ID: 1126560707

View in Genome Browser
Species Human (GRCh38)
Location 15:50040665-50040687
Sequence AAGCTGAGCAGCTCACTCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126560701_1126560707 -3 Left 1126560701 15:50040645-50040667 CCAGTCAGCTCATCCCCCAAAAG 0: 1
1: 0
2: 0
3: 20
4: 280
Right 1126560707 15:50040665-50040687 AAGCTGAGCAGCTCACTCTCGGG 0: 1
1: 0
2: 0
3: 18
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126560707 Original CRISPR AAGCTGAGCAGCTCACTCTC GGG Intronic
900356077 1:2264756-2264778 AGGATGAGCAGATCTCTCTCTGG - Intronic
901306378 1:8236025-8236047 GAGCTGAGCAGCTCCCTTTAGGG - Intergenic
903129608 1:21270148-21270170 ATGGTGAGGGGCTCACTCTCTGG - Intronic
904019472 1:27451561-27451583 AATCTGATCATGTCACTCTCTGG - Intronic
904037842 1:27568420-27568442 GAGCAGAGCAGCTCGGTCTCAGG + Intronic
909463714 1:75948662-75948684 AAGCTAGGAAGGTCACTCTCTGG - Intergenic
912776541 1:112509288-112509310 AAGCTGCGCAGCTCCCGCTTCGG + Exonic
912884372 1:113454331-113454353 AGGCAGTGCAGCTTACTCTCTGG + Intronic
915698797 1:157771020-157771042 AAACTAATCAGCTAACTCTCTGG + Intronic
916489354 1:165287913-165287935 TGGCTGGGAAGCTCACTCTCAGG - Intronic
917695095 1:177514291-177514313 AAGCTCAGCATCTCATTCTCAGG + Intergenic
1063609586 10:7551735-7551757 AAGCTGAGCCGCCCAACCTCGGG + Intergenic
1066375447 10:34854152-34854174 AAGCTGAGAAGCCCAGCCTCGGG - Intergenic
1069314262 10:67078101-67078123 CAGCTTAACAGCTCTCTCTCAGG + Intronic
1072248657 10:93565032-93565054 AAGCTGAGCATCTACTTCTCAGG + Intergenic
1074516532 10:114174893-114174915 AAGGTCAGCAGTTCAGTCTCTGG + Intergenic
1074768182 10:116716028-116716050 CAGCTGAGCAGCTCCCACTCTGG + Intronic
1074893832 10:117757679-117757701 AAGCTGAGCAGCCCACACTTTGG - Intergenic
1075096870 10:119477736-119477758 AACCTGCCCAGCTCCCTCTCTGG - Intergenic
1077018655 11:407749-407771 GAGCTCAGCAGCGCACTCTCAGG + Intronic
1078338232 11:10480791-10480813 AAGCAGAGGAGATCACTTTCAGG + Intronic
1078341667 11:10501588-10501610 AAGGTAACCAGGTCACTCTCGGG + Exonic
1081833897 11:46137587-46137609 AAGCTGAGCAGAGGACTCCCAGG + Intergenic
1083307561 11:61769215-61769237 AAGCTCAGCTGCTCACCCCCCGG + Intronic
1089259806 11:117216407-117216429 GAGTTGAGCAGCTCAGTCCCAGG - Intronic
1091234136 11:134008457-134008479 AAGCAGAGCAGCTCACTGATGGG - Intergenic
1092761425 12:11814647-11814669 AAGCTCTGCAGCCCTCTCTCAGG + Intronic
1096459252 12:51813185-51813207 AAGATGTGCAGCTCCCCCTCGGG - Intergenic
1096572251 12:52530329-52530351 AGGCTTAGGTGCTCACTCTCTGG + Intergenic
1096802148 12:54117718-54117740 AAACTGATCAGCTCCCTCTGTGG + Intergenic
1099926946 12:89030197-89030219 AATCTGAGCAGCTCACTGCCTGG - Intergenic
1103352149 12:120291488-120291510 AAGTGGAGTAGCTCACTCGCTGG + Intergenic
1104483274 12:129127546-129127568 AATGTGAACAGCCCACTCTCTGG + Intronic
1106997832 13:35508301-35508323 AAACTGAGCACTTCCCTCTCTGG - Intronic
1109119834 13:58440791-58440813 AAGCTGAGTAGCTCATTCTAAGG - Intergenic
1112410540 13:99159307-99159329 AATCTGTGCATCTCTCTCTCTGG - Intergenic
1113192520 13:107766184-107766206 AAGCTTAGCAGGTCTCTCTGAGG + Intronic
1114631300 14:24161130-24161152 CATCTGAGCATCTCACTATCAGG - Exonic
1117323901 14:54650982-54651004 AAACTGAGCACCTCACTTTCTGG + Intronic
1117463654 14:55971404-55971426 TAGCTCTGCAGCTCACCCTCTGG - Intergenic
1117885986 14:60363670-60363692 AAGTTGGGCAGGTCTCTCTCAGG - Intergenic
1118687577 14:68306514-68306536 AAGCTGAACAGCTCTCTCAGAGG + Intronic
1119190585 14:72679470-72679492 CAGCTGAGCAGCTCCATTTCTGG + Intronic
1120393645 14:83940467-83940489 AAGCTGATCAGCTCCCTCACTGG - Intergenic
1121185271 14:91962111-91962133 AGGCTAAGCAGCTCACTCAATGG + Intergenic
1121507611 14:94488709-94488731 AAGGTGAGCACCTGACTGTCTGG - Intronic
1122042787 14:99001156-99001178 AATCTAATCAGCTCACTCCCAGG + Intergenic
1126560707 15:50040665-50040687 AAGCTGAGCAGCTCACTCTCGGG + Intronic
1127699627 15:61485577-61485599 AGGTTGAGAAGCTCACTCTGAGG + Intergenic
1128301429 15:66568430-66568452 AAGGTGAGCAGATCACTGTCAGG + Intergenic
1128768847 15:70267006-70267028 AAGCTGAGCTGCCCACAATCAGG - Intergenic
1131440304 15:92454714-92454736 AACCTGAGCAGCTCACCCAGGGG + Intronic
1132203179 15:99969076-99969098 AGGTTGTGCAGCTCACTCTTGGG + Intergenic
1138137193 16:54533282-54533304 CAGCTGAGCAGCTCCCACTGTGG - Intergenic
1138181145 16:54940774-54940796 ACTCTGAGCAGGTCACTCCCTGG - Intergenic
1144090691 17:11853460-11853482 AGGCAGAGCAGCTGACTCACAGG + Intronic
1145058706 17:19719131-19719153 CGGATCAGCAGCTCACTCTCAGG + Intergenic
1147978989 17:44263186-44263208 AAGATGGGCAGGTCACCCTCAGG + Intronic
1149263871 17:54906835-54906857 AAGCTACACAGCTCACTCTCAGG - Intronic
1149343828 17:55714513-55714535 AAGCTGAGCAACACAGTCTCAGG - Intergenic
1152210586 17:79001068-79001090 CAGCTGAGCAGCTCGATCTTTGG - Intronic
1154013990 18:10600311-10600333 AAGCAGATAAGCTCACTCTTAGG - Intergenic
1154131324 18:11739071-11739093 AGGCTGCGCAGGGCACTCTCTGG - Intronic
1157492453 18:48133850-48133872 AAACTGAACAGCTCTCTCCCTGG + Intronic
1158441603 18:57479714-57479736 AAGATGAGCACCCCACTGTCAGG - Exonic
1161047296 19:2142543-2142565 AACCTCAGCAGCTGATTCTCAGG + Intronic
1161665336 19:5572690-5572712 AGGCTGGGCTGGTCACTCTCCGG + Intergenic
1162194025 19:8969997-8970019 CAGCTGTCCAGCTCACTCACTGG - Intronic
1164804323 19:31104518-31104540 GAGCCGAGGAGCTCACTCTAAGG - Intergenic
1164906579 19:31973109-31973131 CAGCTAGGCAGCTCAATCTCAGG + Intergenic
1165461317 19:35945759-35945781 AGGCTGAGGAGCTCAGACTCTGG + Exonic
928091736 2:28378711-28378733 AGGCTGAGCAGCTCAGGCACCGG - Intergenic
928119617 2:28574015-28574037 AAGCTGACCTGCCCACTCTTGGG - Intronic
933387899 2:81634624-81634646 AGGCAGAGGAGCTCACTCTATGG - Intergenic
934984600 2:98875151-98875173 AAGTTAAGCACCTCACTGTCAGG + Intronic
935321433 2:101893262-101893284 AAGCTGAGAAGCTTACTTTTTGG + Intronic
937049721 2:118878649-118878671 AAGCTGAGTATCCCTCTCTCTGG + Intergenic
939883516 2:147656549-147656571 AAGCTGAGCCAACCACTCTCTGG + Intergenic
941880459 2:170475712-170475734 AAGATGATCATGTCACTCTCAGG + Intronic
947880233 2:233502544-233502566 CAGCTGTGCAGCGCTCTCTCTGG - Intronic
948186916 2:236028294-236028316 AACCTGAGCAGGCCACCCTCAGG + Intronic
948346228 2:237300989-237301011 AAGTAGATCAGCTCACACTCAGG + Intergenic
948457784 2:238114898-238114920 GGGCTGAGCTGCTTACTCTCTGG + Intronic
1168858753 20:1029590-1029612 ATGCTGGGCAGCTCATTCTTGGG - Intergenic
1170328749 20:15184636-15184658 AAGCTGTGAAGGCCACTCTCAGG - Intronic
1170706565 20:18749306-18749328 ATGCTGAGCAGCACTCTCACAGG - Intronic
1171853886 20:30327518-30327540 AAACTGATCAGCTCCCTCTGTGG + Intergenic
1172648179 20:36484474-36484496 CAACTGAGCAGGTCCCTCTCAGG + Intronic
1173263252 20:41455290-41455312 AAACTTAGCAGATCACTCTCAGG - Intronic
1175713699 20:61241220-61241242 AAGCTATGCAGCTCACACTGGGG - Intergenic
1176520057 21:7817707-7817729 AGGCAGAGCAGCTCCATCTCTGG + Exonic
1177731823 21:25037067-25037089 AAGCAGAGGGTCTCACTCTCAGG + Intergenic
1178654084 21:34447719-34447741 AGGCAGAGCAGCTCCATCTCTGG + Intergenic
1179481727 21:41682700-41682722 ATGCTGTGCGGGTCACTCTCTGG - Intergenic
1180031031 21:45208158-45208180 CAGCTGAGGAGCTCACACTCAGG - Intronic
1181395583 22:22618855-22618877 AAGCTGAGGAGCTGATCCTCAGG - Intergenic
1182222203 22:28767711-28767733 AGGCTGAGCAGGACACTCGCTGG - Intergenic
1182972413 22:34590565-34590587 AAGCTGATGGGCTCCCTCTCTGG - Intergenic
1183083274 22:35470922-35470944 AAGCTGAAAAGCACACACTCAGG - Intergenic
1183976584 22:41515779-41515801 AAGCTGACGGGCTCTCTCTCCGG + Exonic
1184465572 22:44667537-44667559 AGGCAGAGCTGCTCACTCCCAGG + Intergenic
1185009890 22:48306997-48307019 CCGCTGTGCAGCTCACCCTCTGG + Intergenic
950888031 3:16377819-16377841 AAGCAGCCCAGCTCACCCTCCGG - Exonic
952429003 3:33203720-33203742 AAGCTCAGCAGCAAACTGTCCGG - Intronic
953966465 3:47310951-47310973 AAGCTGACCAGGCCACTCTGTGG - Intronic
959976785 3:112469964-112469986 ACACTGACCAGCTCTCTCTCTGG + Intronic
962853753 3:139326771-139326793 AAGCTGAGCAGCTCCCCCAAGGG + Intronic
964890956 3:161533742-161533764 GACCTGATCAGCTCACTCTTGGG - Intergenic
965683302 3:171274343-171274365 AAACTGAGCCACTCTCTCTCAGG + Intronic
970385972 4:15556876-15556898 AAGCTGACCAGCTGCCTCTGAGG + Intronic
971603712 4:28630458-28630480 AAGCTGACCAGTTCACTGTAAGG - Intergenic
971877701 4:32326345-32326367 AAGCTGGGCAGCCCCCACTCGGG + Intergenic
972533240 4:39978314-39978336 AGCGTGAGCGGCTCACTCTCGGG + Intergenic
972836332 4:42875051-42875073 AAGCTGAGCAGGCCACTTTTTGG + Intergenic
973226654 4:47792659-47792681 AAGCTGAGCATTGCATTCTCTGG + Intronic
974158799 4:58109924-58109946 TAGCTGAGCAGCTTGGTCTCAGG - Intergenic
974980704 4:68953967-68953989 GAGCTGAGGAGCTCAGTCTCTGG - Intergenic
975493297 4:75011925-75011947 CAGCTGAGGAGCTCACTGACTGG - Intronic
977744834 4:100534679-100534701 AAGCTAAGCAGGTCAGTGTCAGG + Intronic
984702669 4:182828185-182828207 AGGCTGGGCAGCTCCTTCTCAGG + Intergenic
984948250 4:184986715-184986737 AAGGTGGGCATCTCACTATCAGG + Intergenic
986150160 5:5120820-5120842 AAGCTGAGTAGCTGCCTATCTGG - Intergenic
987810991 5:22835987-22836009 TAGCTCAGCTGCTCTCTCTCTGG - Intronic
988086750 5:26484037-26484059 ACGCTGAGCAGCTGACTCCAGGG + Intergenic
989179606 5:38563367-38563389 TAGCTGTGCAGGTGACTCTCAGG + Intronic
990948918 5:61277281-61277303 CAGCACAGCAGCTCACTCTCTGG + Intergenic
991502657 5:67292463-67292485 ACACTGAGAAGGTCACTCTCAGG - Intergenic
991609053 5:68431896-68431918 GAGCTCAGTAGCTCACTCTCAGG + Intergenic
992186772 5:74251877-74251899 GAGCAGAGCAGCTCAGGCTCCGG + Intergenic
997463629 5:134072067-134072089 TAGCTGAGCAGCTCGCCCTAGGG + Intergenic
997796386 5:136815575-136815597 AAGCGGAAAAGCTGACTCTCAGG - Intergenic
999204742 5:149840001-149840023 AAGCAGAGGCACTCACTCTCGGG - Intronic
1001664344 5:173420343-173420365 AAGCTGAGCAGCCCTCGCTCAGG + Intergenic
1002305150 5:178278755-178278777 AAATTCAGCAGCTCACTCCCAGG - Intronic
1002596016 5:180323815-180323837 ATGCTGTGCAGCCCTCTCTCAGG - Intronic
1005137120 6:22582210-22582232 CAGCTGAGTTGCTCACTATCAGG - Intergenic
1008751390 6:54737415-54737437 AAGCTAGGCAGCTGCCTCTCTGG - Intergenic
1012253543 6:97007315-97007337 AAGCTGAAAAGCTCACTTTAAGG - Intronic
1014746193 6:125203690-125203712 GGGCTGAGCAGCTCACTCTTTGG + Intronic
1017760205 6:157562621-157562643 CACCTGAGCAGCTCATTCGCAGG + Intronic
1017809808 6:157976761-157976783 AATCTGCACAGCTCACTCTGTGG - Intergenic
1018395911 6:163377911-163377933 AAGCTGAGCACCTCCTTCCCTGG + Intergenic
1018936130 6:168275128-168275150 AAGCTGTGCAGCTCAGGCCCAGG - Intergenic
1021986276 7:26101196-26101218 AAGCTAAACAGCTCGATCTCAGG + Intergenic
1027869559 7:83689671-83689693 AAGCTGAGAAGCAAACTATCAGG - Intergenic
1032744099 7:134768484-134768506 AAGCTGAGGACCTCACAGTCAGG + Intronic
1032907474 7:136387073-136387095 AAGCACAGCAGCTGCCTCTCAGG + Intergenic
1033109441 7:138561555-138561577 AAGCTGACCAACTGACTCTAGGG - Intronic
1036332046 8:7837241-7837263 AAGCTGAGCAGCATTCTCTATGG + Intronic
1037039156 8:14209317-14209339 AAGCAGAACAGCTCTCTCCCTGG - Intronic
1042125405 8:65533368-65533390 GAGCAGAGCTGCTGACTCTCAGG - Intergenic
1042201230 8:66281009-66281031 AAGCTGGGCTGCTCACTCAGCGG + Intergenic
1043883587 8:85573109-85573131 AGGGTGATCTGCTCACTCTCTGG + Intergenic
1047222811 8:122932133-122932155 AAGCTGAGCTGCTCTTTCTTGGG - Intronic
1053791688 9:41690811-41690833 AAACTGATCAGCTCCCTCTGTGG + Intergenic
1054153470 9:61623959-61623981 AAACTGATCAGCTCCCTCTGTGG - Intergenic
1054180089 9:61902826-61902848 AAACTGATCAGCTCCCTCTGTGG + Intergenic
1054473264 9:65555160-65555182 AAACTGATCAGCTCCCTCTGTGG - Intergenic
1054657502 9:67678315-67678337 AAACTGATCAGCTCCCTCTGTGG - Intergenic
1055607257 9:77983659-77983681 TGGCTGAGCAGCTCATTTTCTGG + Intronic
1059885304 9:118738814-118738836 AACCTGAGAACCTGACTCTCTGG + Intergenic
1061392938 9:130327780-130327802 ATGGCGAGCAGCTCACTCCCTGG - Intronic
1191271493 X:58477978-58478000 AAGGGGAGCAGCACACTCTGGGG - Intergenic
1192220134 X:69192118-69192140 AAGCTGAGGAGACCAGTCTCAGG + Intergenic
1195973405 X:110498577-110498599 AAGCTGAGAAAATCACTCTATGG + Intergenic
1201474056 Y:14361926-14361948 AATGTGAGCAGCACACACTCAGG - Intergenic