ID: 1126572285

View in Genome Browser
Species Human (GRCh38)
Location 15:50164903-50164925
Sequence GAGGAGAGCACAGTGATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 574
Summary {0: 1, 1: 7, 2: 40, 3: 113, 4: 413}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126572285_1126572294 30 Left 1126572285 15:50164903-50164925 CCTACAATCACTGTGCTCTCCTC 0: 1
1: 7
2: 40
3: 113
4: 413
Right 1126572294 15:50164956-50164978 AAGGCTTCTGCCAGGGTATTTGG 0: 1
1: 0
2: 1
3: 11
4: 161
1126572285_1126572289 11 Left 1126572285 15:50164903-50164925 CCTACAATCACTGTGCTCTCCTC 0: 1
1: 7
2: 40
3: 113
4: 413
Right 1126572289 15:50164937-50164959 GACTCTTTCTCCATGCCATAAGG 0: 1
1: 0
2: 3
3: 35
4: 164
1126572285_1126572291 22 Left 1126572285 15:50164903-50164925 CCTACAATCACTGTGCTCTCCTC 0: 1
1: 7
2: 40
3: 113
4: 413
Right 1126572291 15:50164948-50164970 CATGCCATAAGGCTTCTGCCAGG 0: 1
1: 0
2: 0
3: 23
4: 213
1126572285_1126572292 23 Left 1126572285 15:50164903-50164925 CCTACAATCACTGTGCTCTCCTC 0: 1
1: 7
2: 40
3: 113
4: 413
Right 1126572292 15:50164949-50164971 ATGCCATAAGGCTTCTGCCAGGG 0: 1
1: 0
2: 1
3: 21
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126572285 Original CRISPR GAGGAGAGCACAGTGATTGT AGG (reversed) Intronic
901197474 1:7448180-7448202 GAGGAGGGCACAAAGATTGATGG + Intronic
901955878 1:12785167-12785189 CAGGAGAGCAGGGTGATAGTGGG + Intergenic
901979251 1:13021215-13021237 CAGGAGAGCAGGGTGATAGTGGG + Intronic
902002831 1:13207723-13207745 CAGGAGAGCAGGGTGATAGTGGG - Intergenic
902022059 1:13353487-13353509 CAGGAGAGCAGGGTGATAGTGGG - Intergenic
902157696 1:14502950-14502972 CAGGAGAGAAGAATGATTGTGGG - Intergenic
903198212 1:21709688-21709710 GAGGAGACCACAGACACTGTGGG + Intronic
903558992 1:24214011-24214033 GAGGGGAGCAAGGTGAATGTGGG - Intergenic
905380766 1:37559890-37559912 CAGGAGAGCAGGGTGATAGTGGG + Intronic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
905890844 1:41517416-41517438 GAGGAGAACACAGTGAACTTGGG - Intronic
906787794 1:48630948-48630970 GAGTAAAGCACAGGGGTTGTGGG - Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907911904 1:58834346-58834368 GAGGGAAGCACAGGGATTGTGGG + Intergenic
908022732 1:59915127-59915149 CAGGAGAGCAGAGTGATAGTGGG - Intronic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910476836 1:87616518-87616540 TGGGAGAGCAGAGTGATTATAGG + Intergenic
910485582 1:87709967-87709989 GAGGAGAACACAATGAATTTGGG + Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911019729 1:93374634-93374656 GGGGAGAGCACAGTTATTATGGG + Intergenic
911239520 1:95449694-95449716 AAAGAGAGCACAGTGCTTGTGGG - Intergenic
911280722 1:95924724-95924746 TAGGTGACCACAGTGAGTGTAGG - Intergenic
912583924 1:110744605-110744627 GAAGAGAGAAAAGTGGTTGTGGG + Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915185825 1:154104529-154104551 CTGGGGAGTACAGTGATTGTGGG + Intronic
915578368 1:156796831-156796853 GAGATGGGCACAGGGATTGTGGG + Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916345630 1:163788149-163788171 GAGGAGAGCACAGTCAATGCAGG - Intergenic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
916868861 1:168890008-168890030 GAGGAGAACACAGTAAGTCTGGG + Intergenic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918402634 1:184178720-184178742 AAGGAGATCAGAGGGATTGTTGG - Intergenic
918907623 1:190518369-190518391 GAAGAGAGAAAAGTGATTTTTGG - Intergenic
919098785 1:193068186-193068208 AAGGAGAGCACCATGATTATTGG + Intronic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
919713319 1:200750118-200750140 GCGGGGAGCAGAGTGAATGTGGG + Intronic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
921073513 1:211682005-211682027 GGGGGCAGCACAGTGATGGTAGG + Intergenic
921797312 1:219361497-219361519 GTGGAGAGCTCAGAGAATGTAGG + Intergenic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
923646804 1:235830830-235830852 GAGGATGGGTCAGTGATTGTGGG - Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067143604 10:43677075-43677097 GAGGGGTGCAGAGTGCTTGTTGG + Intergenic
1067324464 10:45253729-45253751 GAGGAGAGCACAGTGATTGGAGG + Intergenic
1068064690 10:52114605-52114627 GAGAAGTGCACAATAATTGTTGG + Intronic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069729121 10:70599806-70599828 GAGAAAGGCACAGTGTTTGTAGG - Intronic
1069734889 10:70647569-70647591 AAGGAGAGCACTGTGCATGTGGG - Intergenic
1070313864 10:75293311-75293333 GAGGAGGGCAAGGTCATTGTGGG + Intergenic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072717537 10:97761594-97761616 GAGGAAAGCACAGTGAGCCTGGG - Intergenic
1074309850 10:112312720-112312742 GAGGAGGAAACAGTGACTGTGGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075903307 10:126060802-126060824 CAGGAGTGCACAGGGACTGTGGG + Intronic
1076376709 10:129993146-129993168 AAGGAAAGCACGGTGATTGTGGG + Intergenic
1076820292 10:132935332-132935354 GAGGAGATCACAGTGGGTTTGGG - Intronic
1076820301 10:132935368-132935390 GAGGAGATCACAGTGTGTTTGGG - Intronic
1076820325 10:132935512-132935534 GAGGAGATCACAGTGTGTTTGGG - Intronic
1076820337 10:132935584-132935606 GAGGAGATCACAGTGGGTTTGGG - Intronic
1076820346 10:132935620-132935642 GAGGAGATCACAGTGTGTTTGGG - Intronic
1076820364 10:132935727-132935749 GAGGAGATCACAGTGTGTTTGGG - Intronic
1076820369 10:132935763-132935785 GAGGAGATCACAGTGTGTTTGGG - Intronic
1076820381 10:132935834-132935856 GAGGAGATCACAGTGTGTTTGGG - Intronic
1076820413 10:132936013-132936035 GAGGAGATCACAGTGTGTTTGGG - Intronic
1076820442 10:132936156-132936178 GAGGAGATCACAGTGTATTTGGG - Intronic
1076820450 10:132936192-132936214 GAGGAGATCACAGTGTGTTTGGG - Intronic
1076820483 10:132936370-132936392 GAGGAGATCACAGTGTGTTTGGG - Intronic
1076820501 10:132936477-132936499 GAGGAGATCACAGTGTGTTTGGG - Intronic
1076820510 10:132936513-132936535 GAGGAGATCACAGTGTATTTGGG - Intronic
1076820518 10:132936549-132936571 GAGGAGATCACAGTGTATTTGGG - Intronic
1076820526 10:132936585-132936607 GAGGAGATCACAGTGTATTTGGG - Intronic
1077476449 11:2792620-2792642 GCGGAGGGCACAGCGGTTGTGGG + Intronic
1077703219 11:4460685-4460707 CAGGAGAGCAGGGTGATAGTGGG + Intergenic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1078475226 11:11623413-11623435 GAAGAGAGAACAGTGGGTGTGGG + Intergenic
1078843194 11:15097726-15097748 AGGGAGAGCACAGTCATCGTGGG - Intergenic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1079844356 11:25446173-25446195 GAGCAGAGCATAGTGATGTTTGG + Intergenic
1080396810 11:31897809-31897831 GAGGAGAGCTCAGTTAGTGTGGG - Intronic
1080600522 11:33817646-33817668 GCATAGAGCACAGTCATTGTGGG + Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081724480 11:45318474-45318496 GAGGTGAGCACAGTTAATATGGG + Intergenic
1082835153 11:57646077-57646099 AAGGAGAAAGCAGTGATTGTAGG + Intronic
1083375467 11:62216701-62216723 TAGGAGAGCAGGGTGATAGTGGG - Intergenic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1084426510 11:69087078-69087100 GAGGAGTGGCCAGTGAGTGTGGG - Intronic
1084799762 11:71535455-71535477 CAGGAGAGCAGGGTGATAGTGGG - Intronic
1085184271 11:74562172-74562194 GAGGAAAGCACAGAGTCTGTGGG - Intronic
1085260872 11:75203981-75204003 GAGGAGGGCACAGTTTCTGTGGG + Intronic
1085912613 11:80846254-80846276 GAGGAGAAGACAGTCAATGTGGG + Intergenic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1086648060 11:89249534-89249556 GAGGAGAGAAAAGTACTTGTTGG + Intronic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1086878225 11:92123776-92123798 GAGGCAAGCACAGAGCTTGTAGG + Intergenic
1087473098 11:98601647-98601669 AAGGAAAGCACAATGATTGTAGG - Intergenic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1090028604 11:123188390-123188412 GAGGAAGGCACAGAGACTGTAGG - Intronic
1090292298 11:125555928-125555950 AAGGAGAGCACTGTGCATGTGGG - Intergenic
1091013779 11:132030783-132030805 GATGAGAGCAGAGAGATAGTGGG + Intronic
1091412691 12:254470-254492 GAGGAAAGGAAATTGATTGTTGG - Intronic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094026427 12:25964110-25964132 GAGGAGAGGAAAGTTATGGTTGG + Intronic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1095196362 12:39323266-39323288 CAGGAGAGCACAGTAAATGTTGG - Intronic
1095535469 12:43240877-43240899 GAGTAGAGGACAGTGGTTGATGG + Intergenic
1095625001 12:44304194-44304216 GAGGAGAGCACAGTGACTATGGG + Intronic
1095709466 12:45273116-45273138 GAGAATAGAACAGTGATTGCCGG + Intronic
1095874798 12:47068623-47068645 GATGAGAGCACAGGGAGTGTGGG + Intergenic
1097268726 12:57761110-57761132 GAGGAGACCATACTGATTGCTGG - Intergenic
1098100201 12:67007127-67007149 GAGGAGAGCACAGTGGTGATGGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099278893 12:80617067-80617089 CAGCAGAGCACAGTGATTAAAGG + Intronic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1101552027 12:105772193-105772215 GGGAAGAGCTCAGCGATTGTTGG - Intergenic
1103346243 12:120252248-120252270 GAGAACAGCACAGTGCTTGGTGG + Intronic
1107616787 13:42177210-42177232 GAAGTCAGCACAGTGATTATTGG - Intronic
1107722979 13:43268291-43268313 GTGGAAAGCACAGTGATTTCAGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108972926 13:56400619-56400641 AAGGAGATCACAATGATTGTGGG + Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110092541 13:71471142-71471164 GATGGGAGCACAGAGATTGGAGG + Intronic
1110710691 13:78647553-78647575 TAGGAGAGCAGGGTGATAGTGGG - Intronic
1110901401 13:80830356-80830378 AGGGAGAGCACAATGATGGTGGG + Intergenic
1111073659 13:83204075-83204097 GAGCAAAGCACAATGATTGAAGG + Intergenic
1111351813 13:87041235-87041257 AAGGAGAGCACTGTGCATGTGGG - Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1114303037 14:21395306-21395328 GAGGAGATCTCAGTGATTGATGG - Exonic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116481341 14:45394335-45394357 CAGGAGAACAGAGTGATGGTGGG - Intergenic
1116541806 14:46109268-46109290 CTGAAGAGCACAATGATTGTGGG + Intergenic
1116583586 14:46674299-46674321 GAGGGAAGCACAGTGATTGAAGG + Intergenic
1116765844 14:49069923-49069945 GGGGAAAACACAGTGACTGTGGG + Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1119671907 14:76526467-76526489 GAGGAGAACACAGGGCTTCTGGG - Intergenic
1122543839 14:102511540-102511562 GGGGAGAGCAAAGTGAGTGAAGG + Intergenic
1122572971 14:102720548-102720570 GTGGACAGCACAGTGATCTTGGG + Intronic
1122997656 14:105274235-105274257 CAGGAGAGCAGGGTGATAGTGGG - Intronic
1124974867 15:34522358-34522380 GAGGGGAGCACAGTGCCTGCTGG + Intergenic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127147815 15:56042973-56042995 GGGGAGAGCCCAGTGGTGGTGGG - Intergenic
1127635133 15:60861900-60861922 GAGGAGAGCCCAGTGACCTTAGG - Intronic
1128757865 15:70195660-70195682 GAGGACAGCACAGGGTTTCTGGG + Intergenic
1129856717 15:78830338-78830360 GAGCAGACCACAGTGAAGGTGGG + Intronic
1130275806 15:82475842-82475864 AAGGAGACCACAGTGCTTGCTGG + Intergenic
1130468165 15:84203234-84203256 AAGGAGACCACAGTGCTTGCTGG + Intergenic
1130496099 15:84470308-84470330 AAGGAGACCACAGTGCTTGCTGG - Intergenic
1130590458 15:85207832-85207854 AAGGAGACCACAGTGCTTGCTGG + Intergenic
1130963065 15:88677487-88677509 GATGAGAGCAGAGTGAATGCAGG - Intergenic
1131198147 15:90373485-90373507 GAGGAGCACAGAGTGGTTGTGGG + Intergenic
1131944800 15:97608397-97608419 AAGGAAAGTGCAGTGATTGTGGG + Intergenic
1134407164 16:13970585-13970607 TGGGACAGCACAGTGATTGCAGG - Intergenic
1135423243 16:22318440-22318462 GAGCAGAGCACAGTGATTGAGGG + Intronic
1136223660 16:28844720-28844742 GAGGAGACCCCAGTCATCGTAGG - Exonic
1137442023 16:48505952-48505974 CAGGAGAGCACAGGGAAGGTAGG + Intergenic
1138543001 16:57699703-57699725 GAGGAGAGCACAGTGCTCCCAGG + Intronic
1138748312 16:59389413-59389435 AAGGAGGGCACAGTGCATGTGGG - Intergenic
1139354593 16:66360047-66360069 GTGGAGAGCACAAGGAATGTAGG + Intergenic
1143022124 17:3922173-3922195 GAGGAGTGCTCAGTGTTTGGGGG - Intergenic
1143162795 17:4882201-4882223 GAGCAGAGCACAGTGAGAGGAGG - Intronic
1143306662 17:5952814-5952836 GAGGAGAGCAGAGAGAGAGTTGG + Intronic
1143319119 17:6056552-6056574 GAGGAGAGGACAGTGAGCCTGGG + Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1144517612 17:15929506-15929528 GAGGAGAGCACAGTGCTCCTTGG - Intergenic
1144752976 17:17662828-17662850 GAGGAGGGCACAGAGAGTGATGG - Intergenic
1144836375 17:18158627-18158649 GAGGAGACCCCAGTGAGTGGCGG + Exonic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145722168 17:27083384-27083406 GAGGAGACCCCAGTCATTGTAGG - Intergenic
1145857369 17:28174099-28174121 GAGCAGTGCACAGTGACTTTTGG - Intronic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146242678 17:31244616-31244638 ACGGACAGCACAGTGATTATGGG - Intronic
1148774056 17:50084541-50084563 GAGGACTGCACAGTCATTGAAGG - Intronic
1149027265 17:52041723-52041745 GAGCAGAGCACAGTGAAAATGGG - Intronic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1150389955 17:64784393-64784415 GAGGAGGGCACGGGGATTGGGGG + Intergenic
1150538247 17:66067907-66067929 GAGGATAGAACGGTGCTTGTGGG - Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1150940576 17:69688868-69688890 GAGGAGAGAATAATGATGGTTGG + Intergenic
1153202102 18:2656531-2656553 GTGGAGAGCTCAGCGTTTGTTGG + Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153945570 18:10014311-10014333 GAGGAGGGCACTGTGACTGCAGG + Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1156495281 18:37521351-37521373 GAGGAGAGAATAGAGAGTGTGGG - Intronic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159285042 18:66337554-66337576 GGGAAGAGCTCAGTGACTGTGGG - Intergenic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159490659 18:69129517-69129539 GAGGGACGCACAGTGATTATGGG - Intergenic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1161466238 19:4432196-4432218 GAGACGAGCAGAGTGAGTGTGGG + Exonic
1163185550 19:15636616-15636638 GGAGAGAGCACAGTGATCATGGG - Intronic
1165111527 19:33505239-33505261 GTGGAGAGCAGAGTGAGAGTCGG - Intronic
1167212471 19:48141954-48141976 GATGAGAGCATAGTGAATGAAGG + Intronic
1167515776 19:49922415-49922437 GAGGGGAGGACAGTGTTTCTGGG - Intronic
1167568552 19:50272364-50272386 GAGGAGAGGACAGTGCGTCTAGG + Intronic
925484838 2:4316526-4316548 AAGGACAGTACAGTAATTGTGGG - Intergenic
926443221 2:12911791-12911813 GAGGAGCACACAGTGACTTTTGG - Intergenic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928574055 2:32636919-32636941 GAGGACAGCATAGTGTTTGTGGG + Intronic
928726328 2:34178034-34178056 AAGGAGACCACAGCTATTGTGGG + Intergenic
929182620 2:39059742-39059764 GTGGAGAACACAATGATTCTTGG + Intronic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
932101144 2:68900382-68900404 AAGGACAGCAAGGTGATTGTAGG + Intergenic
934197166 2:89848189-89848211 GGAGAGAGCACAGGGAATGTAGG - Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935132413 2:100270577-100270599 CAGGAGAGCAGGGTGATAGTGGG - Intergenic
935478621 2:103557353-103557375 GGGGAGAACACAGTGATAATGGG - Intergenic
936038991 2:109134979-109135001 GAGGAGAGCACAGAGCTGCTGGG - Intronic
937530142 2:122818417-122818439 GAGGTGAAGACAGTGATTGAAGG - Intergenic
940358290 2:152769295-152769317 CAGGAGAGCAGGGTGATAGTTGG + Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941729106 2:168896132-168896154 GAGGAGAGAACAGAGAGAGTGGG + Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942972378 2:181971868-181971890 AAGGAGAGCAAAGGGATTGTGGG - Intronic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944753546 2:202736316-202736338 GATGAGAGGACAGTGATTGCTGG + Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
946167391 2:217873335-217873357 GTGGAGAGCACGGTGTTTGGTGG + Intronic
946204776 2:218096287-218096309 TAGGAGAGCAGGGTGATAGTGGG - Intergenic
946253942 2:218429976-218429998 GAGGAGGGCAGAGTGATGGGAGG + Intronic
946897721 2:224341345-224341367 CATGAGAACACAGAGATTGTGGG - Intergenic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
947551124 2:231047567-231047589 GAGGGGGTCACAGTGACTGTGGG + Exonic
948475616 2:238217116-238217138 GGAGAGAACACAGTGATTGTGGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168866025 20:1087327-1087349 GAGGAGGGAACAGTGCCTGTAGG + Intergenic
1168900046 20:1355541-1355563 GAAGAGAGCACAGTGATTGTGGG - Intronic
1168985459 20:2044675-2044697 GAGAAGCTCACAGTGATTTTGGG - Intergenic
1169015800 20:2291758-2291780 GGGGAGAACACAATCATTGTTGG + Intergenic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170397810 20:15946883-15946905 CAGGAGAGCAGGGTGATAGTGGG + Intronic
1170561882 20:17565698-17565720 GAGGAGAGGACTGGGATTATGGG + Intronic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171433928 20:25104625-25104647 CAGGAGAGCACAGGCAATGTGGG + Intergenic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1171959355 20:31482718-31482740 CAGGATAGCACAGAGACTGTAGG - Intronic
1172054781 20:32146579-32146601 GAGGAGAGCACAGAGCATGGAGG - Intronic
1173462502 20:43254536-43254558 GTGAAAAGCACAGTGCTTGTAGG - Intergenic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1174998499 20:55599914-55599936 GTGGAAAACACAGTGATGGTGGG + Intergenic
1175485970 20:59346558-59346580 GAGGAGAGGGCTGTGCTTGTGGG - Intergenic
1176113171 20:63419681-63419703 GAGGAGAGCACAGTTAGTCCTGG + Intronic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1177212830 21:18091473-18091495 GAGGAGAGCAAAGTGTATGGAGG + Intronic
1179543712 21:42100783-42100805 GAGGAGGGCACAGGGTTGGTGGG - Intronic
1179603586 21:42497028-42497050 GAGGAGAGGACGGCGATCGTAGG - Intronic
1180177093 21:46096147-46096169 GAGGAGCCGACAGTGACTGTGGG - Intergenic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1182389373 22:29978957-29978979 GGAGAGAGCACAGAGTTTGTGGG + Exonic
1183058365 22:35320485-35320507 GAGGAGGCCACACTGAGTGTGGG - Intronic
1184313453 22:43664170-43664192 GAGAAGAGCACAGGGGTTGGAGG + Intronic
1185053776 22:48567479-48567501 AAGGAGAGCAGGGTGATCGTGGG + Intronic
1185219925 22:49624108-49624130 GGGGAGGGCACAGTGATGCTCGG + Intronic
1185219934 22:49624146-49624168 GGGGAGGGCACAGTGATGCTCGG + Intronic
1185219941 22:49624184-49624206 GGGGAGGGCACAGTGATGCTCGG + Intronic
1185219969 22:49624299-49624321 GGGGAGGGCACAGTGATGCTCGG + Intronic
1185219978 22:49624337-49624359 GGGGAGGGCACAGTGATGCTCGG + Intronic
1185219988 22:49624376-49624398 GGGGAGGGCACAGTGATGCTCGG + Exonic
1185219995 22:49624415-49624437 GGGGAGAGCACAGTGATGCTCGG + Exonic
1185285740 22:49999374-49999396 GAGGGGAGCACAGGGATGGGTGG - Intronic
949216829 3:1580968-1580990 TAGCAGAGCTCAGTTATTGTGGG - Intergenic
949978377 3:9481605-9481627 GAGGAGAGCATAGTCATTGAAGG + Intergenic
950777763 3:15365174-15365196 GAAGAGAGCCCAGTGGTGGTGGG + Intergenic
950931788 3:16797292-16797314 GAGGAGGGCAGAGTTATTGCAGG - Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951127607 3:19002162-19002184 GAGGAGGGCTCAGTGCTTCTTGG - Intergenic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952683366 3:36121723-36121745 AAGGAGAGCAAAGTGAGTGTGGG + Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
954030925 3:47819417-47819439 GAAGAGAGCACAGCACTTGTGGG - Intronic
954137361 3:48588193-48588215 TAGGCGAGGACAGTGATGGTGGG - Intronic
955521172 3:59777020-59777042 GACGAGAGCACAGTGAGCATGGG - Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
956245601 3:67179087-67179109 GAGGAGGGCACAATTATTATTGG - Intergenic
956481860 3:69681184-69681206 GAGGAGAGCAAAGAGAGTGAGGG - Intergenic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
956868569 3:73393394-73393416 GAGGTGAGCACAGAAATTGAGGG + Intronic
957219061 3:77358905-77358927 AAGATGAGCACAGTCATTGTAGG + Intronic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957729230 3:84110976-84110998 CAGGACAGCACAGTGATGGGGGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959791539 3:110367811-110367833 CAGGAGAACAGAGTGATAGTGGG - Intergenic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960052124 3:113249088-113249110 GAGGAGAGCAGGGTGATTGCAGG + Intronic
960298188 3:115968999-115969021 AAGGTGAGCTCAGTGATTGTAGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
961044194 3:123697636-123697658 GTGGACAGTACAGTCATTGTTGG + Intronic
961644302 3:128384441-128384463 GACCAGAGCAGAGTGAGTGTGGG + Intronic
961779093 3:129311125-129311147 GAGCTGAGCACAGGGACTGTTGG - Intergenic
962282714 3:134064372-134064394 GTGGGGAGCACAGTCATGGTGGG + Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964179222 3:153864281-153864303 AAGGAAAGCACAGTGATTTAGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964349690 3:155790661-155790683 GGGGAGAGTACATTGATTATGGG + Intronic
964432078 3:156617817-156617839 GGGCAGAGCACAGGAATTGTTGG + Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
966328905 3:178789597-178789619 GAGAAGAGCACAGTGATTGTGGG + Intronic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
966771854 3:183511141-183511163 TAGGAGAGCAGGGTGATAGTGGG + Intronic
967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968150700 3:196335207-196335229 GAGGAGTGCACAGGGAGAGTGGG + Intronic
969601721 4:8180235-8180257 GAGCAGTGCCCAGTGAATGTGGG + Intergenic
970170136 4:13281253-13281275 GAGGAGAGCTCAGTCTCTGTGGG - Intergenic
970363688 4:15336788-15336810 GAGGAGAGGACATTGATTCTTGG - Intergenic
971616800 4:28800915-28800937 TTGGAGATCACAGTGATAGTAGG - Intergenic
971763727 4:30802915-30802937 GAGGAGAGCAAACAGATGGTAGG + Intronic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972380264 4:38512823-38512845 GAGGAAAGCACAGTGAGTTTGGG - Intergenic
972579054 4:40379169-40379191 GAGGACAGTGCAGTGATTATGGG + Intergenic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
976082940 4:81376033-81376055 GGGGAGGGCACAGCGATTGTGGG - Intergenic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
978055793 4:104264375-104264397 CAGAAGAGCACAGTGAATGAGGG - Intergenic
978352835 4:107838257-107838279 GATGAGAACACAATGTTTGTTGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979015644 4:115430006-115430028 TAGGAGAGAACAGTAATTGAAGG - Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
982117933 4:152113408-152113430 GAGGAGAGGAGAGTGATGGAGGG + Intergenic
982690019 4:158538051-158538073 CAAGAGAGAACAGTGTTTGTAGG + Intronic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
985688027 5:1292363-1292385 GAGGAAGGGACAGTGTTTGTGGG - Intronic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986984456 5:13484558-13484580 GCGGAGGGCACAGTGTTTGCTGG - Intergenic
988265427 5:28942666-28942688 TGGGAGAGCACAGTTATTGTGGG - Intergenic
988384075 5:30539155-30539177 GAGAAGAGTACAGTGATTGCAGG + Intergenic
992179962 5:74185969-74185991 GTGGAGAGGACAGGGCTTGTCGG + Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994534111 5:101006409-101006431 CAGGAGAGCAGGGTGATAGTGGG + Intergenic
995147001 5:108797540-108797562 AAAGAGAGCACTGTGATTGTGGG - Intronic
995401200 5:111743875-111743897 GTGGATAGCACAGTAATTTTTGG - Intronic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
996906691 5:128608971-128608993 AAGAACAGCACAGTGACTGTGGG - Intronic
997511859 5:134459708-134459730 GAGGGGAGCTCAGGGACTGTTGG - Intergenic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1002073130 5:176692521-176692543 GTGAAGAGGACAGGGATTGTGGG + Intergenic
1003553444 6:7119602-7119624 GAGAAAAGCACAGTGTTTGGAGG + Intronic
1005430210 6:25748702-25748724 TAGGAGAGCAGGGTGATAGTGGG + Intergenic
1006348507 6:33502973-33502995 GAGGAGGGGACAGTGTTCGTTGG - Intergenic
1006377517 6:33679821-33679843 GAGGAGAGCCCAGGGCTTGCTGG + Intronic
1006792904 6:36715436-36715458 GAGGGGAGCACAGTGGTGTTGGG - Intronic
1007533880 6:42567055-42567077 GTAGAGAAAACAGTGATTGTAGG + Intronic
1009373629 6:62939374-62939396 AAGGAGAGCACAGTGATGGCAGG - Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1011426264 6:87234683-87234705 GAGGAAAACAAAGGGATTGTAGG + Intronic
1012059769 6:94463420-94463442 AAGGAAAGCTCAGTGATTGTGGG - Intergenic
1012072428 6:94639879-94639901 GAGGAGAGCCCAGGGACTGCAGG + Intergenic
1012875545 6:104721355-104721377 GAGGAGAGGGGAGTGATGGTGGG + Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013293886 6:108741748-108741770 GAGGAGAGAACGGTGATCCTGGG + Intergenic
1014430536 6:121365379-121365401 GGAGAGAGCACAGCAATTGTGGG + Intergenic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1016031097 6:139339098-139339120 GAGAAGAGCTCAGTGTTTCTTGG + Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016185774 6:141196251-141196273 GAGGAGAGCAGAGGGATTAGTGG - Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1021133845 7:16943012-16943034 GGGCAGAGCACAGTGCTTGCAGG + Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021436665 7:20625114-20625136 GAGGTGAGGAAAGGGATTGTAGG + Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022886104 7:34645492-34645514 GAGGAGAGCACAGGTTTTGGTGG + Intergenic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1024981315 7:55159596-55159618 GTGAAGAGCACAGTGAGTGTGGG - Intronic
1025908835 7:65811118-65811140 CAGGAGAGTACTGTGAATGTGGG + Intergenic
1025980033 7:66397810-66397832 CAGGAGAGTACTGTGAATGTGGG - Intronic
1026043502 7:66888322-66888344 CAGGAGAGTACTGTGAATGTGGG + Intergenic
1026399637 7:69996550-69996572 GTGGGGAGGACAGTGTTTGTAGG - Intronic
1027204909 7:76090149-76090171 CAGGAGAGTACTGTGAATGTGGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027604764 7:80287304-80287326 GTGGAGAGAACAGTGATTGTAGG + Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1028284715 7:88981787-88981809 GAGGAGAGCACAGTGATCTTGGG - Intronic
1028868178 7:95737092-95737114 AAGGAGAACCCAGTGACTGTGGG - Intergenic
1029790610 7:102839267-102839289 TAGGAGAGCAGGGTGATGGTGGG - Intronic
1029947690 7:104550427-104550449 GAGGAGACCACAGGCAATGTGGG + Intronic
1030431723 7:109456350-109456372 AAGAACAGCACAGTGATTATCGG - Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031546390 7:123055009-123055031 GAGGGACACACAGTGATTGTGGG - Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033828185 7:145218359-145218381 GAGGAGAGCAGAGGGGCTGTAGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1035285039 7:157800297-157800319 GAAGAGGGCACAGTGATGGAAGG - Intronic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1036160124 8:6379984-6380006 GAGGATAGCATAGTCATTGAGGG + Intergenic
1037787781 8:21912668-21912690 GAGAAGAGGACAGTGACTGCAGG + Intronic
1038067273 8:23975996-23976018 CTGGAGAGGACAGTGTTTGTGGG + Intergenic
1038097511 8:24331296-24331318 TGGGAGAGGACTGTGATTGTGGG + Exonic
1038730037 8:30118741-30118763 CAGGAGAGCAGGGTGATAGTGGG + Intronic
1039339300 8:36629302-36629324 GTGGAGAAGACAGTGATTTTTGG + Intergenic
1039414228 8:37379812-37379834 CAGGAGAACACAGGGATTCTAGG + Intergenic
1039473996 8:37829803-37829825 GAGCAGAGCAGAGGGAGTGTGGG - Intronic
1039831056 8:41215353-41215375 GAGAACAGGTCAGTGATTGTGGG + Intergenic
1040290280 8:46120655-46120677 AATGAGACCACAGCGATTGTTGG - Intergenic
1040315943 8:46260976-46260998 GACGAGAGCACAGGGAATGCTGG + Intergenic
1040317758 8:46273974-46273996 GATGAGACCACAGTGATTGCTGG + Intergenic
1040745520 8:50636566-50636588 AAGGAGAGCATAGTGACTTTGGG - Intronic
1040843580 8:51810658-51810680 GCCAAGAGCATAGTGATTGTTGG - Intergenic
1040962707 8:53051862-53051884 TAGGAGAGCATGGTGAGTGTTGG + Intergenic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1043567203 8:81561639-81561661 AAGGAGGGCACGGTGATTGTGGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045379754 8:101611558-101611580 GAGGAGAGGAAGGTGATTGCTGG - Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047225459 8:122952537-122952559 GCGGGCAGCACAGTGATGGTCGG - Exonic
1047508434 8:125497831-125497853 GAGGAGAGCCCAGAGCTTGCCGG + Intergenic
1048027333 8:130598673-130598695 GAGGAGAACAGAGAGATGGTTGG - Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1049658195 8:143808121-143808143 CAGGAGAGCCCAGTGATCTTGGG + Intronic
1049790010 8:144468170-144468192 CAGGAGAGCAGAGGGACTGTGGG + Intronic
1050068539 9:1786442-1786464 GAGAAGACCACAGTGATGGATGG - Intergenic
1050385183 9:5082250-5082272 CAGGAGAGCAGGGTGATAGTGGG + Intronic
1050780731 9:9331469-9331491 GAGGAGAGCACAAGTTTTGTAGG + Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051376142 9:16404829-16404851 GAAGTGAGCACAGTGACAGTAGG - Intergenic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052441681 9:28504964-28504986 GAGGAGACCAAAATGATTGCAGG + Intronic
1053105747 9:35406378-35406400 TAGGAGCACACAGTGCTTGTCGG - Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054329896 9:63741268-63741290 GAGGAGAGCACAATGGGAGTGGG - Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1057852412 9:98575822-98575844 GAGCAGGCCACACTGATTGTGGG - Intronic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1061402518 9:130376151-130376173 GAGGAGAGAACAGTGAGTTAGGG + Intronic
1061706911 9:132460298-132460320 GAGGAGAACACAGTGGCTTTGGG - Intronic
1062509004 9:136894568-136894590 GAGGAGAGCAGGGGGATTGGGGG + Intronic
1062656507 9:137606576-137606598 GAGGACAGAACAGAGACTGTGGG - Intronic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1186173883 X:6904953-6904975 GAGCAGTGGACAGTGAGTGTTGG - Intergenic
1186387047 X:9120591-9120613 GAGAAAAGCACAGTGATTCACGG + Intronic
1187658606 X:21511659-21511681 GAGAAAAGCACAGTGTTTGAAGG + Intronic
1187723890 X:22182388-22182410 AAGGAGAGTACGGTGATTGTGGG - Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188585816 X:31773882-31773904 TAGGAGAGTAAAGTGATTGGTGG + Intronic
1188716548 X:33465465-33465487 AAAGAGAGCACAATGATTGTGGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1188974775 X:36659978-36660000 AAGGAGAGCACAGAGACTGGGGG + Intergenic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190711442 X:53073457-53073479 GAGGAGAGCTCCGGGAGTGTGGG - Intronic
1192237951 X:69307877-69307899 GAGGTGCGCACAGTGACTGATGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192489442 X:71562055-71562077 GTGTAGAGCACAGTGCTTATAGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192958903 X:76104971-76104993 GGAGACAGCACAGTGATTATGGG - Intergenic
1193092432 X:77509625-77509647 GAAAAGAGTACAGTGATTATGGG + Intronic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193738353 X:85186634-85186656 AAAGAGACCACAGTGACTGTGGG - Intergenic
1193931694 X:87561371-87561393 GGGGAAAGCAAAGTGATTGTAGG + Intronic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194937740 X:99971124-99971146 AGGGAGAGCACAATTATTGTGGG - Intergenic
1195230901 X:102845813-102845835 TAAGAAAGCACAGTGATTGCTGG + Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195300339 X:103524160-103524182 TAAGAAAGCACAGTGATTGCTGG - Intergenic
1195303333 X:103554330-103554352 CAAGAAAGCACAGTGATTGCTGG - Intergenic
1195543435 X:106088249-106088271 AAGGAAAGCACAGCAATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196290125 X:113930070-113930092 GGGGACAGCAAAGTGAGTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1196814713 X:119655626-119655648 GAGGAGATCACAGTGAGCGAGGG - Intronic
1197053802 X:122093477-122093499 GGGAAGAGCACAGCGATTGTGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198433079 X:136587472-136587494 GAGGAGGGCACAGGGCTGGTGGG + Intergenic
1198662525 X:138985321-138985343 GAGGAGAGGACAGTGAATAGTGG + Intronic
1198697362 X:139355765-139355787 GAGAAAAGCACAGTGATTGTGGG - Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1199907250 X:152245771-152245793 GAGGAAACCACAGTACTTGTAGG - Intronic