ID: 1126568566

View in Genome Browser
Species Human (GRCh38)
Location 15:50126129-50126151
Sequence GTGTGGGTGTGGAGGTGTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 958
Summary {0: 1, 1: 0, 2: 4, 3: 80, 4: 873}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126568555_1126568566 27 Left 1126568555 15:50126079-50126101 CCTTGTCCAAACAGGCTTCGGAA 0: 1
1: 0
2: 0
3: 4
4: 98
Right 1126568566 15:50126129-50126151 GTGTGGGTGTGGAGGTGTCACGG 0: 1
1: 0
2: 4
3: 80
4: 873
1126568554_1126568566 28 Left 1126568554 15:50126078-50126100 CCCTTGTCCAAACAGGCTTCGGA 0: 1
1: 0
2: 1
3: 2
4: 63
Right 1126568566 15:50126129-50126151 GTGTGGGTGTGGAGGTGTCACGG 0: 1
1: 0
2: 4
3: 80
4: 873
1126568556_1126568566 21 Left 1126568556 15:50126085-50126107 CCAAACAGGCTTCGGAACTACAG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1126568566 15:50126129-50126151 GTGTGGGTGTGGAGGTGTCACGG 0: 1
1: 0
2: 4
3: 80
4: 873

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126568566 Original CRISPR GTGTGGGTGTGGAGGTGTCA CGG Intronic
900000958 1:14667-14689 GTCTGGGGGGGAAGGTGTCATGG + Intergenic
900020672 1:185188-185210 GTCTGGGGGGGAAGGTGTCATGG + Intergenic
900053448 1:611298-611320 GTGGGGGTGTGGGTGTGACAGGG + Intergenic
900372978 1:2340446-2340468 GTGTGGGTGGAGGGGTGTCATGG - Intronic
900551387 1:3257941-3257963 CTGTGGGTGGGGAGCTGTCCTGG + Intronic
900715849 1:4143088-4143110 GTGTGTGTCTGGTGTTGTCACGG + Intergenic
900864237 1:5255843-5255865 GTGTGGCTGTGGAGGAGTGGTGG + Intergenic
901003926 1:6162599-6162621 ATGTGGTCGTGGTGGTGTCAGGG - Intronic
901343676 1:8518994-8519016 GTGTGGGTGTGACAGTGTCATGG - Intronic
901625447 1:10622117-10622139 GTGAGGGTGTGGAGGGGTGGAGG - Intronic
901874335 1:12158372-12158394 GAGTGGGTTTGGAGGGGTTACGG + Intergenic
902218531 1:14950071-14950093 GGGTGGGTGTGGAGGGTGCAGGG - Intronic
902258695 1:15207593-15207615 CAGTGGGTGTGGAGGAGTCGGGG - Intronic
902272522 1:15314812-15314834 GTGGGGGTGTGGATGTGTGTAGG + Intronic
902511927 1:16971401-16971423 GTGTGTGTGTGCATGTGTGACGG - Intronic
902515620 1:16987983-16988005 GTGTGGTTGGAGAGGTGGCAAGG - Intronic
902627024 1:17682803-17682825 GTGTGGGGTTGGTGGGGTCAGGG - Intronic
902635428 1:17731978-17732000 GTGTGTGTGTGTAAGTGACAGGG - Intergenic
902785171 1:18728454-18728476 GTATGAGTATGGATGTGTCATGG + Intronic
903778914 1:25809566-25809588 GTGTGGGGGTGGAGGTGGATGGG - Intronic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
903940528 1:26927287-26927309 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
904043096 1:27595319-27595341 GTGTGTCTGGGGAGGTGTCAGGG + Intronic
904043205 1:27595898-27595920 GTGTGTGTGTGGAAGTGTGTGGG + Intronic
904301344 1:29556725-29556747 GAGTAGGGGTGGAGGTGCCAGGG + Intergenic
904339964 1:29828260-29828282 GAGTGGGGGTGGAGGTTCCAGGG + Intergenic
904567046 1:31434399-31434421 GTGTGGGTGTGGCGGGGGGATGG - Exonic
904593004 1:31625660-31625682 GAGTGGGAGTGGGGGTGGCAGGG - Intronic
905285901 1:36880239-36880261 GTGTGAGTGTGCAAGTGTGAGGG + Intronic
905347199 1:37319212-37319234 GTGTGCGTGTGTATGTGTCTGGG + Intergenic
905392888 1:37649392-37649414 GTGTGTGTGTGCAGCTGTCCTGG - Intergenic
905892580 1:41526566-41526588 GTGTGGGGGTGTATGTGTGAGGG - Intronic
905892598 1:41526636-41526658 GTGTGAGTGTGGGGGTGTGAGGG - Intronic
905892853 1:41528081-41528103 GTGTGAGTGTGAAGGTGTGAGGG - Intronic
905894747 1:41538238-41538260 GTGTGGGTGGGGAGGTCTGGAGG + Intronic
906109449 1:43313146-43313168 GCCTGGGCGTGGAGGTGTCGGGG - Exonic
906273171 1:44497334-44497356 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
906509272 1:46401561-46401583 CTGTGGGTGTGGGGATGGCATGG + Intronic
906581260 1:46936827-46936849 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
906640653 1:47438815-47438837 GTGTGGGTGCGGCGGCGGCAGGG - Exonic
906642689 1:47450774-47450796 GAGAGGGTGTGGGGGTGGCAAGG - Intergenic
906974497 1:50555242-50555264 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
907199551 1:52714705-52714727 GTGTGTGTGTGTATGTGTGAGGG - Intergenic
907658584 1:56370629-56370651 GTGAGGGTGGGGTGGAGTCAGGG - Intergenic
907849936 1:58246868-58246890 GTGTAGGTGTGTGGGTGTGAGGG + Intronic
908066951 1:60416269-60416291 GTGTGTGTGTGTATGTGTTAGGG - Intergenic
908807037 1:67942534-67942556 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
909590948 1:77348740-77348762 GTGTGGGTGTGTGGGTGTGTGGG - Intronic
910621432 1:89259828-89259850 GTGTGTGTGCGGGGGTGTCGGGG - Intronic
910873019 1:91852285-91852307 GTGTGTGTGTGGAGGTGGGGTGG - Intronic
911063721 1:93769391-93769413 GTGTGTGTGTGTGTGTGTCAAGG + Intronic
911261695 1:95693989-95694011 GTGTGTGTGTGGCGGGGTGAGGG + Intergenic
911412837 1:97532013-97532035 GTGTGTGTGTGCAGTTTTCAGGG + Intronic
911797783 1:102095897-102095919 GTGTGTGTGTGTGTGTGTCATGG + Intergenic
912380171 1:109243234-109243256 GTGTGGGGGTGGAGGAGTTAGGG - Intergenic
912449228 1:109759173-109759195 GTGTGTGTGTGGTGGGGTGATGG + Intronic
912496403 1:110094819-110094841 GTGGGGATGTGGAGGAGTCCTGG + Intergenic
912771767 1:112470776-112470798 GTGTGGGTGTGGGGGAGGAAGGG + Intronic
912812150 1:112802604-112802626 GGGTAGGGATGGAGGTGTCAGGG + Intergenic
915088732 1:153406525-153406547 TTCTGGGTGTGCAGGTGTCAGGG - Intergenic
915096166 1:153464310-153464332 TTCTGAGTGTGCAGGTGTCAGGG + Intergenic
915319405 1:155047957-155047979 GTGTGTGTGTGCAGGTGTGTAGG - Intronic
915446435 1:155977328-155977350 GTCTGGGTGTGGAAAGGTCAGGG + Intronic
915598345 1:156907829-156907851 CTGTGGTTATGGGGGTGTCAAGG + Intronic
915648057 1:157287935-157287957 GTGAGGGAGTGGAGGTGTCTGGG + Intergenic
915726650 1:158022858-158022880 GTGCGGGTGTGCAGGTGTGTGGG - Intronic
915923246 1:159994653-159994675 GTGTGTGTGTGTATGTGGCAGGG - Intergenic
916058696 1:161084827-161084849 GTGTGGGTTTGGGGGGGTGAGGG + Intronic
916559967 1:165926200-165926222 GTGTGTATGTGCATGTGTCAGGG + Intergenic
916628446 1:166585417-166585439 GTGTGTGTGTGTGTGTGTCAAGG - Intergenic
916990128 1:170234353-170234375 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
917693156 1:177489883-177489905 GTGTGTGTGTGGGGGGGGCAGGG - Intergenic
917956213 1:180101669-180101691 ATGTGTGTGTGGAGGGGGCAGGG - Intronic
917966830 1:180184102-180184124 GCGTGGGTGTGAAGGTGTGGTGG - Intronic
918080968 1:181207358-181207380 CTGTGGGTTTGAAGGTGTCTTGG + Intergenic
918102108 1:181385468-181385490 GTTGGGGAGTGGAGGTGACAGGG + Intergenic
918793378 1:188859486-188859508 GTGTGTGTGTGTATGTGTTATGG + Intergenic
919287535 1:195583414-195583436 GTGTGTGTGTGTGTGTGTCAAGG + Intergenic
919403984 1:197152793-197152815 GTGTGTGTGTGGAGGGGTGGGGG + Intergenic
919647321 1:200108098-200108120 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
921046824 1:211483693-211483715 GTGCAGGGGTGGGGGTGTCATGG + Intronic
921099132 1:211913027-211913049 GTGTGGGGGAACAGGTGTCACGG - Intergenic
921187569 1:212683468-212683490 GTGTGGCTGTGTGGGTGTGAAGG + Intergenic
922030638 1:221794241-221794263 GTGTGTGTGTGTATGTGTAAAGG - Intergenic
922227112 1:223655018-223655040 GTGTGGGTGTGTGGGTGTGTGGG + Intronic
923563083 1:235056348-235056370 TTGTGGGGGTGGTGGTTTCATGG + Intergenic
923783237 1:237043385-237043407 GTGTGTGTGTGTAAGTGTAAGGG + Intronic
1063194656 10:3730129-3730151 GTGTGGCAGAGGAGGTGGCAGGG + Intergenic
1063295412 10:4800252-4800274 GGGTGGGTGGGGAGATGTTAAGG + Intronic
1063589015 10:7378198-7378220 GTGTATGTGTGGATGTGTGATGG + Intronic
1063663000 10:8046675-8046697 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1063853844 10:10224343-10224365 GTGTGTGTGTGTACGTGTCTAGG + Intergenic
1063898628 10:10708835-10708857 GTGTGTGTTTGGAGGGGTCAAGG - Intergenic
1063984496 10:11487805-11487827 GTGTGTGTGTGGAAGAGTGAGGG - Intronic
1064630912 10:17309653-17309675 GTGTGGGTGTGAATGTGTCCTGG + Intergenic
1064853107 10:19732847-19732869 GTGTGAGTGTGGTGGTGTAATGG + Intronic
1064876554 10:20001467-20001489 GTGTGCGTGTGGAGGGGGCAAGG + Intronic
1066301469 10:34101272-34101294 GTGTGGGGCAGGATGTGTCATGG - Intergenic
1066308974 10:34176953-34176975 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1066471674 10:35703862-35703884 GTGTGTGTGTGCAAGTGTGATGG - Intergenic
1066550542 10:36551931-36551953 GTGTGGGTGTGGGTGTGTACAGG - Intergenic
1068076428 10:52261480-52261502 GTGTGTGTGTGTAGGTGTTGGGG + Intronic
1068629432 10:59284553-59284575 GTGAGGGTGTGTATGTGGCAGGG - Intronic
1068780463 10:60914188-60914210 TTTTGGGTGTGGAGGGGGCAGGG + Intronic
1068819728 10:61360348-61360370 GTGTGTGTGTGGTGGAGGCAGGG - Intergenic
1069155414 10:65023634-65023656 GTGTTGGTGTGGCTGTTTCAGGG + Intergenic
1069319167 10:67146089-67146111 GTGTGTGTGTGGAGGGGTGCTGG - Intronic
1069695419 10:70382265-70382287 GAGTGGGTGCAGAGGTGCCAGGG - Intronic
1069736469 10:70658446-70658468 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
1069950410 10:72014728-72014750 GGGTGGGTGGGGAGGTGTCCAGG - Intergenic
1070002631 10:72392188-72392210 GTGTGTGTGTGGCGGGGTCGGGG + Intronic
1070161317 10:73868309-73868331 GTGTGGGGATGGAGGTGGGAAGG - Intronic
1070198917 10:74184527-74184549 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1070680745 10:78447489-78447511 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1070776798 10:79114531-79114553 GTGTGTGTGTGAAGGTGGGAGGG + Intronic
1071009622 10:80922798-80922820 GTGTGTGGGTGGAGGGGTAAGGG + Intergenic
1072639518 10:97201178-97201200 GTGTGTGTGTGTATGTGTAAAGG - Intronic
1072856426 10:98952342-98952364 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1073207365 10:101776155-101776177 GGGTGGGTGGGGAGGTGGGAGGG + Intronic
1073666161 10:105535999-105536021 GAGTGGTTGTGGAGGAGTCCTGG + Intergenic
1073771142 10:106737065-106737087 GTGTGTATGTGTAGGTGTCAGGG + Intronic
1073932698 10:108594442-108594464 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
1074130942 10:110574681-110574703 GTGTGTGTGTGGAGGTGGTGGGG - Intronic
1074465524 10:113678634-113678656 GTGTGTGTGTTGTGGGGTCAGGG + Intergenic
1074465542 10:113678768-113678790 GTGTGTGTGTTGTGGGGTCAGGG + Intergenic
1074465548 10:113678808-113678830 GTGTGTGTGTTGTGGGGTCAGGG + Intergenic
1074713034 10:116193254-116193276 GAGTGGGTGTGGAGGTGGCAGGG - Intronic
1074856293 10:117476520-117476542 GTGTGGGTGTGTGGGTGGAAGGG + Intergenic
1074869173 10:117563704-117563726 GTGTGTGTATGGATGTGTCTGGG + Intergenic
1075438198 10:122460505-122460527 GGGTGGGGGTGGAGGTTTGAGGG + Intergenic
1075889183 10:125930858-125930880 GTAAGGGTGTGGAGGGGGCAAGG - Intronic
1076547965 10:131258457-131258479 GGGTGGGTGTGGTGCTGCCAGGG - Intronic
1076653565 10:132006306-132006328 GGGTGGGTGTGGGGGTGGGAGGG + Intergenic
1076749412 10:132535201-132535223 GTGTGGGTGTGCACGTGTGGCGG + Intergenic
1076777034 10:132703647-132703669 GTGTGTGTGTGGGGGTGTGCGGG - Intronic
1077094667 11:794244-794266 GTGGGGGTGGGGAGCTGCCACGG + Intronic
1077123525 11:922099-922121 TTGTGGGTGTGGATGTGTTGGGG + Intergenic
1077314930 11:1915048-1915070 GTGTGTGTGTGTATGTGTTATGG + Intergenic
1077419528 11:2444115-2444137 GTGTGGGTGGGGAGCCGGCAGGG - Intergenic
1077489574 11:2854511-2854533 GTGTGTGTGTAGCGGTGTCGGGG - Intergenic
1077870165 11:6255548-6255570 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1077870862 11:6260225-6260247 CTGTGGGGGTGAAGGTGTGAGGG - Intronic
1078123464 11:8534584-8534606 GTGTGTGTGTGTGTGTGTCAAGG + Intronic
1078142872 11:8704263-8704285 ATGTGGGTGGGGAGAGGTCAGGG + Intronic
1078609748 11:12809923-12809945 GAGTGGGTGAGGAGGTGTGGAGG + Intronic
1078748589 11:14138841-14138863 GTTTGGGTGTGGAGAGATCAAGG - Intronic
1079330360 11:19527933-19527955 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1079698130 11:23509603-23509625 GGGTGTGTTTGGAGGTGACAGGG - Intergenic
1080275561 11:30499654-30499676 ATGTGTGTGTGTATGTGTCAAGG - Intronic
1080352264 11:31399068-31399090 TTGGGGGAGTGGAGGTGTCTGGG + Intronic
1080786104 11:35476537-35476559 GTGTGGCTGGGGAGGTCTCAGGG - Intronic
1081489135 11:43553838-43553860 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1081628945 11:44674404-44674426 GTGTGTGAGTGGGGGTGTGAGGG + Intergenic
1082027422 11:47583052-47583074 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1083746078 11:64737103-64737125 GAGGGGGTGAGGAGGAGTCAGGG + Intronic
1084122415 11:67077451-67077473 GTGGGTGTGGGGAGGTGTCCTGG - Intergenic
1084219403 11:67668021-67668043 GTCTGGGTGTAGGGGTGGCAAGG - Intronic
1084421374 11:69062376-69062398 GTGTGAGTGTGGGGGTGTGGAGG + Intronic
1084451406 11:69241016-69241038 GTGTGTGTGTGGTGGGGGCAGGG + Intergenic
1084473384 11:69375818-69375840 GAGTGGGTGTGGTGGTCCCAGGG + Intergenic
1085294644 11:75424187-75424209 GTGTGTGTGTTGAGGGGTGAGGG - Intronic
1085493822 11:76948253-76948275 GTGTGTGTGTGTAGGTGTGTAGG + Intronic
1085519257 11:77128529-77128551 GTTTGGATGTGGAGGAGTCATGG + Intronic
1085666432 11:78418464-78418486 GTGTGGGGGAGGAGGGGTCCCGG + Intergenic
1086497228 11:87416941-87416963 GTGTGTGTGTGGAGGGGCTAAGG + Intergenic
1088588365 11:111379520-111379542 GTGTGGGTGTGAAGGTGGTGTGG + Exonic
1088986108 11:114909972-114909994 GTGTTGGTGGGGTGGTGGCAGGG - Intergenic
1089059767 11:115617041-115617063 GGGTGGCTGTGGAGGAGGCAGGG - Intergenic
1089069221 11:115686598-115686620 GTGTGTGTGTGTGTGTGTCATGG + Intergenic
1089152157 11:116372648-116372670 GTGTGGCTGTGGACAAGTCAGGG - Intergenic
1089581704 11:119485420-119485442 GTGTGGGTGTGCGGGTGTGCAGG - Intergenic
1090083438 11:123630143-123630165 GTCTGGGTGTGTGGGTGTCTGGG + Exonic
1090262451 11:125331319-125331341 GGGTGGGTGGGGAGGTGTCCAGG - Intronic
1091054195 11:132403041-132403063 GTGTGTGTGTGTGTGTGTCAAGG - Intergenic
1091114735 11:133002694-133002716 GTGTGGGTGTGAATGTGTATAGG + Intronic
1091374047 12:14782-14804 GTCTGGGGGGGAAGGTGTCATGG + Intergenic
1092206555 12:6617990-6618012 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
1092840792 12:12539458-12539480 GTTTAGGTGTAGATGTGTCAAGG + Intronic
1094472239 12:30814053-30814075 GTGTGTGTGTGGGGGTGTGGGGG + Intergenic
1094489839 12:30952914-30952936 GTGTGGGTGTGCAGGTGCCCAGG + Intronic
1094842902 12:34349388-34349410 GGGTGGGTGTGGAGGGGACAAGG + Intergenic
1095470676 12:42533844-42533866 GTGTGGGAGGGGAGTTGTGAGGG - Intronic
1095942906 12:47738096-47738118 GCGGGGGTGGGGAGGGGTCATGG + Intronic
1095976263 12:47942766-47942788 GTGTGGGTGAGCAGGTGTATGGG - Intronic
1096189540 12:49606482-49606504 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1096267501 12:50135333-50135355 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1096358884 12:50966503-50966525 CTGAGGGTGTGGAGGTGGGAAGG - Intronic
1096442829 12:51660170-51660192 GAGTGGGGGTGGAGATGTAAAGG + Intronic
1096490241 12:52009067-52009089 GTGTGGATGTGGAGCTGGGAAGG + Intronic
1097272261 12:57783284-57783306 GTGTGTGTGTGGAGGGGTGCAGG + Intronic
1098611701 12:72466800-72466822 GGGTGGGTGTGGTGTGGTCAAGG - Intronic
1098921161 12:76303442-76303464 GCTTGGGTGTGGAGGTGTTGTGG - Intergenic
1099324419 12:81196074-81196096 GTGTGGGTATGCAAGTGTCACGG - Intronic
1099460126 12:82911205-82911227 GTTTGGGTGTGGGGGGGCCAGGG + Intronic
1099668024 12:85655726-85655748 GTGTGTGTGTGTATGTGTGATGG + Intergenic
1100076578 12:90792194-90792216 GTGGGGGTGTGAAGGTTGCAGGG + Intergenic
1100418625 12:94406481-94406503 GTGTGTGTGTGGTGGGGGCAGGG + Intronic
1100988913 12:100231305-100231327 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1101477383 12:105063664-105063686 GGGTGGGTGGGGAGGTGTTGGGG + Intronic
1101553452 12:105784946-105784968 GTGTGTGTGTGTGTGTGTCATGG + Intergenic
1101819636 12:108173838-108173860 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1102350793 12:112190731-112190753 GGGTGGGGGTGGAGCTGGCATGG - Intronic
1102579716 12:113878628-113878650 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1103260814 12:119586834-119586856 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1103279376 12:119742862-119742884 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1103553150 12:121750701-121750723 GTGTGGGTGGGGTGTTGGCATGG - Intronic
1103993286 12:124813437-124813459 GTGTTGGTGTGGTGGCTTCATGG - Intronic
1104470291 12:129024781-129024803 GTGTAAGTGTGGAGGTGTGGGGG - Intergenic
1104779272 12:131409435-131409457 GTGTGGGAGTGGAGCTGTAAGGG + Intergenic
1104921512 12:132293039-132293061 GTGTGGGAGTGGCGGGGCCAGGG + Intronic
1105603288 13:21906620-21906642 GTGTGTGTGTGTGTGTGTCATGG + Intergenic
1105635532 13:22212121-22212143 GTGTCTGTGTGGAGGTGTCAGGG + Intergenic
1105805909 13:23951500-23951522 GTTTGGGTGTGGGGGTGTCCTGG - Intergenic
1105978389 13:25493969-25493991 GTTTGTGTGTGTGGGTGTCAAGG + Intronic
1106194095 13:27478510-27478532 GTGTGTTTGTGGGTGTGTCAGGG - Intergenic
1106626622 13:31427264-31427286 GTGTGGGTGTGGGTGTGTGTTGG - Intergenic
1106839895 13:33675639-33675661 GTGAGGGTTTGGAGATCTCAGGG + Intergenic
1107834946 13:44405527-44405549 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
1108623512 13:52206136-52206158 GTGTGGGTGTTGATGTCTCAGGG + Intergenic
1108676172 13:52739455-52739477 GTATGAGTGTGCAGGGGTCACGG - Intronic
1110033092 13:70643093-70643115 GTGTGTGTGTCGGGGTGGCAGGG - Intergenic
1111433869 13:88180830-88180852 CTGAGGGTGTGGGGGTGTGATGG - Intergenic
1111981899 13:95025311-95025333 GTGTGGGTGTGGGTGTGTGTGGG - Intronic
1111981936 13:95025435-95025457 GGGTGTGTGTGTGGGTGTCAGGG - Intronic
1112876187 13:104042233-104042255 GTGTGTGTGTGGTGTTATCATGG + Intergenic
1113333192 13:109352033-109352055 GTGTGTGTGTGGAGGTGAGAGGG + Intergenic
1113407408 13:110054418-110054440 GGGTGTGTGAGGAGGTGGCAAGG - Intergenic
1113821379 13:113215957-113215979 GTGTGGCTGTGGAGGTCTTTGGG + Intronic
1113943769 13:114032737-114032759 GTGTCAGTGTGGGGGTGCCATGG - Intronic
1114493397 14:23117244-23117266 GTGTGTGTGTGTGTGTGTCATGG - Intergenic
1114560783 14:23589042-23589064 CTGTGGGGGTGGAGGTGGGAGGG + Intergenic
1114992613 14:28306335-28306357 GTGTGTGTGTGCATGTGTGAAGG + Intergenic
1115274625 14:31593552-31593574 GTATGGGGGCGGAGGTGTCCTGG + Intronic
1117831136 14:59752070-59752092 GTGTGGATGTGGAGGTTGGAAGG - Intronic
1118177973 14:63461837-63461859 GTGTGTGTGTGTATGTGTGAGGG - Intronic
1118327419 14:64791122-64791144 GGGTGGGTGTGTATGTGTGATGG - Intronic
1119788211 14:77328113-77328135 GTGTGGGGGCGGGGGTGTCAAGG + Intronic
1119850200 14:77861400-77861422 GGGTGCGTGTGGGGGTGTGAGGG + Intronic
1120784828 14:88523712-88523734 GTGTGTGTGTGTGTGTGTCACGG - Intronic
1121044216 14:90776136-90776158 GTGTGTGTGTGTGTGTGTCACGG - Intronic
1121279470 14:92688579-92688601 GGGTGGGTGTGGGGGACTCATGG - Exonic
1122114346 14:99520387-99520409 GAGTGGGGGTTGAGGGGTCAAGG - Intronic
1122429283 14:101629769-101629791 GTGTGGGTGTGGCTGGCTCAAGG - Intergenic
1122606033 14:102948192-102948214 GGGTGGGCGTGGAGGTGACAGGG + Intronic
1122606047 14:102948222-102948244 GGGTGGGTGTGGAGGTGGAGGGG + Intronic
1122606074 14:102948287-102948309 GGGTGGGTGTGGAGGTGAGACGG + Intronic
1122606166 14:102948499-102948521 TGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122606239 14:102948677-102948699 GGGTGGGTGTGGAGGTGAGGGGG + Intronic
1122606250 14:102948707-102948729 GGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122721854 14:103726681-103726703 GGGTGCGTGGGGAGGTGGCAGGG + Intronic
1122888593 14:104722604-104722626 CAGTGGGTCTGGGGGTGTCAAGG - Intergenic
1122898117 14:104770459-104770481 GTGGGTGGGTGGAGGTGGCAGGG - Intronic
1122916907 14:104863709-104863731 GTGTGGGTGGGTAGGTGGCAGGG - Intergenic
1123054517 14:105562687-105562709 GTGTGTGTGTGAGGGTGTAAGGG + Intergenic
1123054532 14:105562780-105562802 GTGTGGGTGTGTGTGTGTGAGGG + Intergenic
1123054552 14:105562898-105562920 GAGTGGGTGTGTCGGTGTGAGGG + Intergenic
1123054578 14:105563040-105563062 GAGTGGGTGTGTCGGTGTGAGGG + Intergenic
1123054757 14:105564039-105564061 GGGTGTGTGTGGATGTGTGAAGG + Intergenic
1123054793 14:105564211-105564233 GTGAGGGTGTGGGGATGTGAGGG + Intergenic
1123054808 14:105564302-105564324 GTGTGAGTGTGAGGGTGTGAGGG + Intergenic
1123079135 14:105683297-105683319 GTGAGAGTGTGGGGGTGTGAGGG + Intergenic
1123079190 14:105683570-105683592 GGGTGTGTGTGGATGTGTGAAGG + Intergenic
1123079227 14:105683755-105683777 GTGAGGGTGTGGGGATGTGAGGG + Intergenic
1123079280 14:105683966-105683988 GTGAGGGTGTGGGGATGTGAGGG + Intergenic
1123112592 14:105880224-105880246 GTGTGTGTGTGCAGGTGTGGGGG + Intergenic
1123449419 15:20350703-20350725 GTGTGTGTGTGTGTGTGTCAAGG + Intergenic
1124250916 15:28106230-28106252 GTGTGTGTGTGCATGTGTCGGGG + Intergenic
1124345400 15:28918608-28918630 GTGTGGGTGTGGTGGGGTTGGGG + Intronic
1124514436 15:30354624-30354646 GGGTGGGTATGGAGCTGCCATGG - Intergenic
1124667399 15:31605182-31605204 GTGTGGGTGTGCAGGGGGAATGG + Intronic
1124728484 15:32176141-32176163 GGGTGGGTATGGAGCTGCCATGG + Intergenic
1125476023 15:40048578-40048600 GCAGGGGCGTGGAGGTGTCAAGG + Intergenic
1126568566 15:50126129-50126151 GTGTGGGTGTGGAGGTGTCACGG + Intronic
1126723383 15:51606208-51606230 GTGGGGGTGTGGATGTGAGATGG + Intronic
1126968401 15:54082950-54082972 CTCCGGGTGTGGAGGTCTCAGGG + Intronic
1127354727 15:58187448-58187470 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1127482299 15:59388919-59388941 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1128328190 15:66738727-66738749 GTGTGGGAGTGGCTGTGTCGGGG + Intronic
1128566082 15:68701043-68701065 GTGGGGGTGTGCAGGAGGCAGGG - Intronic
1128632681 15:69281975-69281997 CTGTGGGTGTGGGGTTATCAGGG - Intergenic
1129689463 15:77705170-77705192 GTGTGTGTGTGTGTGTGTCATGG - Intronic
1129697718 15:77750059-77750081 GGGTGGGTGAGGGGGAGTCATGG - Intronic
1130158016 15:81370058-81370080 GATTGGGTGTGGAGGTAGCAGGG + Intronic
1130520642 15:84658351-84658373 GTGTGGGTGTGCAGGTCTCTGGG - Exonic
1131015991 15:89058291-89058313 GTGTGGGTGTGGAGGAAGCTTGG - Intergenic
1131078226 15:89512601-89512623 TTGTGGATTTGGAAGTGTCAGGG + Intergenic
1131107721 15:89746061-89746083 GTGTATGTGTGGAGGTGTGGAGG - Intergenic
1131229019 15:90646997-90647019 GAGTGGGTGTGGAGGAGTTGGGG - Intergenic
1131300841 15:91198501-91198523 GTGTGTGTTTGGAGGTCTCCTGG + Intronic
1132072848 15:98794929-98794951 CTGGGGTTGGGGAGGTGTCAAGG - Intronic
1132166838 15:99601841-99601863 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1132301490 15:100779023-100779045 GTGGGGGTGGGGAGGAGGCAGGG - Intergenic
1132422746 15:101687521-101687543 GTGTGGGTGTGTGTGTGGCAGGG + Intronic
1132452552 15:101976273-101976295 GTCTGGGGGGGAAGGTGTCATGG - Intergenic
1132454348 16:14352-14374 GTCTGGGGGGGAAGGTGTCATGG + Exonic
1132522407 16:397662-397684 GTGGGGGTGTGGGGGGGTGAGGG + Intronic
1132522428 16:397700-397722 GTGGGGGTGTGGGGGGGTGAGGG + Intronic
1132556105 16:573348-573370 GGGTGGCTGTGGGGATGTCAGGG + Intronic
1132573944 16:656279-656301 CTGTGGGTGGGGTGGGGTCAGGG - Intronic
1132667125 16:1086636-1086658 TTGTGTGTGTGGAGGGGTGAGGG + Intergenic
1132738073 16:1397296-1397318 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738157 16:1397557-1397579 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738186 16:1397644-1397666 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738215 16:1397731-1397753 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738244 16:1397818-1397840 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132763189 16:1520932-1520954 GGGTGGGTATGGAGGGGACAAGG + Intronic
1132767424 16:1541564-1541586 GCGTGGGGGTGGAGGTGGGAAGG - Intronic
1133394887 16:5438933-5438955 GTGTGGATGGGGAGGTGGTAAGG + Intergenic
1133753460 16:8743336-8743358 GTGTGTGTGTGTGTGTGTCACGG + Intronic
1134076872 16:11298007-11298029 GTTTGTGTCTGGAGGTTTCAGGG - Intronic
1134598880 16:15517853-15517875 GTGTGTGTGTGGATGTGTGTGGG + Intronic
1135608481 16:23843950-23843972 GTGTGTGTGTGCATGTGTGATGG - Intronic
1135925553 16:26690512-26690534 GGGTGGCTTTGGAGGAGTCATGG + Intergenic
1136340822 16:29642017-29642039 GTGTGGGCCTGGAGGTTGCATGG - Intergenic
1136417439 16:30112625-30112647 GGGTGGGGGTTGGGGTGTCAGGG + Intronic
1136719643 16:32310102-32310124 GAGTGGGTGTGGGTGTGTGAGGG - Intergenic
1136838017 16:33516382-33516404 GAGTGGGTGTGGGTGTGTGAGGG - Intergenic
1137273093 16:46915916-46915938 GTGTGTGTGTGTAGGTGTGGTGG - Intronic
1137671838 16:50283795-50283817 GTGTGGGTGAGGGAGTGACAGGG + Intronic
1138044124 16:53703626-53703648 CTGAGGATGTGGAGGTGTCTTGG + Intronic
1138053883 16:53812188-53812210 CTCTGGTTGTAGAGGTGTCAGGG - Intronic
1138338389 16:56270415-56270437 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1138525967 16:57607384-57607406 GTGTGGGGGTGGGGGTGTATAGG + Intergenic
1139543130 16:67633777-67633799 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1140105398 16:71955270-71955292 GTGTGTGTGTGGAGGTGCAGTGG + Intronic
1140249902 16:73286884-73286906 GTGTGGCTGTGTAGGTGTGTGGG + Intergenic
1140954643 16:79850790-79850812 GTGTAGGTGTGTAGGTGTGTAGG - Intergenic
1140954644 16:79850798-79850820 GTGTGTGTGTGTAGGTGTGTAGG - Intergenic
1141858853 16:86703178-86703200 GTGTGGGTGTGTGGGTGTGGGGG - Intergenic
1141858869 16:86703228-86703250 GTGTGGGTGTGTGGGTGTGTGGG - Intergenic
1141858896 16:86703335-86703357 GTGTGGGTGTGTGGGTGTGTGGG - Intergenic
1142226066 16:88878156-88878178 GTGGGGCTGTGGAGGCCTCACGG - Intronic
1142289266 16:89185345-89185367 GTGCGGGTGTGGAGCTGCCGGGG - Intronic
1142435889 16:90057056-90057078 GTGTGAGTGTGGGGGTTTCAAGG - Intronic
1203006788 16_KI270728v1_random:207667-207689 GAGTGGGTGTGGGTGTGTGAGGG + Intergenic
1143022942 17:3926058-3926080 GTGTGGCTGAGCAGTTGTCAGGG - Intronic
1143033338 17:3980430-3980452 GGGTGGGTGTGATGGAGTCATGG + Intergenic
1143216294 17:5227656-5227678 GTGTGGGGGTTGAGGTGGGAGGG + Intronic
1143497621 17:7321506-7321528 GGTTGGGAGTGGAGGTGGCAGGG - Intronic
1143513402 17:7407800-7407822 GTGGGAGTGGGGAGGTGTCAGGG + Intronic
1143589799 17:7875821-7875843 CTGTGGTTGTGCAGGTTTCAGGG - Intronic
1143685773 17:8514516-8514538 GTGGGGCTGAGGAGGTGACAGGG - Intronic
1143745588 17:8991835-8991857 GTGAGGGTTTGGAGGTGGCTGGG - Intergenic
1143824570 17:9594033-9594055 GTGTAGTTGAGGAGATGTCAGGG + Intronic
1143914025 17:10275703-10275725 GTGGAGGTGTGGATGTGACAGGG + Intergenic
1144827412 17:18113793-18113815 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1145264244 17:21371920-21371942 GTGTGGGTGTGACTGTGTCCTGG + Intergenic
1145302226 17:21648717-21648739 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1145348087 17:22054599-22054621 GTGTGGGAGTGCATGTTTCAGGG - Intergenic
1145415493 17:22710787-22710809 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1145796537 17:27658781-27658803 GTGGGGGTGTGGTGATGTCCAGG + Intergenic
1146921462 17:36715420-36715442 TTCTGTGTGTGGAGGTGGCAAGG + Intergenic
1147055848 17:37834308-37834330 GTGTGGATGTGGATGTGTGTGGG - Intergenic
1147147624 17:38494555-38494577 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1147568716 17:41553607-41553629 GTGTGGGTGCAGAGGGGTCCTGG - Intergenic
1147669400 17:42168079-42168101 GCCTGGGTGGGGAGGAGTCAAGG - Intronic
1147683089 17:42266651-42266673 GTGTGGAGGTGGAGGTGGGAGGG + Intronic
1148253344 17:46105902-46105924 GTGTGTGTGTGTGTGTGTCAAGG - Intronic
1149625949 17:58081359-58081381 GTGTGTGTGTGTGTGTGTCAAGG - Intergenic
1149667622 17:58376789-58376811 GTGTGGCTGTGGAGGGCTCATGG + Intronic
1149960468 17:61104205-61104227 CTGTGGGTGGGGAGGTGGAATGG - Intronic
1150001408 17:61443162-61443184 GGCTGGGTGTGGAGGTGCCCTGG - Intergenic
1150308290 17:64105456-64105478 CTGTTGGAGTGGAGGTGTGATGG - Intronic
1150411269 17:64943389-64943411 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
1150563743 17:66319119-66319141 GGGTGGGGGTGGAGGGGACAGGG - Intronic
1151013699 17:70530972-70530994 GGGTGGGGGTGGAGGTGTGGAGG + Intergenic
1151314152 17:73311632-73311654 GTGTGGAGGAGGAGGTGGCAGGG - Intronic
1151318085 17:73336286-73336308 GGGTGGGGGCGGAGGTGGCAGGG + Exonic
1151369730 17:73640258-73640280 GTGTGTGTGTGGGGGGGTCGAGG + Intronic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1151822194 17:76502325-76502347 GGGTGGGGGTGGGGTTGTCAGGG + Intergenic
1152022162 17:77785772-77785794 GGGTGCGTGTGGGGGTGTCAAGG + Intergenic
1152512413 17:80799364-80799386 GTGTGGATGTGCAGATGTCAGGG + Intronic
1152575459 17:81138581-81138603 GTGTGGGTGTGCACGTGTGTGGG - Intronic
1153036754 18:770794-770816 GTGTGTTTGTGGAGGTGTGGGGG + Intronic
1153168024 18:2284155-2284177 GTGTGTGTGTGGAAATATCAGGG - Intergenic
1153317212 18:3735979-3736001 GTGTGTGTGTGCATGTGGCATGG - Intronic
1153376631 18:4387920-4387942 GTGTGTGTGTGTATGTGTGATGG - Intronic
1153763743 18:8355546-8355568 ATTTGGGTGTGGAAGTGACAAGG + Intronic
1153925381 18:9831181-9831203 GTGTGGGTGTGGACATGTTATGG + Intronic
1155116567 18:22774122-22774144 GTGTGGGTGTGTGGGTGTGTGGG + Intergenic
1155501026 18:26487051-26487073 GTGGGGGTGTGAAGGAATCAGGG - Intronic
1155706992 18:28828323-28828345 GTGTGGGTGAGCAGATGGCAAGG - Intergenic
1155838818 18:30622560-30622582 GTGTGTGTGTGTAGGGGGCAGGG + Intergenic
1156463657 18:37335503-37335525 GTGTGTGTGTGGAGGTGTGGGGG + Intronic
1156596407 18:38552746-38552768 GTGTGTGTGTGTATGTCTCAGGG + Intergenic
1156627819 18:38931017-38931039 GTGTGTGTGTGGAGGTGGGGAGG + Intergenic
1156628509 18:38939458-38939480 GTGTGTGTGTGTATGTGACAGGG + Intergenic
1156640236 18:39086272-39086294 TTGTGGGTGTGGAGGTGTGAAGG + Intergenic
1157105941 18:44774393-44774415 GTGTGAGTGTGGGGGTGTGTGGG + Intronic
1157110059 18:44812193-44812215 GTGGGGGTGTGCATGTGCCATGG - Intronic
1157116915 18:44870656-44870678 GTGTAGGTGTGGAGGTGGGTGGG - Intronic
1157142457 18:45123393-45123415 GTGTGTGTGTGGCGGGGGCAGGG + Intergenic
1157347221 18:46850364-46850386 GTGTGTGTTTGGAGATGGCAGGG - Intronic
1157446701 18:47751624-47751646 GTGTGGATGAGGAGGGGACAAGG + Intergenic
1158435184 18:57430407-57430429 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1158631470 18:59118821-59118843 TTGAGGGTGTGGGGGTGGCAGGG - Intergenic
1159688929 18:71460714-71460736 GTGTGTGTGTGGAGGTGGGGTGG + Intergenic
1159771847 18:72555448-72555470 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1159827918 18:73237817-73237839 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1160795125 19:941791-941813 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1160796771 19:949262-949284 GTGTGGAGGGGGAGGTGCCAAGG + Intronic
1160970107 19:1764256-1764278 GTGGGGGCATGGGGGTGTCAGGG - Intronic
1161032668 19:2065440-2065462 GTGTGGGTGTCGGGGAGTGACGG + Intergenic
1161118668 19:2513122-2513144 GGGTGTGTGTGCAGGTGTCGGGG - Exonic
1161125922 19:2557000-2557022 GTGTGTGTGTAGAGGTGGGAGGG - Intronic
1161261458 19:3340098-3340120 GGGTGTTGGTGGAGGTGTCAGGG + Intergenic
1161347162 19:3774193-3774215 GTGTGGGTATGGAGGTGCAAGGG + Intergenic
1161394137 19:4035749-4035771 GTGTGGGTGTGTGTGTGTGATGG - Intronic
1161397796 19:4054019-4054041 GTGTGGGTGCGGATGTGTCGCGG + Exonic
1161493508 19:4575418-4575440 GAATGGGGGTGGAGGTCTCAGGG + Intergenic
1161683407 19:5691691-5691713 GGGTGGGTGTGGGTGTGTCGGGG + Intronic
1161738229 19:6004704-6004726 GTGTGTGTGTGTTTGTGTCAAGG - Intronic
1161921420 19:7269021-7269043 GTGTGGGTGTGTGGGTGTGTTGG - Intronic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162149099 19:8632258-8632280 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1162257003 19:9498720-9498742 GCGTGGGTGCGGAGGTATCAAGG + Intergenic
1162385709 19:10359393-10359415 ATGTGGCTGGGGAGGTGTCAGGG + Intronic
1162590503 19:11588213-11588235 GCATGGGTGTGAAGGTGTCCTGG + Intronic
1162777965 19:12991002-12991024 GGGTGGGTGTGTGTGTGTCAGGG - Intergenic
1163463886 19:17455231-17455253 GTGGGGGGGTGGGGGTGCCAGGG - Intronic
1163490872 19:17616551-17616573 GAGTGTGTGTGGAGGGGGCAGGG + Intronic
1163509021 19:17724459-17724481 GCGTGGGTCTGGAGGTGGGAAGG + Intronic
1163829392 19:19540576-19540598 GTGTGGGTGTGGGCGTGGCTGGG + Intronic
1163895651 19:20056605-20056627 GTGTGGGTGTGTGGGTGTGTGGG - Intergenic
1164620900 19:29695523-29695545 GTCTGGGTGTCCAGGTGTCTGGG - Intergenic
1164621000 19:29696020-29696042 GTCTGGGTGTCCAGATGTCAGGG - Intergenic
1164621143 19:29696747-29696769 GTCTGGGTGTCCAGGTGTCTGGG + Intergenic
1164621156 19:29696818-29696840 GTCTGGGTGTCCAGGTGTCCAGG + Intergenic
1164621324 19:29697524-29697546 GTTTGGGTGTCCAGGTGTCCAGG - Intergenic
1164832594 19:31333972-31333994 GTGTGGGTGGGGAGGGAGCAAGG - Intronic
1164972124 19:32541600-32541622 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
1165656136 19:37533829-37533851 GTTGGGGTGGGGAGGTGTGAAGG + Intronic
1165705338 19:37972189-37972211 GTGTGTGTGTGTGTGTGTCATGG + Intronic
1166103876 19:40588200-40588222 ATGAGGGTATGGAGGTGACAAGG + Intronic
1166379673 19:42349416-42349438 GGGTGGGTTTGGAGGTATCAGGG + Intronic
1167043680 19:47037943-47037965 GGGTGGGGCTGGAGCTGTCATGG - Intronic
1167684812 19:50949772-50949794 AAGTGGGGGTGGGGGTGTCATGG - Intronic
1167768929 19:51501734-51501756 GTGTCGGGTTGGAGGTGCCAGGG + Exonic
1167780707 19:51597111-51597133 GAGTGTGTGTGGAGGAGGCAAGG + Intergenic
1168712467 19:58509775-58509797 GTGTCGGCGTGGGGCTGTCAAGG - Intronic
924958082 2:10032-10054 GTGTGGGTGTGGGTGTGTGTGGG - Intergenic
925059194 2:878165-878187 GTGTGTGTGTGTAGGGGTGAGGG - Intergenic
925059207 2:878211-878233 GTGTGTGTGTGTAGGGGTGAGGG - Intergenic
925267146 2:2574220-2574242 GTGGGGTTGTGGTGATGTCATGG + Intergenic
925280826 2:2683270-2683292 GTGTGTGTGTGGTGGTGACGGGG + Intergenic
925451846 2:3975834-3975856 GTGTGGGTGTGTGTGTGTAAGGG - Intergenic
926317414 2:11721292-11721314 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
926367887 2:12150265-12150287 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
927349702 2:22094659-22094681 CTGTGGGTGTGCAGCTGACATGG + Intergenic
927668655 2:25050434-25050456 GTGTGGGGGTGCAGGGGTAAGGG + Intronic
928199229 2:29236584-29236606 GTGGGGGTGGGGAGCGGTCAAGG + Intronic
929056337 2:37880113-37880135 GTGTGGGAGTAGAGGTGAGAAGG - Intergenic
929356330 2:41029146-41029168 GTGTGTGTGTGGAGGGGGCTGGG + Intergenic
929450375 2:42032965-42032987 GTGTGTGTGTGTATGTGTGACGG - Intergenic
929778255 2:44941906-44941928 GTGTGTGTGTGGATGTGTGTGGG + Exonic
930376509 2:50573950-50573972 ATGTGGATGAGGAGGGGTCATGG + Intronic
930683275 2:54280363-54280385 GTGTGGGTGGGAAGGGGGCATGG + Intronic
931545744 2:63384486-63384508 GTGTGTGTGTGTATGTGTAAAGG - Intronic
931733762 2:65176356-65176378 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
931937449 2:67214596-67214618 GTGTGGGTGTGTATGTGTCGGGG - Intergenic
932300675 2:70664739-70664761 GTGTGTGTGTGGGTGTGTGAGGG + Intronic
932336197 2:70932740-70932762 GGGTGGGGGAGGGGGTGTCAAGG - Intronic
932674450 2:73766442-73766464 GTCTGGGTGTGGAAATGTCGAGG + Exonic
932842886 2:75100072-75100094 GTGTGGGGGTGTGGGTGGCATGG - Intronic
933658720 2:84909326-84909348 GTGTGGTGGTGGAGGTGTGATGG - Intergenic
933658774 2:84909605-84909627 GTGTGGTGGTTGAGGTGTGATGG - Intergenic
933689467 2:85168491-85168513 GTGGGGGTGTCGGGGAGTCATGG + Intronic
933840174 2:86280081-86280103 GCGTGGGTGTGGGTGTGTTAAGG + Intronic
934033621 2:88069435-88069457 GTGTGTATGTGTATGTGTCAGGG + Intronic
934527709 2:95061939-95061961 GTGTGGATGTGGAGGCCCCACGG - Intergenic
934988234 2:98902481-98902503 GCCTGAGTGTGGGGGTGTCAGGG + Intronic
935169019 2:100595931-100595953 GTGTGTGTGTGGGTGTGTCTGGG - Intergenic
935527532 2:104189513-104189535 GTGTGGGTGTGGAGGTTGTTGGG - Intergenic
935702497 2:105824681-105824703 GTGTGGGTGTTGTGCTTTCATGG + Intronic
936075703 2:109400609-109400631 GTGTGGGTGTGTATGTGGAAGGG - Intronic
936093004 2:109512816-109512838 GAGGGGGTGAGGAGGGGTCAGGG - Intergenic
936384716 2:112019011-112019033 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
936568764 2:113598747-113598769 GTCTGGGGGGGAAGGTGTCATGG - Intergenic
936610413 2:113996942-113996964 GTGTGTCTGAGGTGGTGTCAGGG + Intergenic
936777098 2:115986750-115986772 GTGTGGGTGTGGTGGGGGAAAGG + Intergenic
937870684 2:126783885-126783907 GTGTGTGTGTGCACTTGTCAGGG - Intergenic
937887704 2:126911407-126911429 GTGAGGGTGTGGTGGGGTGAGGG - Intergenic
938209407 2:129454596-129454618 GTGTGGGTGTGGCTGTATAAGGG + Intergenic
938939422 2:136156212-136156234 GTGTGTGTGTGTATGTGTGAAGG + Intergenic
939849949 2:147292459-147292481 TTTGGGGTGTGGAGGTGGCAGGG - Intergenic
939934506 2:148274206-148274228 TTGTGTGTGTGGTGGTGTCGGGG - Intronic
940034190 2:149296042-149296064 GGGTAGCTGTGGAGGTGGCAGGG + Intergenic
940797853 2:158099496-158099518 GTGTGTGTGTGCATGTGTAAGGG + Intronic
941424707 2:165327989-165328011 GAGTGTGTGTAGATGTGTCAAGG + Intronic
942346696 2:175010427-175010449 GTGTGTGTGTGTGGGTGTGAAGG + Intergenic
942432274 2:175925144-175925166 GTGTGGATGTGCGTGTGTCAGGG - Exonic
942859680 2:180594793-180594815 GTGTGGATGTGGGGGTGTGCAGG - Intergenic
943401011 2:187410867-187410889 GTGTGTGTGTGTTGGTGTCGGGG + Intronic
943706916 2:191045536-191045558 GTGGGGGGTTGGAGGTGGCAGGG + Intronic
944221396 2:197308148-197308170 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
944277136 2:197851845-197851867 GTTTGGGTGAGGTGGAGTCAGGG - Intronic
944303251 2:198149100-198149122 TTCTGGGAGTGGAGGTGGCAAGG + Intronic
944315405 2:198280312-198280334 GTGTGGGTGTGGGTGTGTGTGGG - Intronic
945500787 2:210571899-210571921 GTGTGTGTGTGTATGTGTAATGG + Intronic
945712122 2:213310307-213310329 GTGTGTGTGTTGTGGTTTCAGGG - Intronic
946046931 2:216829149-216829171 GTGTGTGTGTGTGGGTGTCTTGG + Intergenic
946307085 2:218862126-218862148 GAGTGGGGGAGGAGGTGACACGG + Intronic
946414980 2:219535451-219535473 GTGTGGGTGTGTATGTGTGTGGG + Intronic
946976614 2:225160039-225160061 GTGTGTGTGTGGAGGGGTGGGGG - Intergenic
947201524 2:227618606-227618628 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
947353996 2:229273257-229273279 TTGTAGGTGTGGAGGTGTGCAGG - Intergenic
947487916 2:230569494-230569516 GTGAGTGTGTGGAGGTGTTCTGG + Intergenic
948163569 2:235844284-235844306 GAGTGGGTTTGGAGGGGGCAAGG + Intronic
948238478 2:236408571-236408593 ATGTGGGTGTGGCAGTGACATGG + Intronic
948501073 2:238395037-238395059 GAGTGGGTGGGGGGGTGTCCAGG + Intronic
948692187 2:239713137-239713159 GTGTGTGTGTGAATGTGTCTGGG + Intergenic
948767201 2:240228768-240228790 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
948867019 2:240780759-240780781 GTGTGTGTGTGGAGCTGTGTGGG - Intronic
949042521 2:241855857-241855879 GTGTGTGTGTGGAGGTGGGAAGG + Intronic
949050929 2:241896803-241896825 GTGTGGGTGTGTGGGTGTGGGGG + Intronic
1169076686 20:2764313-2764335 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1169135020 20:3191968-3191990 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1169194458 20:3675692-3675714 GAGTGGGTGTGGAGAAGGCAGGG - Intronic
1169293593 20:4373618-4373640 GTGTGTGTGTGGAGGTGTATGGG + Intergenic
1169913053 20:10662731-10662753 GGGTGTGTGTGGGGGTGGCAGGG - Intronic
1170797351 20:19560471-19560493 GTGTGGGTAGGAAGCTGTCATGG + Intronic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1171122930 20:22581708-22581730 GTGTTGGGGTGGGGGTGTTATGG + Exonic
1171346076 20:24467789-24467811 GTGTGTGTGTGTGTGTGTCATGG + Intergenic
1171518810 20:25760145-25760167 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1172215085 20:33230034-33230056 GTGTGTGTGTGGTGGGGTGAGGG - Intergenic
1172444459 20:34985748-34985770 GTGTGTCTGTGTAGGGGTCAGGG - Intronic
1172890305 20:38259803-38259825 GTGTGGTGGTGGTGGTGGCAGGG - Intronic
1173089368 20:39955632-39955654 GGCTGGGTCTGGAGGTGTGAAGG - Intergenic
1173094962 20:40017081-40017103 GTGTGGGTGTGGATGTGGGTGGG + Intergenic
1173095855 20:40027548-40027570 GTGTGGGTGTGTGGGTGTGTGGG + Intergenic
1173149309 20:40551913-40551935 GTGTGTGTGTGTACATGTCAAGG + Intergenic
1173223346 20:41146797-41146819 GTGTAGGTGTGGATGTGTGGTGG + Intronic
1173431103 20:42987723-42987745 ATTTTGGTGTGGGGGTGTCAGGG - Intronic
1173727204 20:45306515-45306537 TTGTGTGTGTGGAGGGGTCTGGG - Intronic
1173945843 20:46950394-46950416 CTGTGAGTTTGGAGGTCTCATGG + Intronic
1174343671 20:49914491-49914513 GTGTGGGTGGGGAGGTGGAGGGG - Intronic
1174367429 20:50065018-50065040 GTGTGTGTGTGGGGGTGTGTAGG - Intergenic
1174459112 20:50670354-50670376 GGGTGGGGGTGGGGGTGTCTGGG - Intronic
1174785619 20:53429827-53429849 GTGTGTGTGTCAGGGTGTCAGGG + Intronic
1174799499 20:53551382-53551404 GTGTGTGTGTGTGTGTGTCATGG + Intergenic
1175010514 20:55729830-55729852 TTGTGGGTGAGGAGGAGACAAGG + Intergenic
1175172551 20:57090739-57090761 GTGTGGTGGTGGAGGTGTGTGGG - Intergenic
1175172573 20:57090856-57090878 GTGTGTGGGTGGAGGTGTGTGGG - Intergenic
1175844639 20:62051996-62052018 TTGTGGTTGTGGAGGTGACATGG - Intronic
1175844826 20:62052792-62052814 GTGGGGGTGGGGTGGTGTGAGGG - Intronic
1176023820 20:62975898-62975920 GTGTGGGTGTGGAGCTGGTGTGG - Intergenic
1176023871 20:62976068-62976090 GTGTGGGTGTGGAGCTGGTGTGG - Intergenic
1176176900 20:63732346-63732368 GTGTGTGTGTGCATGTGTCAGGG + Intronic
1176652958 21:9566552-9566574 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1179127924 21:38608641-38608663 CTGAGGGTTTGGAGGTGTCTGGG + Intronic
1179451030 21:41468608-41468630 TAGTGCGTGTGGAGGTCTCAGGG - Intronic
1179680594 21:43018465-43018487 GTGTGTGTGTGTGGGTGGCAGGG - Intronic
1179959792 21:44761839-44761861 GTGTGGGTGAGCAGGTGTGGGGG + Intergenic
1180081592 21:45489997-45490019 GTGTGGGGGAGGAGGTGTGGGGG - Intronic
1180155580 21:45975621-45975643 GTGTGGGTGGGGAAGTATCGGGG + Intergenic
1180183482 21:46128300-46128322 GTGTCGGGGATGAGGTGTCAGGG - Intronic
1180220181 21:46353640-46353662 GTGTGTGTGTGTTGGTGGCAGGG + Intronic
1180597522 22:16988398-16988420 GTCTGGGAGTGGAGCAGTCAGGG - Intronic
1181645010 22:24226270-24226292 GGGTGGGTGGGCAGGTGGCAGGG + Intronic
1181928583 22:26380475-26380497 GTGTGGGTTTGGATGTTTCGCGG + Intronic
1182061185 22:27398996-27399018 GTGTTGGTTTGGGGGTGTCAGGG - Intergenic
1182623304 22:31629576-31629598 GTATGGGTGTGTAGGTGCAAGGG + Intronic
1182674821 22:32030669-32030691 GGGTGGGTGTGTGGGTGTTAAGG + Intergenic
1182819068 22:33198632-33198654 GTGTGTGTGTGTGTGTGTCACGG - Intronic
1182971203 22:34579795-34579817 GTGTGTGTGTGTGTGTGTCATGG - Intergenic
1183062232 22:35343313-35343335 GTGGGGGTGTGTAGGTGTATGGG - Intronic
1183062234 22:35343321-35343343 GTGTGTGTGTGGGGGTGTGTAGG - Intronic
1183194735 22:36345573-36345595 GTGTGTCTGTGGGGGTGACATGG - Intronic
1184210073 22:43030292-43030314 GTGGGCATGTTGAGGTGTCAGGG - Intergenic
1184400202 22:44269380-44269402 GTGTGGGTGTCTGTGTGTCATGG - Intronic
1184569890 22:45315838-45315860 GTGGGGGTGTTGTGGTTTCAAGG + Intronic
1185080153 22:48705222-48705244 CTGTGGGTGTGAAGGTGCCGGGG + Intronic
1185151736 22:49167651-49167673 GAGGGGGTGTGGAGGGGTAACGG + Intergenic
1185151746 22:49167681-49167703 GAGGGGGTGTGGAGGGGTAATGG + Intergenic
1185189374 22:49424673-49424695 TGGTGGGGGTGGAGGTCTCAAGG - Intronic
1185192764 22:49449006-49449028 GTGTGTGTGTGTATGTGACAGGG - Intronic
1185260155 22:49857057-49857079 GTTTGTCTGTGGAGGTGGCAAGG - Intronic
950204218 3:11065580-11065602 GTGTGTGTGTGTGTGTGTCATGG + Intergenic
950416862 3:12873797-12873819 GTGTGGCTGTGGGGGAGGCAAGG - Intergenic
950544400 3:13630038-13630060 GTGTGAGGGTGAAGGTGTAAGGG - Intronic
950553841 3:13683594-13683616 GTGTGGGTGTGAGGATGTGAGGG - Intergenic
950642446 3:14357115-14357137 GTGTAGGTGTGGTGGTGTAAGGG + Intergenic
950645404 3:14373958-14373980 GTGGAGGTGTGGAGGTGTGGGGG - Intergenic
950645408 3:14373966-14373988 GTCAGGGTGTGGAGGTGTGGAGG - Intergenic
950672887 3:14537771-14537793 GTGTGGGTGTACATGTGTGAAGG - Intronic
950918487 3:16668964-16668986 CTGTGGGTTTGGAGTTGGCAGGG + Intronic
951477967 3:23128844-23128866 GTGTGGGTGTGGATAGGTCAAGG - Intergenic
951530348 3:23693130-23693152 GGCTGGGTGTGGGGGTGGCAGGG - Intergenic
951848882 3:27116400-27116422 GTGTGTGTGTGTATGTGTTAAGG + Intronic
951929023 3:27942947-27942969 GTGTGTGTGTGTGTGTGTCATGG + Intergenic
952211993 3:31237268-31237290 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
952226345 3:31380678-31380700 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
952565231 3:34649223-34649245 GTGTGGATGTGCAGAAGTCATGG - Intergenic
952747428 3:36794449-36794471 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
952763805 3:36938079-36938101 GGGAGGGTCTGGAGGTGTCCAGG + Intronic
953126267 3:40094394-40094416 GTTAGGGCGTGGAGGTGCCATGG - Intronic
953255851 3:41289877-41289899 GTGTGTGTGTGTATGTGTGACGG + Intronic
953457836 3:43056693-43056715 GTGTGTGTGTAGAGGTGTGTAGG + Exonic
953885698 3:46713308-46713330 GTGTGGTGGAGGTGGTGTCAAGG - Intronic
953921764 3:46956807-46956829 GGGTGGGTGTGGTGGTGACAGGG - Intronic
953922342 3:46960853-46960875 TTGTGGGTATGGAGGTATAAAGG + Intronic
954092918 3:48299918-48299940 GTGAGGGAGGGGAGGTGTCATGG - Intronic
954228553 3:49199152-49199174 GCGTGAGTGTGGGGGTGTGAGGG + Intronic
955638848 3:61059990-61060012 GTGTGTGTGTGTAGGTGTGTAGG + Intronic
955731842 3:61995594-61995616 GTGTGGGTATGGGGGTGTGTAGG + Intronic
955916043 3:63909391-63909413 ATGTGTGTGTGGAGATGACAAGG - Intronic
956652827 3:71521111-71521133 GTGTGGGGGAGGGGGTGTCAGGG + Intronic
956873265 3:73438926-73438948 GTGTAGACGTGGAGGTGTGAAGG - Intronic
956988801 3:74737910-74737932 GTGTGTGTGTGTGTGTGTCAAGG - Intergenic
957153416 3:76516286-76516308 GTGTGGGTATGGAGGTAGGATGG - Intronic
957209113 3:77237435-77237457 GTGTGTGTGTGGTGGTGATAAGG + Intronic
957398251 3:79673320-79673342 GTGTGGGTGTGGGTGTGTGAGGG + Intronic
958180983 3:90060703-90060725 GTGTGGCTGTGGCTGAGTCAAGG + Intergenic
958921964 3:100117023-100117045 GTGAAGGTGTGAAGATGTCATGG + Intronic
959638281 3:108601259-108601281 GTGTGGGTGTGGGTGTGTGTTGG + Intronic
959650315 3:108744808-108744830 GAGTGGGGGTGGAGGTTTCCTGG + Intronic
960645397 3:119875494-119875516 GTGTGTGTGTGTGTGTGTCACGG - Intronic
960894561 3:122489068-122489090 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
961368471 3:126415691-126415713 GAGGGGGTGTGGAGCTGGCAGGG + Intronic
961389465 3:126543768-126543790 GTGTGAGTGTGGGTGTGTCTTGG + Intronic
961406554 3:126683791-126683813 GTGTGTGTGTGCAGGTGTCTGGG + Intergenic
961406557 3:126683817-126683839 GTGTGTGTGTGCAGGTGTCTGGG + Intergenic
961790182 3:129370260-129370282 GTGTGTGTGTGGATGTGGTATGG + Intergenic
961951851 3:130757889-130757911 GTGTGGGTGTGGGTGTGTGTGGG - Intergenic
961951855 3:130757905-130757927 GTGTGGGTGTGGGTGTGTGTGGG - Intergenic
961951859 3:130757921-130757943 GTGTGGGTGTGGGTGTGTGTGGG - Intergenic
961951865 3:130757943-130757965 GTGTGGGTGTGGGTGTGTGTGGG - Intergenic
962152007 3:132903089-132903111 GTGTGGGTCCGAAGGTGTCCAGG - Intergenic
962251129 3:133836741-133836763 GTGTGGGGCTGAAGCTGTCATGG - Intronic
962269536 3:133967868-133967890 GTGGGGGTGTGGAGGTGGGGTGG - Intronic
962348361 3:134638946-134638968 ATATGTGTGTGGAGGGGTCATGG + Intronic
962879482 3:139562680-139562702 GTGAGAGACTGGAGGTGTCATGG + Intronic
963075860 3:141345710-141345732 GTGTGTGTGTGGGTGTGTCTTGG + Intronic
963723459 3:148891471-148891493 GTGTGTGTGTGTATGTGACAGGG - Intronic
964425407 3:156547861-156547883 TTGTGGGTTTCCAGGTGTCAGGG - Intronic
965154011 3:165022590-165022612 GTGTGTGTGTGTATGTGTGATGG - Intronic
965348656 3:167585416-167585438 GTGTGTGTGTGTGTGTGTCATGG + Intronic
965831674 3:172797036-172797058 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
965947126 3:174256555-174256577 GTGTGTGTGTGGCGGTGTGTTGG + Intronic
966181745 3:177195370-177195392 GTGTGGGTTGGGTGGTATCATGG - Intronic
967774710 3:193374636-193374658 GTGTGTGTGTGTGTGTGTCATGG - Intronic
968194321 3:196694514-196694536 GTGTGGGTGTGGGTGTGTAATGG - Intronic
968194417 3:196694913-196694935 GGGTGGGTGTGTAGGTGTGTGGG - Intronic
968194484 3:196695218-196695240 GTGTGGGTGTGTAGATGTTTAGG - Intronic
968194530 3:196695444-196695466 GTGTGTGGGTGGCGGTGTCCAGG - Intronic
968194539 3:196695482-196695504 GTGTGGGTGTGTGGGTGTGTGGG - Intronic
969301408 4:6299444-6299466 GGGTGGGTGTGCATGTGTGAGGG + Intronic
969398762 4:6939754-6939776 GTGGTGGTGTGGAGGTGGCATGG + Intronic
969426691 4:7128568-7128590 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
969719650 4:8886395-8886417 GTGTGGGTGTGGAGATGCAGGGG - Intergenic
969866599 4:10080429-10080451 GTGGGGGTGGGGAGGTGCAAAGG - Intronic
971097235 4:23421280-23421302 GTGTGTGTGTGGATGTGTGTGGG + Intergenic
972044288 4:34644663-34644685 GTGTGTGTGTGTAGCTGTTAGGG + Intergenic
972583771 4:40418385-40418407 GAATGGGGGTGGAGGTGTGAGGG + Intergenic
974242173 4:59263847-59263869 GTGTGTGTGTGTAAGTGTTAAGG - Intergenic
974764527 4:66325444-66325466 GTGTGTGTGTGTATGTGTGAGGG - Intergenic
974795546 4:66744515-66744537 GTGTGTGTGTGGAGGTGGGTGGG - Intergenic
975622522 4:76308319-76308341 GTGTGGGGGTGGTGGTGGTATGG - Intronic
976035221 4:80810347-80810369 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
976445296 4:85124095-85124117 GTGTGTGTGTGTGTGTGTCATGG - Intergenic
977560242 4:98525429-98525451 GAGTGAGTGTGGATGTGTGATGG + Intronic
977675776 4:99745213-99745235 GTGTGGTTGTGTGGGTGTCAAGG - Intergenic
979291008 4:118978788-118978810 GTGTGTGTGTGTGTGTGTCATGG - Intronic
980545621 4:134258459-134258481 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
981007864 4:139894076-139894098 ATGTGAGTGTTCAGGTGTCAGGG - Intronic
981421563 4:144556057-144556079 GTGTGTGTGTGTAGGTGGCATGG + Intergenic
981457568 4:144971756-144971778 GTGTGGCAGTGGAAGTGGCAAGG - Intronic
982298361 4:153853436-153853458 GTGTGTGTGTGTGTGTGTCATGG - Intergenic
982539387 4:156648911-156648933 GTGTGTGTGTTGAGGTGTTGGGG - Intergenic
983031302 4:162805255-162805277 ATGTGTGTGTGGTGGGGTCAGGG - Intergenic
983179111 4:164626928-164626950 GTGTGAGTGTATAGGTGTCCTGG - Intergenic
983313447 4:166096227-166096249 GTGTGTGTGTGTGTGTGTCACGG + Intronic
984218232 4:176941266-176941288 GTGTGTGTGTGTATGTGTAAAGG + Intergenic
984815359 4:183831110-183831132 TGGTGGGTGTGGAGGCGTGAGGG + Intergenic
985085051 4:186304781-186304803 GTGTGGGTGTGTGTGTATCAAGG + Intergenic
985118558 4:186616386-186616408 GAGTGGGTGGGGAGGGGCCATGG - Intronic
985200153 4:187476280-187476302 TTGTGTGTGTGGTGGTGGCAGGG - Intergenic
985547200 5:515718-515740 GTGTGGGTGTGTGAGTGGCAGGG - Intronic
985606508 5:861042-861064 GTGCGGGTGTGGGGGTGTGCAGG - Intronic
985683861 5:1271536-1271558 GGGTGGGGGTGGAGGTGGCCTGG - Intronic
985824619 5:2183195-2183217 GGGTGGGTGAGGAGGGGCCAGGG + Intergenic
986718069 5:10538313-10538335 GTGAGGGTGTGTGGGTGTGAGGG + Intergenic
987123263 5:14787870-14787892 GTGTGGGTTTGGGAGCGTCATGG - Intronic
987947356 5:24628841-24628863 GTGTGTGTGTGTGTGTGTCAAGG - Intronic
988329441 5:29815907-29815929 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
988520621 5:31942387-31942409 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
989300246 5:39882866-39882888 GTGTGTGTGTGGTGGTGGGAAGG + Intergenic
990396024 5:55379569-55379591 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
990992614 5:61700464-61700486 GTGTGGAGGTGATGGTGTCAGGG + Intronic
991000487 5:61777788-61777810 TTGTGTGTGTGGATGTGTGAGGG - Intergenic
991096916 5:62749500-62749522 GGGATGGTGTGGATGTGTCAAGG - Intergenic
992530829 5:77650349-77650371 GTGTGTGTGTGGAGGTACAAGGG + Intergenic
992741275 5:79775840-79775862 GTGTGACTGTGGAGGGGTAAAGG + Intronic
992866385 5:80960715-80960737 GTGCGGGTGCGGAGGGCTCACGG - Exonic
993500399 5:88660464-88660486 GTGTGTGTGTGGTGGTGGCGGGG + Intergenic
994188509 5:96841525-96841547 GTGGGGGGGTGGTGGTGCCAGGG - Intronic
994536979 5:101043903-101043925 GTATGGGTGTGGATGTTTCTTGG + Intergenic
995379236 5:111513128-111513150 GTGTGGGTGTGGGTGTGTGTGGG + Intergenic
996175118 5:120347062-120347084 GTGTCTGTGAGGAGGTTTCAGGG + Intergenic
997060344 5:130493654-130493676 GTGTGTGTGTGGAGGCTTTAGGG - Intergenic
997365413 5:133322294-133322316 GTGTGGGTGTGGGTGTGTGTGGG - Intronic
997432559 5:133850792-133850814 ATGTGGGTGTGCTGGTGTCATGG - Intergenic
997601531 5:135141817-135141839 GTGAGGGTGTGGAAGCCTCAGGG + Intronic
997736232 5:136214551-136214573 GTGGGGGTATCCAGGTGTCATGG - Intronic
997838311 5:137215072-137215094 GTGTGGGTGGGTAGGTGGCAGGG + Intronic
997863934 5:137444309-137444331 GGGTGGGAGTGGAGGAGCCAGGG - Intronic
998236831 5:140405003-140405025 GTGTGTGTGTGTATGTGTAATGG + Intronic
998881704 5:146652025-146652047 GTGTGGCTGTAGAAGGGTCAGGG + Intronic
999077468 5:148810272-148810294 GTGTGGGTGTGTGTGTGTGAGGG - Intergenic
999192403 5:149758057-149758079 GTGTGGGTTTGGAGGTGGGCAGG - Intronic
1000704760 5:164496980-164497002 GTGTGTGTGTGTGTGTGTCATGG + Intergenic
1000725008 5:164758851-164758873 GTGTGTGTGTGTCTGTGTCAAGG - Intergenic
1000795892 5:165663912-165663934 GTGTGTGTGTGGAGGGGTGCTGG + Intergenic
1000964386 5:167638127-167638149 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1001230283 5:169980971-169980993 GTGTGGGTGTGGTGGTCACTTGG + Intronic
1001682090 5:173565609-173565631 GTTTGTGTGAGGTGGTGTCATGG - Intergenic
1001716718 5:173822498-173822520 GTGTGGGTGTGTATGTGTGTGGG + Intergenic
1001780549 5:174365238-174365260 ATGGAGGTGTGGAGGTGGCAGGG + Intergenic
1001930852 5:175672054-175672076 GTGTGTGTGTGGAGGGGTGAAGG - Intronic
1001949413 5:175805867-175805889 GTGTGTGTGTAGCGGTGACATGG - Intronic
1001979728 5:176030628-176030650 GTGTGAGGGTGGGGGTGTGAGGG + Intronic
1002132501 5:177090241-177090263 ATGTGGCTGTGTGGGTGTCAAGG + Intronic
1002237689 5:177813135-177813157 GTGTGAGGGTGGGGGTGTGAGGG - Intergenic
1002345987 5:178547734-178547756 GTGTGGGTGTGGGGGTGTGTGGG - Intronic
1002346018 5:178547824-178547846 GGGTGGGTGTGGGGGTGTGTAGG - Intronic
1002346027 5:178547848-178547870 GTGTGGGTGTGGGTGTGTGTAGG - Intronic
1002633337 5:180595043-180595065 GTGTGGGTGTGGGGATGTGTGGG + Intergenic
1002915858 6:1527237-1527259 GGGTGTGTGTGGAGGGGGCAGGG - Intergenic
1003961345 6:11211925-11211947 GTTTGGCTGGGGAGGTGCCAGGG - Intronic
1004069919 6:12288568-12288590 GTGTGGGTGTGGGTGTGGGAGGG + Intergenic
1004297293 6:14424762-14424784 GTGTGTGTGTGTAGGTGTGTAGG - Intergenic
1004481148 6:16020401-16020423 GTGTGTGTGTCTAGGTGTGAAGG - Intergenic
1004483030 6:16039105-16039127 GTGTGGGAGTGTAGGTGGTAGGG - Intergenic
1004838344 6:19554517-19554539 GTGTGGGTGTGTGGGTGTGTGGG - Intergenic
1006444672 6:34073632-34073654 GTGGGGGTGTGGATGCTTCACGG - Intronic
1006844930 6:37055616-37055638 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1007210174 6:40187386-40187408 GTGTGTGTGTGGCGGGGTGAGGG + Intergenic
1007394547 6:41570075-41570097 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1007481554 6:42153717-42153739 GTGTGGGTTTGGGGGAGCCACGG - Intergenic
1007761097 6:44134231-44134253 GTGTGGGGGTGGCGGCGGCAGGG + Intronic
1007770427 6:44187549-44187571 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1007971074 6:46052817-46052839 GTCTCGGTGTGGAGGTGCCAGGG + Intronic
1009290507 6:61875168-61875190 GTGTGGGCGTGGTGGGGGCAGGG + Intronic
1010339169 6:74727286-74727308 GTGTGGGTGGGGTGGTGGAAGGG + Intergenic
1010977588 6:82333241-82333263 GTGTGGCAGTGGAGGGGTGAGGG - Intergenic
1011156780 6:84341834-84341856 GTGTGTGTGTGTATGTGTCCTGG + Intergenic
1011196216 6:84782228-84782250 GTGTGGATGTGGGGGTGTGGAGG - Intergenic
1011929999 6:92700410-92700432 GTGTTTGTGTGGAAATGTCACGG + Intergenic
1012093973 6:94934420-94934442 GGGTGTTTGTGGAGCTGTCAGGG - Intergenic
1012271732 6:97220953-97220975 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1012953887 6:105548011-105548033 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1012967555 6:105691249-105691271 ATGTGTGTGGGGAGGGGTCAGGG + Intergenic
1013367602 6:109447363-109447385 GTGTTGGGATGGGGGTGTCAGGG + Exonic
1013645051 6:112129192-112129214 GTGTGTGTGTGTATGTGTGATGG + Intronic
1015467846 6:133567631-133567653 CTCTGGGTGTGGCAGTGTCATGG - Intergenic
1015577958 6:134692754-134692776 GTGTGTTTGTGTATGTGTCAGGG - Intergenic
1015689990 6:135911241-135911263 CTGTGGGTGTGGAGATTTAATGG - Intronic
1015777362 6:136827532-136827554 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1015854137 6:137605559-137605581 GTCTGGGCGGGGTGGTGTCAGGG - Intergenic
1016869695 6:148804383-148804405 GTGTGTGTGAGGGGGGGTCATGG + Intronic
1017385276 6:153875875-153875897 GTGAGGGTGTGGAGGGGTGAGGG - Intergenic
1017769040 6:157630941-157630963 GTGTGAGTGTGGGTGTGTAAGGG - Intronic
1017769938 6:157637194-157637216 CTGTGGCTTTGGAGGTGGCATGG + Intronic
1017889524 6:158627189-158627211 GTGTGTGAGTGAAGGTGTAAGGG - Intronic
1018014168 6:159697030-159697052 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1018186861 6:161273298-161273320 GTGGGGGAGGGGAGTTGTCAAGG - Intronic
1018266412 6:162029178-162029200 GTGTGGGGGTGGAGGTGGGTGGG - Intronic
1018677614 6:166236529-166236551 GGGAGAGTGTGGAGGTGGCATGG + Intergenic
1019401886 7:859487-859509 GTGTGTGTGGGGAGGAGTGAGGG + Intronic
1019433748 7:1011460-1011482 GTCTGGGTGTGGGTGTGTCTGGG - Intronic
1019433757 7:1011504-1011526 GTCTGGGTGTGGGTGTGTCAGGG - Intronic
1019617561 7:1972889-1972911 GTGTGGGGGAGGAGGTCTCCCGG - Intronic
1021239244 7:18180216-18180238 GTGTGTGTGTGTATGTGTCTTGG - Intronic
1021627826 7:22611969-22611991 GGCTGGGAGTGGGGGTGTCAGGG - Intronic
1021809755 7:24391951-24391973 GGGTGGAGGTGGAGGTGTGATGG - Intergenic
1022198542 7:28093894-28093916 GTGTGGGTGGGCAGGAGCCAGGG + Intronic
1022517496 7:30985236-30985258 GTGTGTGTGTGTATGTGTGAGGG + Intronic
1023137870 7:37071328-37071350 GTGTAGGGGTGGAGGTGGAAGGG - Intronic
1023162587 7:37311673-37311695 CTGTGGGTGTGCATGTGTCACGG - Intronic
1023583312 7:41704646-41704668 GTGTGTGTGTGTAGGTGACGTGG + Intergenic
1024616936 7:51123820-51123842 ATGTGGGTGAGGAGGTGGCATGG - Intronic
1024712254 7:52029409-52029431 GGGGGGGTGTGTAGGTGTCAGGG - Intergenic
1024765599 7:52654581-52654603 GTGTGGGCTTGGAGGAGCCATGG - Intergenic
1024786428 7:52912180-52912202 GACTGGTTGTGGTGGTGTCATGG - Intergenic
1024854036 7:53755874-53755896 GTGTGTGTGTGCATGTGTCTGGG - Intergenic
1025160312 7:56653708-56653730 CTGTGGGTGTGGCGGTTTCAAGG - Intergenic
1025239085 7:57256676-57256698 CTGTGGGCGTGGAGCTGTCCCGG + Intergenic
1025279298 7:57615273-57615295 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1025305433 7:57850227-57850249 GTGTGGGAGTGCATGTTTCAGGG - Intergenic
1025755227 7:64331984-64332006 CTGTGGGTGTGGTGGTTTCAGGG + Intronic
1025942983 7:66087266-66087288 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1026389546 7:69886793-69886815 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1026527222 7:71164699-71164721 GTGTGTGTGTGCATGTGACAAGG + Intronic
1026975683 7:74496568-74496590 GTGTGGGTGTGCATGTGTGTGGG + Intronic
1027318363 7:76997909-76997931 GTGCAGGTGTGGAGGTGTGCAGG + Intergenic
1027318427 7:76998192-76998214 GTGGGTGTGTGGAGGTGTGTGGG + Intergenic
1027629527 7:80585313-80585335 GTGTGTGTGTGGAGGTGGGGGGG + Intronic
1028205393 7:88010816-88010838 GGCTTGGTGTGGAGGTGGCATGG + Intronic
1028735535 7:94207821-94207843 GTGTGTGTGTAGAGGTGTTTAGG - Intergenic
1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG + Intronic
1028931179 7:96414791-96414813 GTGTGGGTGTCAAGGTGAGAGGG + Intergenic
1028965121 7:96793667-96793689 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1029510661 7:100992825-100992847 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029511150 7:100996074-100996096 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029511878 7:101000745-101000767 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029512370 7:101003994-101004016 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029529781 7:101117616-101117638 GGGTGGGGGTGGAGGTCCCAGGG - Intergenic
1029818519 7:103122248-103122270 GTGTGTGTGTGCACGTGTGAGGG - Intronic
1029946729 7:104541099-104541121 GTGTGTGTGTGTGTGTGTCATGG - Intronic
1029967526 7:104755571-104755593 GTGTGTGTGTGGTGGTGTTGGGG - Intronic
1030110365 7:106021614-106021636 GTGTGTGTTTGGGGGTGTGATGG + Intronic
1030987935 7:116263955-116263977 GAGGGGGTGTGGAAGGGTCATGG - Intergenic
1031075550 7:117208927-117208949 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1031144051 7:117978229-117978251 TTGTGTGTGTGGATGTGTGAGGG - Intergenic
1031326634 7:120407920-120407942 GTGTAGGTGAAGAGGAGTCAAGG + Intronic
1031401420 7:121329386-121329408 ATGTGAGTATGGAGGTGGCAGGG + Exonic
1031997824 7:128244242-128244264 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1032429171 7:131847010-131847032 GTGTGGGTGGGGAGGCGTGTTGG + Intergenic
1033197583 7:139341019-139341041 GTGTGGGTGTGGATTTGATATGG - Intronic
1034417839 7:150974612-150974634 GTGGGGGTGTGGGGGTGTGGGGG - Intronic
1034423249 7:151000033-151000055 GTGTGAGTGTGGATGTGTGTAGG + Intronic
1034480058 7:151312905-151312927 GTGTGAGTGTGGATGTGTGTGGG + Intergenic
1034690851 7:153012534-153012556 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
1034856864 7:154558093-154558115 GTGGGGGGGTGGAGGGGTAAAGG - Intronic
1034939565 7:155221466-155221488 GTTTGGGTGTGGCTGTGCCAGGG - Intergenic
1035296745 7:157871784-157871806 GTGTGGGTGTGTAGGTATTTAGG - Intronic
1035916689 8:3632339-3632361 GTGGGGATGGGGGGGTGTCAGGG - Intronic
1035947829 8:3984773-3984795 GTGTGTGTGTGTGGGTGTAAAGG + Intronic
1035988659 8:4463288-4463310 GTGTTGGTGAGGAGGTGTATGGG + Intronic
1036715090 8:11114763-11114785 GTGTGTGTGTGTATGTGCCAGGG + Intronic
1038388701 8:27174423-27174445 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
1038567987 8:28635704-28635726 GTGTGTGTGTGGAGTTGTGGGGG - Intronic
1039435356 8:37556171-37556193 GTGTGGGTGTGGAGGGGAAGGGG - Intergenic
1040932278 8:52747770-52747792 CTGTGGGCGTGGAGGTTGCAGGG - Intergenic
1041088391 8:54278895-54278917 GTGTGAGTGTGGAAGTGTGTGGG - Intergenic
1041212511 8:55566985-55567007 GTGTGTGTGTGTGTGTGTCATGG + Intergenic
1041698612 8:60763453-60763475 GTGTGGGTGGGGAGCGGTCAGGG + Intronic
1041781972 8:61586680-61586702 GTGAGAGAGTGGAGGGGTCAAGG - Intronic
1041786202 8:61637200-61637222 GTGGGGGTGTGAAGGTGTGAGGG - Intronic
1042114809 8:65419189-65419211 GTCTGGGAGTGGAGGAGACAGGG - Intergenic
1042144831 8:65716884-65716906 GTGTGGGTATAGAGGTCTGAGGG - Intronic
1042414209 8:68500625-68500647 GTGTGAGTGTGGATGTGTGTGGG - Intronic
1043654371 8:82643370-82643392 GTGTGTGTGTGTTTGTGTCAGGG - Intergenic
1043672311 8:82902777-82902799 GTGTGGGTGTGAGGATGTAATGG - Intergenic
1043872075 8:85444373-85444395 GTGTGTGTGTGTAGGTGTTGGGG + Intronic
1044164294 8:88962168-88962190 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1044434934 8:92150828-92150850 GGGTGGGGGTGGAGGGGGCAGGG + Intergenic
1044550037 8:93501771-93501793 GTGTATGTGTGGTGGTGGCAGGG - Intergenic
1045222241 8:100210809-100210831 GTTTGGGTGTGGAACTGGCAAGG - Intronic
1045565794 8:103313786-103313808 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1045839651 8:106564400-106564422 GTGTGTGTGTGTATGTGTCCAGG - Intronic
1046175844 8:110573994-110574016 GTGTGGGTGTGTCTGTGTGATGG - Intergenic
1047387995 8:124427153-124427175 GTGTGTGTGTGCAGGGGTCGGGG - Intergenic
1047802184 8:128321485-128321507 GTGAGGGTGTGCAGGGGTGAGGG + Intergenic
1048871832 8:138805337-138805359 GTGATGGTGTGGATGTGTGATGG + Intronic
1048988325 8:139747421-139747443 GAGTGGGTGTGGAGGTGTCCAGG + Intronic
1048988363 8:139747567-139747589 GAGTGGGTGTGGGGGTGTCCCGG + Intronic
1048988428 8:139747804-139747826 GAGTGGGTGTGGGGGTGTCCCGG + Intronic
1048988458 8:139747923-139747945 GAGTGGGTGTGAGGGTGTCCCGG + Intronic
1048988489 8:139748041-139748063 GAGTGGGTGTGGGGGTGTCCCGG + Intronic
1048988522 8:139748160-139748182 GAGTGGGTGTGGGGGTGTCCCGG + Intronic
1048988552 8:139748278-139748300 GAGTGGGTGTGAGGGTGTCCTGG + Intronic
1049043641 8:140131763-140131785 GTGTGAGTGAGGAGTTGTCTGGG - Intronic
1049684910 8:143935473-143935495 TTCTGGGTGTGGGGGTGGCAGGG - Intronic
1049694196 8:143975689-143975711 GTGTGGGAGTGGGGGTGGCCAGG - Intronic
1049756724 8:144314102-144314124 CTGCGGGGGTGGGGGTGTCAAGG - Intronic
1049883765 9:14778-14800 GTCTGGGGGGGAAGGTGTCATGG + Intergenic
1050583301 9:7083731-7083753 GTGTGTGTGTGTGTGTGTCAAGG + Intergenic
1050798583 9:9579578-9579600 GAGGAGGTGTGGAGGTGGCAGGG - Intronic
1050839614 9:10131707-10131729 GTGTGTGTGTGGAATTGTGAAGG + Intronic
1051105647 9:13576760-13576782 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
1051965640 9:22826224-22826246 GTGAGTGATTGGAGGTGTCAGGG - Intergenic
1052412290 9:28137194-28137216 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1052969808 9:34370559-34370581 GTGTGAGTGTGGGGGTGGAAAGG + Exonic
1053202921 9:36164994-36165016 AGTTGGGTCTGGAGGTGTCATGG - Intergenic
1053268017 9:36730036-36730058 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1053397754 9:37789778-37789800 GTGTGTGTGTGCCTGTGTCATGG + Intronic
1053438613 9:38095094-38095116 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1055008282 9:71534483-71534505 GTGTGTGTGTGGAGGGGTGGTGG + Intergenic
1055208375 9:73761382-73761404 GTGTGTGTGTGGTGGTCACAGGG + Intergenic
1055504079 9:76930510-76930532 GTATTGGTGTGGAGCTGTCAGGG + Intergenic
1055594451 9:77850886-77850908 GTGGGGGTGGGGATGTGCCATGG - Intronic
1055989402 9:82089514-82089536 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1056039316 9:82645637-82645659 GTGTGTATGTGTAGGTGTAAAGG - Intergenic
1056562940 9:87748533-87748555 GGGTGGAAGGGGAGGTGTCATGG - Intergenic
1056790450 9:89622078-89622100 GATAGGGTGTGGAGGTGCCAGGG - Intergenic
1057045100 9:91879418-91879440 GTGTGGGTGTGTGGGTGTGGGGG + Intronic
1057054232 9:91949230-91949252 GTGGGGGAGAGGAGGTTTCAGGG + Intronic
1057191913 9:93093115-93093137 GTGGGGGTGTGTGTGTGTCAGGG + Intergenic
1057429014 9:94977586-94977608 GTGTGTGTGTGGTGGAGGCAGGG - Intronic
1058531554 9:105910629-105910651 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1058732359 9:107862366-107862388 GTGTGTGTGTGTGAGTGTCAAGG - Intergenic
1058847215 9:108972846-108972868 GTGTGGGTGGGGGGGTGGGAGGG + Intronic
1059237387 9:112772507-112772529 GTGTGCGTGTGGAGATATCTAGG + Intronic
1059463262 9:114448861-114448883 CTGTGGGTGAGGAAGTGACAAGG - Intronic
1060223568 9:121776836-121776858 GTCTGGGTGTGGGCGTATCAGGG + Intronic
1061396619 9:130347110-130347132 GTGTGGAGGGGAAGGTGTCAGGG + Intronic
1061560938 9:131402672-131402694 GTCTGGGTGTGGGGCAGTCAGGG + Intronic
1061935293 9:133854113-133854135 GTGTGTGTGTGCAGGTGCAAGGG - Intronic
1061962733 9:133996621-133996643 ATGTGGGTGGGGAGGTGACGAGG + Intergenic
1061974273 9:134060583-134060605 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1062031164 9:134362667-134362689 GTGTGTGTCTGTAGGTGTGAAGG - Intronic
1062106840 9:134759847-134759869 GTGTGAGTGTGGGGGTGTGGGGG - Intronic
1062287343 9:135779028-135779050 CTGTGGTTGTGGGGGTTTCAGGG - Intronic
1062287419 9:135779264-135779286 ATGTGGCTGTGGGGGTCTCAGGG - Intronic
1062483146 9:136761802-136761824 GTGGGGCTCCGGAGGTGTCAGGG + Exonic
1203630687 Un_KI270750v1:70093-70115 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1185451458 X:283079-283101 GTGTGTGTGTGTAGGCGACACGG + Intronic
1186183889 X:7000226-7000248 TTGTTGGTGTAGAGCTGTCAAGG - Intergenic
1186278083 X:7961946-7961968 AATTGTGTGTGGAGGTGTCAAGG + Intergenic
1186350016 X:8731510-8731532 GTGTGGATGTGGCGGTTTCCCGG - Intronic
1186842649 X:13499914-13499936 GTGTGGGTGTGTGGGTGTGTGGG + Intergenic
1186936374 X:14454163-14454185 GTGTGGGTGTGGGTGTGTGTGGG - Intergenic
1187423383 X:19156000-19156022 GTGTGAGTGTGCAGGCTTCAGGG - Intergenic
1187505314 X:19874448-19874470 GGGGGGGTGTGGAGGTGTTGAGG + Intronic
1187916040 X:24152652-24152674 CTGTGGTTGTTGAGGTGTTAAGG + Intronic
1188236052 X:27732500-27732522 GTGTGTGTGTGTGTGTGTCAAGG + Intronic
1188411550 X:29878170-29878192 GTGTGGGTTAAGAGGTCTCAGGG + Intronic
1188697387 X:33212104-33212126 GTGTGTGTGTATAGGTCTCATGG + Intronic
1189191792 X:39115589-39115611 GTGTGTGTGTGGTGTTTTCATGG + Intergenic
1189273383 X:39767498-39767520 GTGTGTGTGTGCAGGGGGCAAGG - Intergenic
1189504517 X:41598130-41598152 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1190222351 X:48520585-48520607 GTGTGTGTGTTGAGGTGTTGGGG - Exonic
1190598201 X:52066826-52066848 AAGGGGGTGTGGAGGTGGCAGGG + Intronic
1190610623 X:52187247-52187269 AAGGGGGTGTGGAGGTGGCAGGG - Intronic
1190726724 X:53194803-53194825 GTTTGGGAGTGGGGGTGTTAAGG - Intronic
1191146429 X:57170707-57170729 GTGTGTGTGTGTGTGTGTCATGG + Intergenic
1192180543 X:68913068-68913090 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
1192198520 X:69048420-69048442 CTGTGGGAGGGGAGCTGTCATGG - Intergenic
1192207077 X:69103478-69103500 GAGTGGGGGTGGAGGTGGGATGG - Intergenic
1192431019 X:71111600-71111622 GTGTGGGTGGGGAGGGGTAGTGG - Exonic
1192584788 X:72310403-72310425 GTGTGTGTGTGTGTGTGTCAAGG - Intergenic
1193076362 X:77360009-77360031 GAGTGGGGGTGGAGGTGTGGAGG + Intergenic
1194125061 X:90007181-90007203 CTGATGGTGTGGAGGTCTCAGGG + Intergenic
1194661681 X:96634671-96634693 CTGTGGGTGTGTAGGTGTAGGGG + Intergenic
1194744208 X:97610669-97610691 GTGTGTGTGTGGTCCTGTCATGG + Intergenic
1194821691 X:98515316-98515338 GTGTGTGTGTGTAGGTGTGTAGG + Intergenic
1196080944 X:111630337-111630359 CTGTGTGTGTGGGGGAGTCAGGG + Intergenic
1196160568 X:112478117-112478139 GTGTGTGTGTGAAGGTGAAAAGG + Intergenic
1196333177 X:114496260-114496282 GTGTGTGTGTGTATGTGTAATGG - Intergenic
1196540375 X:116900379-116900401 GTGCAGGTGTGGGGCTGTCATGG - Intergenic
1196563595 X:117178753-117178775 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1196862518 X:120041389-120041411 GTGTGGGTGTGGTAGGGGCACGG - Intergenic
1196880584 X:120194955-120194977 GTGTGGGTGTGGTAGGGGCACGG + Intergenic
1196916861 X:120545868-120545890 GTGGGGGTGGGGAGGGGTGATGG + Intronic
1197495282 X:127172253-127172275 ATGTGGGGGTGGGGGTGTGATGG + Intergenic
1198018489 X:132635378-132635400 CTGGGGGTGTGGAAGTGGCATGG - Intronic
1198127042 X:133655465-133655487 GTGTGTGTGTGGGTGTGTGAAGG - Intronic
1198316991 X:135477867-135477889 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1198402113 X:136278405-136278427 GTATGGATGTGGAGAAGTCATGG + Intergenic
1198402204 X:136279013-136279035 GTATGAATGTAGAGGTGTCATGG - Intergenic
1199972699 X:152872564-152872586 GTGTGTGTGTGGGGGTGTGTGGG + Intergenic
1200402050 X:156025381-156025403 GTCTGGGGGGGAAGGTGTCATGG - Intergenic
1200864580 Y:8029293-8029315 TTGGGGGTGTGTATGTGTCAAGG + Intergenic
1201164145 Y:11192246-11192268 GTGTGTGTGTGTATGTGTTATGG - Intergenic
1201340243 Y:12925618-12925640 GTGTGCGTCTGCACGTGTCAGGG + Intergenic