAGG + Intronic
941811063 2:169756576-169756598 GAGCCACAGCTGCTACAGCCTGG - Intronic
946812812 2:223544334-223544356 TAGTCACAATTGCTAAAAACTGG - Intergenic
1170678933 20:18507933-18507955 CACCCACAGCTGCAACAAGCAGG - Exonic
1173924558 20:46771190-46771212 TATCCAAAGCTGATAGAAACAGG + Intergenic
1174612301 20:51808174-51808196 TAACCACAGCTGCTTCAATTTGG + Intergenic
1175144433 20:56885055-56885077 TGTCCACAGCTGCTCCCAACTGG + Intergenic
1175389002 20:58614630-58614652 TAGCCTCACCTGCTAGAGACGGG - Intergenic
1178254790 21:31042193-31042215 TAGCCACGGCTGGTACAGGCTGG + Intergenic
1179138311 21:38699852-38699874 TAACCCCAGCTGATACAAGCAGG - Intergenic
1182265563 22:29112277-29112299 TGGCCACAGCTGCCTCACACTGG - Intronic
1182342377 22:29633849-29633871 TAGACACTGATGCTACAAAATGG - Intronic
1184970327 22:48015381-48015403 ACGCCACAGCAGCTACACACTGG - Intergenic
953126810 3:40098404-40098426 TACCCACAGCTGCTACCAAAGGG - Intronic
964602802 3:158520971-158520993 TAGTTACAGATACTACAAACTGG + Intronic
970102184 4:12537390-12537412 TAGACTCTGCTGATACAAACTGG - Intergenic
972221783 4:36964244-36964266 TTCCCACAGCTGGTACATACTGG - Intergenic
974793947 4:66724615-66724637 TATCCACGGCTGCTAAAAAGTGG + Intergenic
974966087 4:68761912-68761934 TAGCCACAGCTGGGACACAGGGG + Intergenic
974969575 4:68807485-68807507 TAGCCACAGCTGAGACAAAGGGG - Intergenic
975408414 4:74018883-74018905 TCGGCACTGCTGCCACAAACTGG + Intergenic
975640889 4:76499232-76499254 TAGCCACAGCAGCTAGGAAGTGG - Intronic
989127976 5:38075289-38075311 TGGCCACAGCTGCTGCCCACTGG - Intergenic
990303248 5:54470197-54470219 TAGCCACAGCTGCCACCGATGGG - Intergenic
990544663 5:56810877-56810899 TGGCCAAAGCTGCTATAAAGAGG - Intergenic
992208733 5:74456416-74456438 TAGCCACACCTGCTTCTAACAGG + Intergenic
998216369 5:140241048-140241070 TAGAAACAGCAGCTACAAAATGG - Intronic
998217238 5:140246465-140246487 TAGCCACTGCAGCTATAAAATGG + Intronic
998715241 5:144876118-144876140 TAGACACAGCTGCTAAAAGAAGG - Intergenic
999444308 5:151627096-151627118 CAGCTACAGCAGCTACACACAGG - Intergenic
1008463152 6:51799501-51799523 TATTCCCAGCTGCTTCAAACTGG + Intronic
1008566053 6:52769564-52769586 TAACCACTGATGCTACAAATAGG + Intergenic
1008570248 6:52809919-52809941 TAACCACTGATGCTACAAATAGG + Intergenic
1011366610 6:86589016-86589038 TAGCCTCAACTGCTACCTACAGG - Intergenic
1012135497 6:95551357-95551379 GAGCCACAGATGGGACAAACTGG + Intergenic
1013438722 6:110139422-110139444 TTGCAGCAGCTGCTACATACGGG + Intronic
1019471968 7:1225778-1225800 TAGCCACAGATCCTACAAACAGG + Intergenic
1022346239 7:29517176-29517198 TAGCCACAGCTCCAAAAGACAGG - Intergenic
1027573714 7:79905220-79905242 TAGACACAAATGCTACAAATGGG - Intergenic
1028189251 7:87825886-87825908 TAGATACAGCTGTTCCAAACTGG - Intronic
1031493934 7:122423356-122423378 TAGCCACAAGTTCTAAAAACTGG - Intronic
1031858973 7:126957320-126957342 CTGCCACAGCTGCTCCAGACAGG - Intronic
1032031830 7:128490788-128490810 TGGCCAAAGCTGATTCAAACAGG - Intronic
1033297127 7:140150156-140150178 TGGTCAAAGCTGCTAGAAACAGG - Intronic
1035957310 8:4095175-4095197 TAGCCACAGCGAACACAAACTGG + Intronic
1038630483 8:29238677-29238699 TAGCCACAGATGGCACAAATAGG - Intronic
1041239369 8:55836127-55836149 GAGCCACAGTTGTTTCAAACTGG - Intergenic
1042401955 8:68360070-68360092 AAGCCACAGCTGAAACAAAGAGG - Intronic
1043376153 8:79652032-79652054 CAGCCACAGCTGCTAAAGGCAGG - Intronic
1044609531 8:94078438-94078460 TAGCCAGAGCTGCATCAACCTGG + Intergenic
1046879373 8:119291245-119291267 TAGCCATAGCTTCTCCAAAGAGG + Intergenic
1047499806 8:125431965-125431987 GAGACACAGCTCCTAGAAACAGG + Intronic
1047990037 8:130276580-130276602 CAGCCACAGCTGAGACAATCTGG + Intronic
1049156907 8:141072875-141072897 GAGCCACAGCTGCTCCTCACAGG - Intergenic
1050762965 9:9096221-9096243 TAGCCACCGTTGCCACAAAATGG + Intronic
1053202686 9:36163493-36163515 CAGCCACAGCTGCCAGGAACAGG - Exonic
1055506912 9:76957360-76957382 TATCCACAGCAGCTCAAAACAGG + Intergenic
1055749384 9:79487907-79487929 TAGCCCGAGCTGCCATAAACAGG + Intergenic
1057375902 9:94522751-94522773 TAGACAAAGATGGTACAAACAGG - Intergenic
1058153501 9:101486837-101486859 TGGCCACAGCTGGCACAAGCAGG - Intronic
1058164949 9:101608699-101608721 GAGGCTCAGCTTCTACAAACTGG - Intronic
1061599458 9:131657634-131657656 CAGCCACAGCAGCCACAATCAGG - Intronic
1186505763 X:10090792-10090814 TACTCACACCAGCTACAAACTGG + Exonic
1191850413 X:65581954-65581976 TAGCCCCAGCTGCTCCAGGCAGG - Intergenic
1194936855 X:99960651-99960673 GTGCCACAGCCCCTACAAACAGG + Intergenic
1199545722 X:149005706-149005728 TAGCCAAAGCTGCTTCATCCGGG + Intergenic
1199578838 X:149341383-149341405 CAGACACAGCTGATACAAGCAGG - Intergenic