ID: 1126574118

View in Genome Browser
Species Human (GRCh38)
Location 15:50181575-50181597
Sequence CAGGACTCCCCCGACCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126574118 Original CRISPR CAGGACTCCCCCGACCAGGC AGG Intronic
900299479 1:1969698-1969720 CAGGACCCCCCCGCCCAGGTGGG + Intronic
901462840 1:9401858-9401880 CAGGACTCCTCGGGCCTGGCAGG + Intergenic
901845656 1:11980522-11980544 CAGGACTCGCCGGGCCGGGCCGG - Intronic
902810390 1:18884916-18884938 CAGGACTCCCCGGCCATGGCAGG - Intronic
902890949 1:19443176-19443198 CAGGACTTCCGAGACCAGCCTGG + Intronic
904001876 1:27343323-27343345 CAGTTCTCCCCAGACCAGGCTGG - Intronic
904116391 1:28164930-28164952 CAGCTCTCGCCCTACCAGGCGGG - Intronic
905278339 1:36833459-36833481 CAGCCCTCCCCCGACCAGCCAGG - Intronic
907469591 1:54664595-54664617 CAGGGCACAGCCGACCAGGCAGG + Intronic
910413269 1:86968612-86968634 CAGGAGTCCCGAGACCAGCCTGG - Intronic
912015894 1:105035302-105035324 CAGGAGTTCCCAGACCAGCCTGG - Intergenic
915498099 1:156295227-156295249 CAGGACTCCCCTGACCCTGGTGG + Intronic
915726748 1:158023528-158023550 CAGGAATCCCCACACCAGACAGG + Intronic
920173251 1:204084478-204084500 CAGGGCTGCCAGGACCAGGCAGG + Intronic
922250593 1:223845857-223845879 CCGGGCTCCCCCGCCCCGGCCGG + Exonic
922668313 1:227491111-227491133 CAGGAGTCCCCCTTCCAGCCTGG - Intergenic
924482819 1:244452011-244452033 CATGACTGCCCCGCGCAGGCCGG + Exonic
1064266254 10:13827851-13827873 CAGGGCTCCCCGAAGCAGGCAGG - Intronic
1066340331 10:34526433-34526455 CAGGACAGTCACGACCAGGCAGG + Intronic
1067431933 10:46250933-46250955 CAGGCCTCCTCCAACAAGGCTGG - Intergenic
1067747802 10:48949501-48949523 CAGGCCTCCCCCTAGGAGGCAGG - Intronic
1070795714 10:79215138-79215160 CAGGACTCCCACGCTCAGCCTGG - Intronic
1073308130 10:102519226-102519248 CAAGACTTCACCAACCAGGCTGG + Intronic
1075963374 10:126588150-126588172 CTGGACTCCCCAGAGCCGGCAGG - Intronic
1076076246 10:127535971-127535993 CAGGAATCCCTCCACCAGGACGG - Intergenic
1076372608 10:129964844-129964866 CAGGGCTCCCCGGCCAAGGCTGG + Intergenic
1076527131 10:131118968-131118990 CAGGACAGCCCCCACCACGCAGG + Intronic
1078579053 11:12524924-12524946 CAGGACCCCTGCGCCCAGGCGGG + Intronic
1081948550 11:47021511-47021533 AAGGACTCCCCCTGCCAGGCAGG - Intronic
1083679407 11:64344297-64344319 CAGGAGTCCCCGGAGAAGGCTGG + Exonic
1083705378 11:64510658-64510680 CAGGAATCCTCAGACCCGGCTGG - Intergenic
1083811658 11:65109931-65109953 CAGGGCTACCCCGGCCAGCCTGG - Intronic
1084207938 11:67606820-67606842 CAGTCCTCCCCCGAGGAGGCGGG + Intergenic
1087328661 11:96753417-96753439 CAGCATTCCCCAGAGCAGGCAGG + Intergenic
1091558736 12:1594604-1594626 CCGCACTCCGCCGCCCAGGCGGG + Intronic
1091791326 12:3273781-3273803 CAGGCCTGCCCCGCACAGGCAGG - Intronic
1094491921 12:30966167-30966189 TAGGGCTCCCCCAAGCAGGCAGG + Intronic
1103875535 12:124124311-124124333 CAGAACACCCCCGACCCAGCAGG + Intronic
1104090115 12:125509286-125509308 CAGGAAGCCCCGGCCCAGGCAGG - Intronic
1106420300 13:29580278-29580300 GAGGACTCCCGAGGCCAGGCAGG + Intronic
1108451917 13:50575741-50575763 CAGGACTCTCTCTCCCAGGCTGG + Intronic
1115788481 14:36853521-36853543 CAGGACTCCTGCTACCAGCCCGG + Intronic
1122899424 14:104776092-104776114 CAGGACTCCGCCTCCCAAGCAGG + Intronic
1124360040 15:29029935-29029957 CAGGACTCTCCAGACCACGCGGG + Intronic
1126034338 15:44533180-44533202 CAGGAGTTCCAAGACCAGGCTGG - Intergenic
1126574118 15:50181575-50181597 CAGGACTCCCCCGACCAGGCAGG + Intronic
1129705755 15:77793166-77793188 CAGGTCTCCTCCTGCCAGGCAGG - Intronic
1132731771 16:1366422-1366444 CAGGAGGCCCCTGCCCAGGCTGG + Intronic
1134690036 16:16185059-16185081 CAGGAGACCCCTGACCTGGCCGG + Intronic
1136192264 16:28623513-28623535 CAGGAAGCCTCCGACCACGCGGG - Exonic
1136576871 16:31130376-31130398 CAGGTCTCCCCCTCCCAGACAGG - Intronic
1137368875 16:47886541-47886563 CAGGGCTCCCTCCTCCAGGCAGG + Intergenic
1141703220 16:85651767-85651789 CTGGACTCCCCCTCCCAGGCTGG - Intronic
1148779837 17:50115191-50115213 CAGGCCTCACCCTACCAAGCAGG + Intronic
1148805118 17:50260009-50260031 CCAGATTCCCCCGAGCAGGCCGG - Intergenic
1148813418 17:50309733-50309755 CAGTGCTCCCCAGAGCAGGCAGG - Intergenic
1152779260 17:82219187-82219209 GAGGACACCCGGGACCAGGCAGG + Intergenic
1152800920 17:82330270-82330292 CAGGACTCCCCAGAGCAGCCTGG - Intronic
1155162047 18:23204032-23204054 CAGGACTCCCCAGACCTCACTGG + Intronic
1158681663 18:59573073-59573095 CAGGAGTTCCAGGACCAGGCAGG + Intronic
1160406869 18:78652382-78652404 CAGGCCACCCCAAACCAGGCAGG - Intergenic
1160710067 19:547367-547389 CAGGACACCCCCGCACAGGTGGG - Exonic
1160809022 19:1005042-1005064 CAGCAGGTCCCCGACCAGGCCGG - Exonic
1161060840 19:2214031-2214053 GAGGACACACCCGCCCAGGCAGG - Intronic
1164725317 19:30462009-30462031 ATGGACTGCCCTGACCAGGCCGG - Intronic
1165156504 19:33792116-33792138 GAGGACTCCCCCGACCCCCCTGG + Intergenic
1167300138 19:48673226-48673248 CAGGACAGCCCCGAGCAGCCTGG + Intergenic
1167639097 19:50670577-50670599 CATGACTCCCCAGACCCTGCAGG + Intronic
925992307 2:9263350-9263372 CAGGACCCCCCCAGCCAGCCTGG - Intronic
927092222 2:19720723-19720745 CAGTAGTCCTCTGACCAGGCAGG + Intergenic
928020380 2:27699929-27699951 CAGGAGTCCCGAGACCAGCCTGG + Intergenic
928861362 2:35861168-35861190 CAGAACTCAACCGACCATGCTGG + Intergenic
929802666 2:45117591-45117613 CAGGACTCCTACAAGCAGGCTGG + Intergenic
937265966 2:120614831-120614853 CAGGCCTGTCCCGCCCAGGCAGG + Intergenic
937268936 2:120634867-120634889 CTTGTCTCCCCCGGCCAGGCAGG + Intergenic
938257153 2:129868344-129868366 CTTGGCTCACCCGACCAGGCAGG + Intergenic
946404089 2:219483615-219483637 CAGGCCTCCCCGGGCCAGGCGGG - Exonic
947432906 2:230046311-230046333 CAGGAGTGCCCCGATCAGGCCGG - Exonic
947760888 2:232603052-232603074 CAGGAGTTCCCAGACCAGCCTGG - Intergenic
1169388173 20:5168665-5168687 CAGGAAGCCTCCCACCAGGCTGG + Intronic
1170796154 20:19548688-19548710 GAGGACTCCCCTGACTAGGTTGG + Intronic
1171458140 20:25283309-25283331 CAGCCCTCCCACAACCAGGCAGG + Intronic
1172125039 20:32620783-32620805 CAGGACTCCTCCTCACAGGCAGG - Intergenic
1175326238 20:58130272-58130294 CAGGACACCCCTGACAAGGGTGG - Intergenic
1175424650 20:58855682-58855704 CGGGACTCCCCTGGCTAGGCTGG + Intronic
1176095605 20:63342827-63342849 CAGGAATCCCCTGCCCAGCCCGG - Intergenic
1176166923 20:63679254-63679276 TGGGATTCCCCCGACCAGGTCGG - Intronic
1176364917 21:6026914-6026936 CAGGTCTCCTCCAACCACGCTGG + Intergenic
1176522931 21:7838385-7838407 CTGGACTCCCCGGAGCTGGCAGG - Intergenic
1178656951 21:34468397-34468419 CTGGACTCCCCGGAGCTGGCAGG - Intergenic
1179758601 21:43511631-43511653 CAGGTCTCCTCCAACCACGCTGG - Intergenic
1179957417 21:44749348-44749370 CGGGTCTCCCCCGACCTGCCTGG - Intergenic
1180142554 21:45901139-45901161 CAGGCCTGCCCCCGCCAGGCTGG - Intronic
1180200100 21:46219134-46219156 CAGGACGCCCCTGTGCAGGCTGG + Intronic
1180768497 22:18361688-18361710 CTGGGCTCCCCCGCCCAGGTTGG - Intergenic
1180810539 22:18758014-18758036 CTGGGCTCCCCCGCCCAGGTTGG + Intergenic
1181196682 22:21192269-21192291 CTGGGCTCCCCCGCCCAGGTTGG + Intergenic
1181212843 22:21300855-21300877 CTGGGCTCCCCCGCCCAGGTTGG - Intergenic
1182527095 22:30927253-30927275 CAGGCCTCCTCCAACCAAGCAGG + Intronic
1184172936 22:42769977-42769999 CAGGACCCCGCCGACCCGGCGGG + Intergenic
1184769502 22:46589237-46589259 CAGGACTCCCCCCAAGAGCCAGG - Intronic
1185402743 22:50627161-50627183 CCGTACTCCCACGACCAGGTAGG - Exonic
1203230115 22_KI270731v1_random:102576-102598 CTGGGCTCCCCCGCCCAGGTTGG - Intergenic
951678685 3:25271930-25271952 CAGAACTCTCCCAACCAGGCAGG - Intronic
953005302 3:38972195-38972217 CATCACTCCCCCATCCAGGCAGG - Intergenic
954230750 3:49215257-49215279 CAGGAGTCCCAAGACCAGCCTGG - Intronic
954744424 3:52779034-52779056 CAGAACTCACCTGACAAGGCCGG - Exonic
961084648 3:124056388-124056410 CAGGAATCCCCTCTCCAGGCTGG - Intergenic
961651346 3:128418114-128418136 CTGGAGTCCCCAGACCAGACTGG + Intergenic
965776684 3:172239230-172239252 CAGGATTCTCCCAAGCAGGCTGG - Intronic
968591130 4:1460159-1460181 CAGGACTCCCCAGAGCAGGGCGG - Intergenic
968642897 4:1723197-1723219 CATGGCTCCCCCTGCCAGGCTGG + Intronic
979215087 4:118153612-118153634 CAGGAGTTCCCTGACCAGCCTGG + Intronic
979576083 4:122293874-122293896 CCGGACTCCCTGGAGCAGGCAGG - Intronic
983396646 4:167205817-167205839 CAGGAGTTCCAAGACCAGGCTGG - Intronic
989177266 5:38540327-38540349 CAGCTCTCCCCCGACCTGTCCGG + Intronic
992363254 5:76064336-76064358 AAGGGCTCCTCCCACCAGGCGGG + Intergenic
998457716 5:142286688-142286710 CAGGACTCTATCGCCCAGGCTGG + Intergenic
998603256 5:143606465-143606487 CATGTCTCACCCTACCAGGCAGG + Intergenic
999401038 5:151264425-151264447 CAGGGCTCCTCCCACCAGGCTGG - Intronic
1002172416 5:177382865-177382887 CGAGACACCCCCAACCAGGCAGG + Intronic
1002967576 6:1982094-1982116 CAGGAGTCCCAAGACCAGCCTGG + Intronic
1006439622 6:34045741-34045763 CAGGAACCCCAGGACCAGGCAGG + Intronic
1006471855 6:34234121-34234143 CAGGACTTCCCTGACCACCCTGG + Intergenic
1006820281 6:36887931-36887953 CAGGACTTCCAAGACCAGCCTGG - Intronic
1013600875 6:111703865-111703887 CAGGACTCCACTCACAAGGCAGG + Intronic
1013773181 6:113650163-113650185 GAGGACTCTCCTGACCAGCCTGG - Intergenic
1014858539 6:126433033-126433055 CAGGCCTCCACTGAGCAGGCTGG - Intergenic
1015802083 6:137070434-137070456 CACTCCTCCCCCGACCAAGCTGG - Intergenic
1018037039 6:159890367-159890389 GAGGAGCCCCCGGACCAGGCTGG + Intergenic
1019510236 7:1414088-1414110 CAGGAGCCCCCGGACCAGCCGGG + Intergenic
1019770976 7:2883447-2883469 CAGGCCTCCCCCGACTTGCCTGG + Intergenic
1020098888 7:5383352-5383374 CAGGGCTCCCCTGCACAGGCAGG + Intronic
1020210359 7:6154132-6154154 CAGGGCTCCTCCGACCGCGCAGG - Exonic
1022878541 7:34562379-34562401 CAGAACTTCCCTGACCAAGCTGG - Intergenic
1028950130 7:96625157-96625179 CAGTACTCACCTGAGCAGGCTGG - Intronic
1031967271 7:128035811-128035833 CAGGACTCTCCCACCCAGCCAGG + Intronic
1032839341 7:135701920-135701942 CAGGCCTGCCCCGCCCAGCCTGG + Intronic
1034411123 7:150942694-150942716 CAGGACTCCCCTGCCAAGGCTGG - Intergenic
1034411163 7:150942913-150942935 CAGACCTCCACCGCCCAGGCAGG + Intergenic
1034471065 7:151254564-151254586 AAGGCCTCCCCACACCAGGCAGG - Intronic
1034662949 7:152788164-152788186 CAGGAGTTCCCAGACCAGCCTGG - Intronic
1034911937 7:155003811-155003833 CAGGACGCCAGGGACCAGGCCGG - Intergenic
1036910933 8:12755899-12755921 CCCGACGCCCCCGCCCAGGCCGG + Intronic
1037605919 8:20437019-20437041 GAGGACACCTCCGTCCAGGCAGG - Intergenic
1049544078 8:143221465-143221487 CAGGACCCCTCCGCCCACGCAGG - Intergenic
1051383541 9:16482787-16482809 CAGGACTCTCTGGACCAGACTGG + Intronic
1058724531 9:107789376-107789398 CAGCACTGCCCCCACCATGCTGG + Intergenic
1060112255 9:120914590-120914612 CAGAGCCCCCCCGACCAGTCGGG - Intronic
1060883752 9:127136301-127136323 CAGGCCTCCCCCTCCCTGGCTGG - Intronic
1061091521 9:128429042-128429064 CAGGGCCCCCCCCACCAGGCAGG - Intronic
1189846429 X:45142811-45142833 CAGGACTACCCCTACCACCCTGG - Intergenic
1193065493 X:77254931-77254953 CGCCACTCCCCCGACCAAGCTGG - Intergenic
1193647668 X:84088959-84088981 CTGGACTTCCCAGAGCAGGCAGG + Intronic
1202343904 Y:23900870-23900892 CAGGACTCCCACCTCCAGCCTGG - Intergenic
1202526864 Y:25769214-25769236 CAGGACTCCCACCTCCAGCCTGG + Intergenic