ID: 1126568860

View in Genome Browser
Species Human (GRCh38)
Location 15:50128529-50128551
Sequence CTGTGACAGTAGAGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 291}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126568860_1126568865 9 Left 1126568860 15:50128529-50128551 CCCACTTCCCTCTACTGTCACAG 0: 1
1: 0
2: 2
3: 28
4: 291
Right 1126568865 15:50128561-50128583 GGTTCTCTGTGATGCCATTCTGG 0: 1
1: 0
2: 1
3: 12
4: 172
1126568860_1126568869 30 Left 1126568860 15:50128529-50128551 CCCACTTCCCTCTACTGTCACAG 0: 1
1: 0
2: 2
3: 28
4: 291
Right 1126568869 15:50128582-50128604 GGAGAGAAGCAGGAGAGGAGAGG 0: 1
1: 1
2: 43
3: 396
4: 2332
1126568860_1126568866 20 Left 1126568860 15:50128529-50128551 CCCACTTCCCTCTACTGTCACAG 0: 1
1: 0
2: 2
3: 28
4: 291
Right 1126568866 15:50128572-50128594 ATGCCATTCTGGAGAGAAGCAGG 0: 1
1: 0
2: 3
3: 22
4: 230
1126568860_1126568868 25 Left 1126568860 15:50128529-50128551 CCCACTTCCCTCTACTGTCACAG 0: 1
1: 0
2: 2
3: 28
4: 291
Right 1126568868 15:50128577-50128599 ATTCTGGAGAGAAGCAGGAGAGG 0: 1
1: 0
2: 4
3: 49
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126568860 Original CRISPR CTGTGACAGTAGAGGGAAGT GGG (reversed) Intronic
900304898 1:2000947-2000969 CTGTGACAGTGAAGGGAAGGGGG - Intronic
900397242 1:2458132-2458154 CTCTGACAGCACAGGGAAGGTGG + Intronic
901181772 1:7346909-7346931 CTGTGACAGTTGAGTGTAGCTGG - Intronic
902279825 1:15366336-15366358 CTGCGACAGCACAGGGAAGCAGG - Intronic
904804041 1:33118503-33118525 CTGTGACTGCAGAGGGAGGCAGG + Intronic
905737243 1:40338198-40338220 CTGTGGCTGTAGTGGAAAGTGGG - Intergenic
909792393 1:79695424-79695446 ATGTGGCAGTAGTGAGAAGTGGG - Intergenic
912090043 1:106061103-106061125 CAATGACAGTAGAAGGCAGTAGG - Intergenic
912200500 1:107452490-107452512 CTGTGGTAGTATTGGGAAGTGGG + Intronic
915924686 1:160007301-160007323 ATGTTACAGCTGAGGGAAGTGGG + Intergenic
916462760 1:165044374-165044396 CTGTGGTAGGAGAGGAAAGTAGG - Intergenic
919190111 1:194205438-194205460 AAGAGTCAGTAGAGGGAAGTGGG + Intergenic
920095418 1:203483434-203483456 CTATCACAGTAGAGGGCAGATGG - Exonic
920201629 1:204263178-204263200 CTGTGACAGGAGAAGGCAGAGGG + Intronic
920837425 1:209524572-209524594 CTGGGAGAGTGGAGGGAAGGGGG + Intergenic
920846276 1:209595549-209595571 CTCTGTCAGGAGAGGGGAGTTGG + Intronic
921087629 1:211810947-211810969 AGGTGACAACAGAGGGAAGTAGG + Intronic
921239769 1:213166861-213166883 CAGTTACATTAGAGGAAAGTAGG + Intronic
923054195 1:230413285-230413307 CTGAGACAGAATAGGGAGGTTGG - Intronic
923275898 1:232396062-232396084 CAGTGAAAGTGGAGAGAAGTAGG - Intergenic
923280231 1:232436576-232436598 CTGGGACAGGAGAGGAAAGCAGG + Intronic
923383004 1:233440353-233440375 CTGAGACAGAAGTGGAAAGTCGG - Intergenic
924950687 1:248880110-248880132 CTGTGACAATATAGGAAAATGGG - Intergenic
1062815197 10:494210-494232 CTTTGACAGCAGAAAGAAGTGGG + Intronic
1062928192 10:1333804-1333826 CTGTGGCATTACAGGTAAGTTGG - Intronic
1064451925 10:15449871-15449893 TTTTGACAGTGGAGGGTAGTTGG + Intergenic
1065029127 10:21567514-21567536 CTGTGTCAGTGGAGAAAAGTAGG - Intronic
1065828422 10:29593280-29593302 CTCTGACAGTAGCGGACAGTTGG + Intronic
1067856601 10:49799057-49799079 CAGTGACAGAAGAGGGAGGAGGG - Intergenic
1068931058 10:62590754-62590776 CAGTGACAGTTGAGGGAACAAGG - Intronic
1071552965 10:86581501-86581523 CTCTGTGAGTAGAGGGAGGTTGG - Intergenic
1071680829 10:87703743-87703765 CTGGGCCAGTAGTGGGAAGAAGG + Intronic
1072537722 10:96375848-96375870 TTCTGACTGTAGAGGTAAGTAGG - Intronic
1074744128 10:116514642-116514664 CTGTGATGGGGGAGGGAAGTGGG + Intergenic
1076305337 10:129462101-129462123 CTGGGTCACTAGAAGGAAGTGGG - Intergenic
1076426627 10:130371708-130371730 CTGTGACAGGAAAGGGAAGCTGG + Intergenic
1077604195 11:3596478-3596500 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1079087836 11:17460028-17460050 CTGTCAGAGGAGAGAGAAGTGGG - Intronic
1079487179 11:20947422-20947444 CCGTGTCTGTAGAGGTAAGTGGG + Exonic
1081302583 11:41470679-41470701 TTGTGTCAGATGAGGGAAGTGGG + Intergenic
1081342595 11:41946646-41946668 ATGTCACAGTTCAGGGAAGTAGG + Intergenic
1081751472 11:45514162-45514184 TGGTGACAGTAGCGGGACGTAGG - Intergenic
1081907897 11:46680748-46680770 CTGTAGGAGTAGAGGGAGGTGGG + Intronic
1082934246 11:58639896-58639918 CTGTAACAGATGAAGGAAGTGGG - Intergenic
1083902834 11:65652037-65652059 CAGTGACAGTGGGGAGAAGTGGG + Intergenic
1084226645 11:67719290-67719312 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1084260093 11:67971072-67971094 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1084812679 11:71624182-71624204 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1084934942 11:72581819-72581841 ATGTGACAGTAGAGGAAAGAGGG + Intronic
1085452157 11:76640917-76640939 CTGTGTCAGAAGAGGGATCTAGG - Intergenic
1086443860 11:86853862-86853884 TGGTGAAACTAGAGGGAAGTAGG - Intronic
1086926645 11:92648138-92648160 CTATGACAGTAGTGGTAGGTAGG + Intronic
1087902046 11:103651814-103651836 CTGTGACGCTAGAGGTAAGATGG - Intergenic
1089634755 11:119804989-119805011 CTATGACAGTCTAGGTAAGTGGG - Intergenic
1090800370 11:130167608-130167630 CTGTGATAGGGGAGGGAAGGGGG - Intronic
1090994878 11:131857094-131857116 CAGTGACATTAGAGGATAGTGGG - Intronic
1091596281 12:1881120-1881142 CAGGGACAGGAGAGGGAAGGAGG + Intronic
1091736229 12:2924308-2924330 ATGAGCCAGGAGAGGGAAGTGGG + Intronic
1092126619 12:6079247-6079269 CTGTGGCAGAACAGGGAAGCTGG - Intronic
1092275552 12:7058371-7058393 CTGTGAGGGTAGAGGCAAGATGG - Intronic
1092905064 12:13093556-13093578 CTGTGGCAGTGGATGGAAGCTGG - Intronic
1096621611 12:52869102-52869124 CAGTGACAGCACAGGGAAGTAGG - Intergenic
1096984267 12:55745796-55745818 CTGAGAGGGTAGAGGGAACTAGG - Intronic
1097159521 12:57036484-57036506 CTGAGACTGTAGCTGGAAGTTGG + Intronic
1097173940 12:57132138-57132160 CTGGGACAGAAGAGGGAGGCAGG - Intronic
1098158966 12:67629554-67629576 TTGTGGCAGTAGTGAGAAGTAGG + Intergenic
1099431525 12:82591913-82591935 CTGGGAAAGTAGAGTGGAGTGGG + Intergenic
1100025344 12:90121740-90121762 CTGTGACAGTAGTGGCAGGTTGG + Intergenic
1100346531 12:93737074-93737096 CTGGGATAGTTGAGGGAAGGTGG + Intronic
1100620545 12:96268077-96268099 CTGTGTCAGTATAAGTAAGTTGG + Exonic
1100682612 12:96944547-96944569 CTGGGACAAAAGAGAGAAGTAGG + Intronic
1100686059 12:96986761-96986783 CTCTGAGAGTTGGGGGAAGTGGG + Intergenic
1100849706 12:98696473-98696495 CTGTGGCAGTGTTGGGAAGTAGG - Intronic
1101465281 12:104942557-104942579 CTGTGACTGTATAGGGGAGGAGG - Intronic
1103821034 12:123698931-123698953 CAGTGACAGTACTGGGAAGGAGG + Intronic
1104529390 12:129554612-129554634 AGGTGACAGTAGAGAGAAGGTGG - Intronic
1104620450 12:130308028-130308050 GTGTGACAGCAGAGGGCGGTGGG - Intergenic
1106658925 13:31778064-31778086 AAGTGACAGTAGGGGGAATTTGG - Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107103371 13:36617962-36617984 CTGTGACAGGAGAGGTCAATAGG - Intergenic
1107546322 13:41436805-41436827 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1107998661 13:45886905-45886927 ATGTGACAGTGTTGGGAAGTAGG - Intergenic
1108214898 13:48174552-48174574 CTGTTCCAGCAGAGGGAAGTGGG - Intergenic
1108957428 13:56177849-56177871 ATATGACAGTAGAAGCAAGTGGG + Intergenic
1109257743 13:60103784-60103806 CTGTCACAAGAGAGGGAATTAGG - Intronic
1109839770 13:67906374-67906396 TGGTGAAACTAGAGGGAAGTAGG + Intergenic
1110525114 13:76526888-76526910 ATGTGACAGTATTGAGAAGTAGG - Intergenic
1110888243 13:80666128-80666150 CAGTGTCAGTAGAGGAATGTGGG - Intergenic
1111268397 13:85849971-85849993 CTGTGAAAGTAGACAGGAGTGGG - Intergenic
1111840597 13:93445341-93445363 CTATGACAGTATTAGGAAGTAGG - Intronic
1115434437 14:33357165-33357187 ATGTGAAATTAGAGGGAAGATGG + Intronic
1117575779 14:57095750-57095772 CTGTGACAGTATTGGGAGGTGGG - Intergenic
1119228498 14:72961979-72962001 CTGTTAGAACAGAGGGAAGTGGG - Intergenic
1120282716 14:82459472-82459494 CTGTGACAAAATAGGAAAGTAGG + Intergenic
1120731095 14:88002373-88002395 GTGTGGCAGTAGTGGGAAGTGGG - Intergenic
1121314364 14:92952308-92952330 CTGTCACTATACAGGGAAGTAGG + Intronic
1121512278 14:94521462-94521484 GTGAGACAGTAGGGAGAAGTAGG + Intergenic
1124130568 15:26981684-26981706 TGGTGACAGTAAGGGGAAGTGGG + Intronic
1125548616 15:40527552-40527574 GTGTGGCAGTATTGGGAAGTGGG + Intergenic
1125886023 15:43230171-43230193 CTTTGACTGCAGAGTGAAGTGGG - Intergenic
1125957527 15:43800561-43800583 CTGTGTCAGTTGCCGGAAGTCGG + Exonic
1126357686 15:47813406-47813428 CTGACACAGCAGAGGGCAGTGGG - Intergenic
1126568860 15:50128529-50128551 CTGTGACAGTAGAGGGAAGTGGG - Intronic
1129535794 15:76312705-76312727 CAGTGAGAGAAGAGGGCAGTGGG - Intergenic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1134245810 16:12539097-12539119 TTGTGAAAGTAAAGGCAAGTAGG - Intronic
1136034865 16:27531465-27531487 CTGAGCCAGTAGAGGGAAAGGGG - Intronic
1137910551 16:52373585-52373607 CTCTGCCAAAAGAGGGAAGTGGG + Intergenic
1138232637 16:55350286-55350308 CTGAGACAGTAGAGTGCAGAAGG + Intergenic
1138346046 16:56320831-56320853 CTGGGACAGTGGTGGGAAGAGGG + Intronic
1139336375 16:66234606-66234628 GTGTGACGGTAGTGGGAGGTGGG + Intergenic
1139738112 16:69010553-69010575 CTGTGACAGCAGAGGCAAGGTGG - Intronic
1141956594 16:87376079-87376101 CTGTGGCAGTGGAGGGCAGGGGG - Intronic
1144406601 17:14957997-14958019 TTGTGACAGCAGTGGGAAGAAGG - Intergenic
1144499156 17:15770285-15770307 CCGTGGGAGTAGAGGGAGGTGGG + Intergenic
1145162538 17:20585321-20585343 CCGTGGGAGTAGAGGGAGGTGGG + Intergenic
1145878498 17:28337342-28337364 CACAGACAGTAGGGGGAAGTTGG - Intronic
1147205587 17:38835186-38835208 CTGTTAGAACAGAGGGAAGTGGG + Exonic
1147331636 17:39702781-39702803 CTGTGACAGTCCTGTGAAGTAGG + Intronic
1148622634 17:49045827-49045849 CTGTGACAAAAGAGAAAAGTGGG - Intronic
1150709073 17:67514526-67514548 CTGTGAAAGTCAAGGGAAGCCGG + Intronic
1151106520 17:71622399-71622421 CTGTGACAGGAGATGGAAACTGG - Intergenic
1152330549 17:79670181-79670203 CAGTGAATGCAGAGGGAAGTGGG - Intergenic
1152548031 17:81012742-81012764 CTGAGGCTGTATAGGGAAGTGGG - Intergenic
1154115632 18:11610582-11610604 CTGTGAGAGGACAGGGAAGGTGG + Intergenic
1154120079 18:11644797-11644819 CTGTGAGAGGACAGGGAAGGTGG + Intergenic
1155840011 18:30632348-30632370 ATGTGGCAGGAGGGGGAAGTGGG + Intergenic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158864678 18:61626875-61626897 CTGTTACAGTGGAGGAAAGTGGG + Intergenic
1163537184 19:17883658-17883680 CTGGGAGAGTAGGTGGAAGTGGG - Intronic
1163577332 19:18118358-18118380 CTGTGGCAGCAGTGGGAAGGGGG + Intronic
1164569856 19:29366027-29366049 CTGTGTCAGCAGAGGGCAGGGGG - Intergenic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165277427 19:34767161-34767183 GTGTGACAGAAGTGGGAAGACGG + Intronic
1166377231 19:42334342-42334364 CTCTGGAAGGAGAGGGAAGTGGG - Intronic
1166670245 19:44705544-44705566 ATGGGGCAGTAGAGGGAAGGAGG - Intronic
1167041478 19:47025248-47025270 CTGTGGCAGTTGAGGGAAGGAGG + Intronic
1168189804 19:54729764-54729786 CTGTGACAGAAACGGGCAGTGGG - Exonic
1168394626 19:56037743-56037765 TTGAGACAATGGAGGGAAGTGGG + Intronic
925213451 2:2071603-2071625 CTGAGACATAAGAGGAAAGTAGG + Intronic
925551030 2:5074663-5074685 CTGTGTCAGTAGATGGAGGTTGG - Intergenic
927182636 2:20457792-20457814 CTGAGGCAGTAGAGGGCAGGAGG - Intergenic
929228291 2:39533206-39533228 CTGAGACAGGAGAGAGCAGTGGG - Intergenic
930140098 2:47942818-47942840 CCTTGAGAGTAGAGTGAAGTAGG + Intergenic
930673573 2:54176942-54176964 CTGTGAAAGGAGAGGGAAGCTGG - Intronic
932348257 2:71010210-71010232 TGGTGAAACTAGAGGGAAGTAGG + Intergenic
932351134 2:71033090-71033112 TGGTGAAACTAGAGGGAAGTAGG + Intergenic
933573384 2:84039741-84039763 ATGTGAGAGTAGTGGGGAGTTGG + Intergenic
934078430 2:88447776-88447798 CTGAAGCAGTAGAGGGTAGTTGG - Exonic
934875592 2:97916505-97916527 CTGTGGCTGAAGAGAGAAGTGGG - Intronic
934978936 2:98824471-98824493 TTGTGACAATAGGAGGAAGTTGG - Intronic
936912249 2:117604985-117605007 CTTTTACAGTCGAGGGAACTGGG - Intergenic
939501840 2:142996537-142996559 CAGTGAAAGAAGAGGGATGTTGG + Intronic
940093835 2:149951677-149951699 ATGTGACAGTATAGGGAAGCGGG - Intergenic
940870677 2:158857732-158857754 TGGTGAAACTAGAGGGAAGTAGG + Intronic
943068412 2:183113367-183113389 TGGTGGCAGGAGAGGGAAGTTGG + Intergenic
943555193 2:189394636-189394658 CTGTTACAGTAGCCTGAAGTGGG + Intergenic
943678474 2:190742119-190742141 TTGTGACAGTATCGGGAAGTGGG + Intergenic
946328954 2:218999229-218999251 GTGTGACAGTGGAGGGACCTGGG - Intergenic
947317372 2:228875625-228875647 AAGTAACAGAAGAGGGAAGTGGG - Intronic
947331674 2:229035455-229035477 GTGTGTGAGTAGAGGGAAGGAGG - Intronic
948251865 2:236535987-236536009 CTGGGCCAGCAGAGGGAGGTGGG + Intergenic
1169288714 20:4330909-4330931 ATGTGGCAGTATTGGGAAGTAGG - Intergenic
1169498321 20:6135342-6135364 CTGTCACAGGAGAGAGAAATGGG + Intergenic
1170709654 20:18778872-18778894 CTGTCACAGTGGAGGGAAGTAGG + Intergenic
1173435457 20:43028393-43028415 CTGTGACACTTCAGGGAAGTTGG - Intronic
1174753439 20:53135280-53135302 GTGTGACTGGAGAGGGAAGCAGG - Intronic
1176261646 20:64185015-64185037 TTGTTCCAGTAGAGGGATGTGGG + Intronic
1178443354 21:32616503-32616525 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1178563822 21:33664512-33664534 CTGTGGCAGTGTAGGGAGGTGGG - Intronic
1179124107 21:38576639-38576661 CTGTGACAGCAAAGGGAGGTTGG - Intronic
1179807957 21:43852031-43852053 CTGTGACTGCGGAGGGAACTGGG - Intergenic
1179808028 21:43852404-43852426 CTGTGACTGCGGAGGGAACTGGG - Intergenic
1180200157 21:46219370-46219392 CTGTGACAGCAGAGAGGGGTGGG - Intronic
1180836156 22:18930517-18930539 CAGTGAGTGTAGAGGGCAGTTGG + Intronic
1184096356 22:42318412-42318434 CTGTGAGAGGAGAGGGGAGGAGG + Intronic
1184575354 22:45359950-45359972 CTGTGTAATTACAGGGAAGTGGG - Exonic
1184748629 22:46471780-46471802 CTGGGACAGGAGAGGACAGTGGG - Intronic
1184924223 22:47626039-47626061 CTGAGACAGGACAGGGAGGTAGG - Intergenic
1203286248 22_KI270734v1_random:155816-155838 CAGTGAGTGTAGAGGGCAGTTGG + Intergenic
949511611 3:4771486-4771508 CTTTCACAGTGGAAGGAAGTGGG - Intronic
949588183 3:5464238-5464260 CTGGGGGAGTAGAAGGAAGTGGG + Intergenic
949885736 3:8692312-8692334 TGGTGAAACTAGAGGGAAGTAGG + Intronic
950219988 3:11187173-11187195 CTTTGTCAGTAGTGGAAAGTAGG - Intronic
951699497 3:25480779-25480801 TTGTTACAGTAGAGGGTGGTGGG + Intronic
953451130 3:43007325-43007347 CTGGGACAGTTGAGGGCAGTGGG - Intronic
953479983 3:43243079-43243101 CTATGATGTTAGAGGGAAGTTGG - Intergenic
953904211 3:46860394-46860416 CAGTGACAGCAGTGGGCAGTGGG - Intronic
954002971 3:47572307-47572329 CTGTCACAGTCCAGGGAAGAAGG + Intronic
954562680 3:51571266-51571288 TTGTCACAGTAGAGGGAACAAGG - Intronic
955196119 3:56806297-56806319 GTGTCACAGTTGAGGGAAGCTGG + Intronic
955365109 3:58304142-58304164 ATGTGACAGATGAGGGAGGTAGG + Intergenic
955540738 3:59973402-59973424 CTGTGGCAGAAGAGAGAGGTTGG - Intronic
955917914 3:63925167-63925189 CTGTGAAGGAAGAGGGAAGTTGG + Intronic
955924423 3:63991510-63991532 CTGGGACAGTAGGGAGGAGTGGG + Intronic
956260153 3:67330282-67330304 CTGTGAGGGTCGAGGGAAGCAGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957043250 3:75353338-75353360 TGGTGAAACTAGAGGGAAGTAGG - Intergenic
958185254 3:90111511-90111533 CTGGTACAGTAGAGAGAAGTGGG - Intergenic
959465560 3:106682013-106682035 CTGTGGCACAAGAGGGATGTGGG + Intergenic
959870431 3:111321088-111321110 CTGTGACAGTTCAGGCAATTTGG - Intronic
960477692 3:118149486-118149508 CTGTGACAGTAGCCTGAAGAAGG - Intergenic
961273397 3:125707512-125707534 TGGTGAAACTAGAGGGAAGTAGG + Intergenic
961276154 3:125728657-125728679 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
961875335 3:130018383-130018405 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
961981519 3:131084147-131084169 CTGTGAGAGTTGAGGGGATTGGG - Intronic
962771167 3:138611600-138611622 GTGTGGCAGTATTGGGAAGTGGG + Intronic
962890357 3:139666712-139666734 CTGGTACAGTAAAGGGAGGTTGG - Intronic
963345882 3:144096259-144096281 TTATGACAGGAGAGAGAAGTAGG + Intergenic
964762265 3:160145746-160145768 ATGTGACAGAAGTAGGAAGTGGG - Intergenic
966301232 3:178481607-178481629 CTGAGACAGTAGCATGAAGTAGG + Intronic
968840032 4:2996583-2996605 CTGTGACAGTATTGGGAGGTAGG - Intronic
969026793 4:4179635-4179657 TGGTGAAACTAGAGGGAAGTAGG - Intergenic
969500077 4:7547329-7547351 CTCTGGAAGTGGAGGGAAGTGGG - Intronic
969735349 4:8985569-8985591 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
969786654 4:9463400-9463422 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
969950388 4:10829630-10829652 CAGTGACAGTATTAGGAAGTGGG + Intergenic
970912628 4:21294955-21294977 TTGTGACAGTAGAGGTAAAAAGG - Intronic
972314154 4:37909890-37909912 CTGTCACACTAGACAGAAGTTGG + Intronic
973808637 4:54549031-54549053 CTGGGACAGCCGAGGGAAGGGGG + Intergenic
975163265 4:71147907-71147929 CTGTGACTCTAGAGGGAACTGGG + Intergenic
976722102 4:88178774-88178796 CTGAGACAGTACTGGGCAGTAGG + Intronic
977809787 4:101346385-101346407 CTGTGACAGAAATAGGAAGTGGG - Intronic
977865678 4:102024517-102024539 TTGTCAGAGTAGAGGGAATTTGG + Intronic
978010323 4:103674406-103674428 CTGTGGAAATAGATGGAAGTAGG + Intronic
979362855 4:119784637-119784659 TGGTGACAGGAGAGGGAAGCAGG + Intergenic
979857840 4:125656442-125656464 CAGTGACAGAAGAGAGAAATGGG + Intergenic
981957439 4:150495156-150495178 CTGTGACAGAGGAGGAAAATGGG - Intronic
983728261 4:170958005-170958027 CTGTGACAGGAAAGGGGTGTGGG + Intergenic
985126690 4:186701681-186701703 CTGTGACAGGAGAAGGAATGTGG - Intronic
985192659 4:187393139-187393161 CGGTGGCTGAAGAGGGAAGTCGG - Intergenic
987873722 5:23652442-23652464 CTTTGACAGTAGACTGAAATAGG + Intergenic
988399742 5:30747516-30747538 CTGTGGCAATAGAGGGAAATAGG - Intergenic
989723315 5:44554991-44555013 CTGTGAAAACAGAGGGAATTAGG + Intergenic
991996321 5:72390680-72390702 CTGTTACAGAAGAGAGAACTGGG + Intergenic
993810965 5:92475064-92475086 ATGTGGCAGTATTGGGAAGTGGG + Intergenic
993846682 5:92953280-92953302 CTGTGGTAGTAGAGGTAGGTTGG + Intergenic
994177325 5:96725090-96725112 CTGTGAAACTGGAGGAAAGTAGG + Intronic
995126509 5:108581990-108582012 CAGTGATAGTATAAGGAAGTGGG - Intergenic
995204031 5:109458397-109458419 CTTTGACAGTTGAGAGAAGAAGG + Intergenic
996102659 5:119460180-119460202 ATGTGACAGTATAGAGATGTGGG - Intronic
996421296 5:123265853-123265875 CTGAGACAGCAGACGTAAGTTGG - Intergenic
997942223 5:138168512-138168534 CTCTGACAGCAGAGGGGAGGGGG + Intronic
998502519 5:142645841-142645863 CAGTGACTGTGGAGGGAGGTTGG - Intronic
999175583 5:149629554-149629576 CAGTGACAGGAGAGGGCAGGAGG + Intronic
999186040 5:149709699-149709721 CTGTGGCAGTGGAGGTAAGTGGG + Intergenic
999326713 5:150648638-150648660 CTGTGCCATTAGATGGGAGTTGG - Exonic
1000707172 5:164526327-164526349 CTGTGATAGCAGAGTGAAGAGGG - Intergenic
1000735266 5:164891376-164891398 CTCTGACAGTACTGGGAAGCAGG - Intergenic
1001027307 5:168235010-168235032 CAGTGACAGAGGAGGGAGGTGGG + Intronic
1001701065 5:173706759-173706781 GTGTGACAGTATTAGGAAGTGGG - Intergenic
1002076690 5:176712639-176712661 CTGGGGCAGGAGAGGGAGGTGGG + Intergenic
1004675740 6:17840313-17840335 ATGTGATAATAGAGGCAAGTAGG + Intronic
1006193693 6:32224180-32224202 CTGGGGAAGTAGGGGGAAGTAGG + Intergenic
1007018750 6:38497275-38497297 CTGTGACAGCAGTGGGAGGTGGG - Intronic
1007833410 6:44655958-44655980 CAGGGACAGAAGACGGAAGTGGG + Intergenic
1009291129 6:61884060-61884082 TTTTGACAGGAGAGGGAAATAGG - Intronic
1009457236 6:63871788-63871810 CTTTGTCAGTAGAGGGCACTTGG + Intronic
1011823217 6:91276516-91276538 CTTTGCCACTAGAGGGAAGAAGG + Intergenic
1012212139 6:96532456-96532478 ATGTGGCAGTATTGGGAAGTAGG + Intronic
1013302545 6:108818103-108818125 CTGTGACAGAAGAAGGACCTGGG - Intergenic
1013345471 6:109256018-109256040 CTTTGAGGGTAGAGGAAAGTGGG + Intergenic
1017817568 6:158026819-158026841 CTGTGTCAGAAGAGGCAGGTGGG + Intronic
1020290367 7:6718281-6718303 CTGGGACAGCAGAGGAAGGTGGG - Intergenic
1020310437 7:6863496-6863518 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1027344691 7:77245791-77245813 ATGTGACAGAAGAGGCATGTAGG + Intronic
1028578593 7:92380905-92380927 CTTTGACAGTTGACAGAAGTAGG + Intronic
1029077140 7:97943825-97943847 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1029788971 7:102822557-102822579 CTGTGACAGTAATAGAAAGTGGG - Intronic
1030161407 7:106512166-106512188 CTGAGACAGTCTGGGGAAGTGGG - Intergenic
1030422231 7:109321998-109322020 ATGTGAGAGTAGAGTGAAGCAGG + Intergenic
1031666499 7:124490292-124490314 CTGTGGCAATAGAGTGAACTTGG - Intergenic
1033108747 7:138556537-138556559 CTGTGAATGTAGGGGGAAATAGG + Intronic
1033879949 7:145868987-145869009 CTGTGATGGTAGAGGCAGGTTGG + Intergenic
1034280010 7:149846751-149846773 CTGTGGGAGAAGAGGGAGGTGGG + Intronic
1035390804 7:158503332-158503354 CTGTGAGGGTAGAGAGAAGCTGG - Intronic
1036240645 8:7078121-7078143 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1036261410 8:7243457-7243479 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1036305189 8:7596099-7596121 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1036313450 8:7702001-7702023 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1036356039 8:8044095-8044117 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1036737668 8:11332093-11332115 CTGTGAGAGGACAGGGAAGGTGG + Exonic
1036766891 8:11555056-11555078 CTGAGCCAGGAGAGGGAATTAGG - Intronic
1037670664 8:21012687-21012709 ATGTCACAGAAGAGGGAAGCAGG - Intergenic
1038214737 8:25551149-25551171 CTGTGACAGCAGTAGGAGGTGGG - Intergenic
1038699310 8:29835287-29835309 ATGTTACAGTAGAGGGAGATGGG + Intergenic
1039300713 8:36205736-36205758 CTGTGAAGGTAGAGGCAAGATGG + Intergenic
1039343888 8:36682547-36682569 TTGAGACTGAAGAGGGAAGTTGG + Intergenic
1041055277 8:53979465-53979487 CTGTGACACTAGAAGCAAGATGG - Intronic
1041306011 8:56461735-56461757 CTGTGAAAGTAGAAGGAAGTGGG - Intergenic
1041719053 8:60960003-60960025 ATGTGACAGTGTTGGGAAGTAGG - Intergenic
1042108869 8:65357557-65357579 GTATGACAGTAGAAGGCAGTGGG - Intergenic
1043387397 8:79761787-79761809 CTTTGACAGATGAGGAAAGTGGG + Intergenic
1044722064 8:95160293-95160315 TGGTGACAGTAGAGGGTGGTGGG - Intergenic
1045046040 8:98279517-98279539 CAGTGAAAGGACAGGGAAGTGGG - Intronic
1045794038 8:106021682-106021704 ATGTGACAGTACATGGAGGTAGG + Intergenic
1046737499 8:117792724-117792746 CTGTGACACTAGAGGGACCACGG + Intergenic
1046763006 8:118040994-118041016 CTTTGCCAGTAGATGGAATTAGG + Intronic
1047158944 8:122354619-122354641 CTGTTACATGAGAGAGAAGTGGG - Intergenic
1048704156 8:137131661-137131683 CTGTAACACTAGAGGAAGGTAGG - Intergenic
1049306067 8:141904978-141905000 CTGAGACATAGGAGGGAAGTGGG - Intergenic
1050308171 9:4327245-4327267 CTGAGAGAGCAGAGGGAGGTGGG + Intronic
1051082147 9:13306520-13306542 CTTTGACAGTTGAGAGAAGAAGG - Intergenic
1053022633 9:34706274-34706296 CAGTGACAGGAGAGGAGAGTTGG + Intergenic
1056863739 9:90211397-90211419 TGGTGAAACTAGAGGGAAGTAGG + Intergenic
1056900867 9:90598091-90598113 CAGTGACAGTTGAGGAAACTGGG + Intergenic
1056916169 9:90748047-90748069 TGGTGAAACTAGAGGGAAGTAGG - Intergenic
1057189832 9:93080660-93080682 CTCTGACAGTGGAGGGACCTGGG - Intronic
1058768710 9:108209273-108209295 CTTTTACAGAAGAGGGAAGTGGG - Intergenic
1059430553 9:114247660-114247682 CTTGGACAGTAGCGGGAAGGAGG + Intronic
1059494946 9:114701748-114701770 CAGTGAAAGTAGTGGGAGGTGGG - Intergenic
1061667017 9:132166487-132166509 TTGTGACAGTGGATGGAAATGGG - Exonic
1186233382 X:7480223-7480245 CTGTGGCAGCAAAGGGAAGTTGG + Intergenic
1186526953 X:10257577-10257599 CTGGGAGGGTAGAGGGATGTTGG + Intergenic
1188801830 X:34541720-34541742 CTGAGAGAGTGGAGGGAAGTTGG - Intergenic
1190658940 X:52637137-52637159 CCTTGACAGTAGAGGAAAATAGG - Intergenic
1196015623 X:110937437-110937459 GTGTGTCAGTATTGGGAAGTGGG + Intergenic
1197362234 X:125519217-125519239 CTGTGAAAGTACATGGAAGAAGG - Intergenic
1197882135 X:131178066-131178088 CTGGGACATAAGTGGGAAGTGGG + Intergenic
1198480097 X:137033234-137033256 CGGTGACAGCCGAGGGGAGTGGG + Intergenic
1199734873 X:150676432-150676454 CTGGGCCAGTATAGGGAACTAGG + Intergenic