ID: 1126577299

View in Genome Browser
Species Human (GRCh38)
Location 15:50209685-50209707
Sequence GAGAATACACAGAAGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 446}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126577297_1126577299 -6 Left 1126577297 15:50209668-50209690 CCTTTTGGCTACGATGTGAGAAT 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1126577299 15:50209685-50209707 GAGAATACACAGAAGGATGAAGG 0: 1
1: 0
2: 2
3: 40
4: 446

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126577299 Original CRISPR GAGAATACACAGAAGGATGA AGG Intronic
900741636 1:4333794-4333816 GAGAATCAACAGAATGAGGAAGG + Intergenic
900761403 1:4473911-4473933 GAGAATACACAGGGAGAAGATGG - Intergenic
900930954 1:5737181-5737203 GATAATAGATAGATGGATGAGGG + Intergenic
901205324 1:7491437-7491459 GAGTAGACACAGAGGGAAGATGG + Intronic
901904695 1:12398119-12398141 GAGAATACATTGTAGGAGGAAGG + Intronic
901951240 1:12748730-12748752 GAGAATAAACACAAGCATCAAGG + Intronic
902270976 1:15304830-15304852 TAGAATTAACAGAAGGATCAAGG - Intronic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
902724124 1:18323897-18323919 GCGAAAACACATAAGGAGGAAGG + Intronic
903359466 1:22767701-22767723 GAGAAGACACAGGGGGAAGAGGG - Intronic
903826499 1:26149360-26149382 GGGAATCCACAGAGGGATCAGGG + Intergenic
903826510 1:26149402-26149424 GGGAATCCACAGAAGGATCGGGG + Intergenic
903877183 1:26483169-26483191 GGGACTACACAGGAGGATGATGG - Intergenic
905401641 1:37707954-37707976 CAGACCCCACAGAAGGATGAGGG - Intronic
905502521 1:38450947-38450969 GAAAAGACACAGAGGGAAGATGG - Intergenic
906967500 1:50472888-50472910 GAGAATTCAGAGAAGAATGAAGG + Intronic
907342622 1:53747793-53747815 GAGAAAACACAGGATGAGGAGGG - Intergenic
907764135 1:57391717-57391739 AAGAATGCACAGATGGATTAGGG - Intronic
908255052 1:62296271-62296293 GAGGATTCACATAAGGATGTTGG - Intronic
908621952 1:65991994-65992016 GAGCTTAAACAGAAGAATGAGGG + Intronic
909428562 1:75557400-75557422 GTGAATACACAGAAGAAAGGTGG + Intronic
909561866 1:77016277-77016299 GAGGAGATACAGGAGGATGAGGG - Intronic
911096997 1:94062756-94062778 GAGAAGACACAGAGGGACAAAGG + Intronic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
912383439 1:109259902-109259924 GAGAAGACACAGGAGCCTGAAGG - Intronic
913439977 1:118886963-118886985 GAGAACACACTGAAGGAGGTTGG - Intronic
915264860 1:154709532-154709554 GAGAAGCCAGAGAAGAATGAAGG + Intronic
916539923 1:165743188-165743210 GAGAATATACAGGAAAATGAAGG + Exonic
916808481 1:168283563-168283585 GAGAAAAGAGAGAAGGAAGAAGG - Intronic
917316868 1:173735096-173735118 GTGATTACACAGAAAGAAGAGGG + Intronic
917520746 1:175746693-175746715 GAGAAAACAAAGAAGACTGAGGG + Intergenic
919153175 1:193725757-193725779 GAGAAAACAGTGAATGATGATGG + Intergenic
920799240 1:209172440-209172462 GAGAAGCCACAGAAGGTTCACGG + Intergenic
921124735 1:212167344-212167366 GAATATCCACAGAGGGATGAAGG - Intergenic
921134395 1:212247313-212247335 CACAATACACAGAAGAATGCTGG - Intergenic
923040673 1:230317936-230317958 GGGTATACACGGAAGGGTGAAGG + Intergenic
923114823 1:230925508-230925530 GAGAATACACAGAGGTATTCTGG - Exonic
923469912 1:234281238-234281260 ATGAAGACACAGAAGGGTGATGG + Intronic
923843549 1:237701685-237701707 GACAAGACTCAGAAGGGTGAGGG - Intronic
924053280 1:240098929-240098951 GAAAATATACAGTTGGATGAAGG + Intronic
924377140 1:243423266-243423288 GAAAATACAAAGAAGAATTAAGG + Intronic
1062789079 10:289970-289992 GAGAAGACACAGCAGGCTGGGGG - Intronic
1063090852 10:2865245-2865267 GAGATTACACAGCAGGAGGTGGG - Intergenic
1063571802 10:7221987-7222009 GAGAATATAAAGAAAGATAAAGG - Intronic
1063883566 10:10554661-10554683 GAGATAACTCAGAAGGATGGAGG - Intergenic
1064287423 10:14004016-14004038 GAGACCATACAGAAGGATGTGGG + Intronic
1066818517 10:39453583-39453605 AAAACTACACAGAAGGATTATGG - Intergenic
1067317544 10:45182216-45182238 GAGAACACACAGATCCATGAGGG + Intergenic
1068217888 10:54007137-54007159 GAAAATACACAGAAAGAAAAGGG - Intronic
1068257664 10:54534509-54534531 GAGATTCCACAGAAAGATCAAGG + Intronic
1068906393 10:62329010-62329032 GTGACTACACAGAAAGAAGATGG - Intergenic
1069880327 10:71588773-71588795 GGGAACACCCAGAGGGATGAGGG - Intronic
1070125139 10:73615242-73615264 GAGTATACTCAGGAGGCTGAGGG + Intronic
1071411420 10:85400495-85400517 CAGAATAAACAGAAGGACCATGG + Intergenic
1072204798 10:93193752-93193774 AAGAACACACAGAAGGAACAAGG + Intergenic
1073320078 10:102610533-102610555 GAGAACATCCAGAAGGGTGAGGG + Intronic
1073390996 10:103176223-103176245 GAGAATCCACAGGAGGGAGAGGG - Intronic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1074136307 10:110629946-110629968 GAGAATACACAGACAGAAGTTGG - Intergenic
1074223020 10:111457184-111457206 GATAATACACAGAAGATTTAAGG - Intergenic
1074970826 10:118535367-118535389 CAGAATACACAGAAGACAGAAGG - Intergenic
1075354436 10:121757867-121757889 CAGAATACACACAAATATGAGGG - Intronic
1075377430 10:121990101-121990123 AAAAATCCACAGAAGGTTGAAGG - Intronic
1075920992 10:126212849-126212871 GAGAATACACAAAAGGCAGGTGG - Intronic
1076444972 10:130508041-130508063 CAGAAAAGACAGATGGATGAGGG - Intergenic
1076468703 10:130703792-130703814 GGGAAGAGAAAGAAGGATGAGGG - Intergenic
1077667258 11:4123917-4123939 GAGACTTCACAGAAGAATCAAGG + Intronic
1077670873 11:4156504-4156526 AAGAATACAGGGAATGATGAGGG - Intergenic
1078901811 11:15649719-15649741 GAGAATACGGAGAAAGCTGAAGG + Intergenic
1079990583 11:27242229-27242251 GCCAATTCTCAGAAGGATGATGG + Intergenic
1080786063 11:35476235-35476257 GAGATTACAGAGAGAGATGATGG - Intronic
1080979663 11:37386100-37386122 GAGAATACCTATAAGCATGATGG + Intergenic
1081011285 11:37815673-37815695 GAGACTAAACAGAAATATGAAGG - Intergenic
1081108681 11:39104743-39104765 GTGAAGACACAGGAGGAAGATGG - Intergenic
1082910462 11:58367879-58367901 GAGAATAAGCAAAATGATGAAGG - Intergenic
1083036972 11:59647421-59647443 CAGAATTTACAGAAGGATTAGGG - Intronic
1083185169 11:61013483-61013505 GAGAATTCCCAGAACGATGGAGG - Exonic
1083277885 11:61607533-61607555 GAGAATTCCTAGGAGGATGACGG - Intergenic
1084551550 11:69846179-69846201 GAGAAGACACAGAGGGGAGAAGG + Intergenic
1085869615 11:80333941-80333963 GAGAACACACACAAGGATTCAGG + Intergenic
1087268348 11:96084921-96084943 GAGAACTCACAGTAGAATGAAGG + Intronic
1087737064 11:101846140-101846162 GAGAAGAGACAGAAGGCAGAGGG - Intronic
1088128593 11:106460106-106460128 GAAAAACCACAGAAGCATGAAGG + Intergenic
1088131183 11:106493059-106493081 AAGAATAGACACAAAGATGAAGG + Intergenic
1088483359 11:110317632-110317654 GATAACACACAGAACAATGAAGG - Intergenic
1088535128 11:110852235-110852257 GAGAGAGCACAGAAGGATGAAGG + Intergenic
1089298571 11:117484096-117484118 GAGAATACCCGGAAGGAAGGAGG - Intronic
1090399784 11:126441620-126441642 GAGAACACACAGAATTATGCAGG + Intronic
1090472527 11:126992957-126992979 GAGGAGGCACAGAAGGATGGTGG - Intronic
1091048251 11:132344709-132344731 GAGAATACATTTGAGGATGATGG - Intergenic
1091116335 11:133017123-133017145 GTGAGGACACAGAAAGATGATGG - Intronic
1091235775 11:134021158-134021180 GGGAACACACAGAGGGATGTTGG - Intergenic
1091254716 11:134173320-134173342 GAGATACCACAGATGGATGAAGG + Intronic
1093000524 12:13990863-13990885 ACAGATACACAGAAGGATGAGGG + Intergenic
1093833985 12:23803090-23803112 GAGAATTTAGAGAAGCATGATGG - Intronic
1094234503 12:28148224-28148246 GAAGAAACACAGAAGAATGAAGG - Intronic
1094800261 12:34024845-34024867 GAGGATACAGAGAAGGAGCAGGG + Intronic
1095690484 12:45082948-45082970 GTCAATACACAGAAGCATGAAGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096713930 12:53479489-53479511 GAAACTACACAGATGGATCATGG - Exonic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1097802639 12:63931844-63931866 GAGAATAGACAAAGGAATGAGGG + Intronic
1097901995 12:64882535-64882557 ATGAATACACAGCAGTATGAGGG - Intergenic
1098655541 12:73024642-73024664 CAGAATACCCAAAAGAATGAAGG + Intergenic
1098666945 12:73176229-73176251 GAGATTACAAAGTAGGAGGAGGG + Intergenic
1100219188 12:92485553-92485575 GGAAATGAACAGAAGGATGATGG + Intergenic
1100226370 12:92560425-92560447 GCATATACACAGAAGAATGAGGG + Intergenic
1100921508 12:99493568-99493590 TGGAATAAACAGTAGGATGAGGG - Intronic
1103138050 12:118524915-118524937 GAAAATACAGAAAAGGATCAAGG + Intergenic
1104163091 12:126199647-126199669 GAGATTAAACAGAGGAATGATGG + Intergenic
1106061006 13:26291877-26291899 GAGTAAACCCAGAAAGATGATGG - Intronic
1107259123 13:38470256-38470278 GAAAATAAACAGAAGCATCAAGG - Intergenic
1107856862 13:44624711-44624733 GGGAATACTTAGCAGGATGAAGG - Intergenic
1107924248 13:45243193-45243215 TAAAGTACACAGAAGGATGGAGG - Intronic
1108722356 13:53145319-53145341 GAGAAAGCAAAGAAGGATGCCGG - Intergenic
1109429749 13:62216330-62216352 GAGAATACACAGACACATGGAGG - Intergenic
1109636418 13:65123714-65123736 CAGAATACACACAGGGAAGAAGG + Intergenic
1109980707 13:69902706-69902728 GAGAACACACAGACAGAGGAAGG + Intronic
1111079339 13:83281343-83281365 GAGAATACAAATAATTATGATGG + Intergenic
1112130032 13:96513249-96513271 AAAAATACACAGAAAGATCAAGG - Intronic
1113042888 13:106123800-106123822 GAGAAAACACACAAGGAAGGTGG + Intergenic
1115306536 14:31939308-31939330 GAGAAGACACAGACAGAAGATGG + Intergenic
1116813870 14:49566009-49566031 GATACTACTCAGAAGGCTGAAGG + Intergenic
1117186780 14:53247648-53247670 GAGACTAGAAAGAAGGAAGAGGG + Intergenic
1117515090 14:56492813-56492835 GAGAATAAGCAGAAGTATGAAGG + Intronic
1117571600 14:57054476-57054498 GCGAAGGCACAGAAGTATGATGG + Intergenic
1117653911 14:57934849-57934871 GAAAAGACACAGAAGAATGAGGG + Intronic
1118893531 14:69927942-69927964 AAGAATAAACAGAGGGGTGAAGG + Intronic
1118896302 14:69948670-69948692 GAGAACACACAGAAAAAAGAGGG - Intronic
1120129990 14:80795322-80795344 CAGATAACACAGAAGGAAGAGGG - Intronic
1120470540 14:84918273-84918295 GAGAAGAAAAAGAAGGAAGAAGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG + Intronic
1122679093 14:103443024-103443046 GAGAAAACACAGAAAAATGAGGG + Intronic
1122728082 14:103773256-103773278 GAGAATAAAATGAAAGATGAAGG + Intronic
1124268011 15:28254752-28254774 GGGACTTCACAGAAGGATGCTGG - Intronic
1124479172 15:30062771-30062793 AAGAAAAGACAGAAGGAAGAAGG + Intergenic
1124713467 15:32034002-32034024 GAGAATTAACAGAAAGATGAGGG + Intronic
1124803892 15:32861799-32861821 GAGAATTCACTGAAGAATGCAGG + Intronic
1125523702 15:40362312-40362334 GAGAAGTCACAGAGGGCTGAGGG - Intronic
1125832158 15:42724618-42724640 TGGAATACATAGAAAGATGAGGG + Intronic
1126128835 15:45321133-45321155 GAGAAGGCACAGAAAGCTGAAGG - Intergenic
1126499832 15:49333442-49333464 GAGAATATGCAGAAGAATGTAGG - Intronic
1126577299 15:50209685-50209707 GAGAATACACAGAAGGATGAAGG + Intronic
1127294491 15:57597575-57597597 GAGAAAACACAGGTGGATGAAGG - Intronic
1127702573 15:61515226-61515248 GAGAATACACAGCTGGATGGTGG + Intergenic
1128775239 15:70315509-70315531 AAGAGGACACAGAAGGATGTAGG - Intergenic
1129976982 15:79830874-79830896 AAGAAGAGACAGAAGGATAAAGG + Intergenic
1130665399 15:85865111-85865133 GAGAACCCACTGAAGGATGTAGG + Intergenic
1133230148 16:4362531-4362553 TAGGGTACACAGGAGGATGACGG + Intronic
1135890906 16:26356351-26356373 GAGAAGACACAGCAGGAAGGTGG - Intergenic
1136922326 16:34343586-34343608 GAGAACTCAAAGAAGGATGTTGG - Intergenic
1136982247 16:35068220-35068242 GAGAACTCAAAGAAGGATGTTGG + Intergenic
1138420161 16:56893665-56893687 GAGACAACAGAGAGGGATGAGGG + Intronic
1138799285 16:60006952-60006974 GATAAGAAAAAGAAGGATGAAGG - Intergenic
1139381826 16:66537331-66537353 TAGAATACACAGAAGAGGGATGG - Intronic
1140139518 16:72242066-72242088 GAGAAGAGAAGGAAGGATGAAGG - Intergenic
1140888746 16:79267530-79267552 GAAGATACACAGAGGGATAATGG + Intergenic
1141382888 16:83591612-83591634 GAGAATTCAGAGAAGGAAGAAGG - Intronic
1142519436 17:494534-494556 GATAAGACACAGGATGATGATGG - Intergenic
1142909371 17:3074103-3074125 GATAAGACACACAAGGATGAAGG + Intergenic
1142925191 17:3230135-3230157 GATAAGACACACAAGGATGAAGG - Intergenic
1145044525 17:19602696-19602718 TAGAATTAACAGCAGGATGATGG - Intergenic
1146635384 17:34500340-34500362 GAGAAAACAGAGCAGGATGAGGG - Intergenic
1146817806 17:35957729-35957751 AAGAATACACAAATGGATTAAGG - Intergenic
1147377719 17:40032807-40032829 CAGAGTCCACAGAAGGGTGACGG - Intronic
1148339226 17:46863513-46863535 GAGAAGACAAAGAAAGAGGATGG + Intronic
1149337776 17:55654905-55654927 GAAAATACACAAAAAGTTGAAGG + Intergenic
1153187700 18:2503050-2503072 GAGAATAAAAAGGAGGAAGAAGG + Intergenic
1154008511 18:10556108-10556130 GACAATAAACATTAGGATGATGG + Intergenic
1154282723 18:13020468-13020490 AAGTGTCCACAGAAGGATGAGGG - Intronic
1155608912 18:27640741-27640763 GAGAATACATGGATGCATGATGG + Intergenic
1156540728 18:37907259-37907281 GAGAATATACAGAACGATTGTGG - Intergenic
1156739501 18:40305997-40306019 GAGAATCCACAGGAAGAAGATGG - Intergenic
1157257813 18:46154037-46154059 GAGAATTCAAAGATGGAGGAAGG + Intergenic
1157434500 18:47657003-47657025 GAAAATACAGAGAAGCATGCAGG + Intergenic
1157551000 18:48581958-48581980 GAGTAGACCCAGAAGGATGATGG + Intronic
1157569901 18:48705348-48705370 GAGGAGACACAGAGGGATGAAGG - Intronic
1158287026 18:55895116-55895138 GAGAAGACTCTGAAGGAGGAAGG + Intergenic
1158745311 18:60193165-60193187 GAGAACCTACACAAGGATGATGG - Intergenic
1158787630 18:60734895-60734917 GTGAAGACACAGAAAGAAGATGG - Intergenic
1159550041 18:69885460-69885482 GAGAAGCCTCAGAAGGAGGAAGG + Intronic
1160331623 18:77998081-77998103 GAGGCGACACAGAAGGAAGAAGG + Intergenic
1161540293 19:4846752-4846774 GTGAATACACAGAGAGAAGATGG + Intronic
1163481934 19:17561845-17561867 GAGAATATAGAAAAGTATGAAGG - Intronic
1164264354 19:23599071-23599093 GAGAATACACAGTAGAAATAAGG + Intronic
1164542053 19:29128630-29128652 GAGAACACACACAGGGACGATGG + Intergenic
1164955750 19:32382494-32382516 GAGACTTCAAAGAAGGAGGATGG - Exonic
1164969555 19:32519772-32519794 CAGAATGCACAGTAGGATGCAGG - Intergenic
1164969745 19:32521497-32521519 CAGAATGCACAGTAGGATGCAGG - Intergenic
1165733911 19:38163905-38163927 GGGAATAAACAGGGGGATGAGGG + Intronic
1165796585 19:38523475-38523497 GAGAAGATACAGGAGGAGGAAGG - Intronic
1165796601 19:38523551-38523573 GAGAAGATACAGGAGGAGGAAGG - Intronic
1165916393 19:39263733-39263755 GAGAAAGCAGAGAAAGATGAAGG + Intergenic
1166546809 19:43639184-43639206 GAGAATAGACAGGATGATGGAGG + Intronic
1166552042 19:43672275-43672297 GAGAAAACAAAGCAGGCTGAAGG + Intergenic
1167499363 19:49836608-49836630 GAGCACACACAGGAGGATCATGG - Intronic
1168653496 19:58109867-58109889 GAGAATATAAAGATGGATGAAGG + Intronic
925773435 2:7307285-7307307 TAGAACACAAAGAAGGAGGAAGG + Intergenic
926252471 2:11163286-11163308 CAGAATACACAGAATGAGGTGGG + Intronic
927009379 2:18886823-18886845 GACAATAAAAAGATGGATGAAGG - Intergenic
927501762 2:23588049-23588071 GAGGTTACAGAGAAGGATGAGGG - Intronic
928784185 2:34862185-34862207 GAGAAGACACAGGAAGAAGATGG - Intergenic
931615630 2:64153844-64153866 GAGAAGACACAGGATGATTAAGG - Intergenic
931989731 2:67777911-67777933 AAGAATCCACCGAAGGATCATGG + Intergenic
932492368 2:72130563-72130585 TCGAAAACACAGAAGAATGAAGG - Exonic
933256392 2:80085826-80085848 GAGAAAAGAGAGAAGGGTGAGGG + Intronic
935643634 2:105314110-105314132 GTGAAGACACAGAAAGAGGAAGG + Intronic
936244610 2:110815958-110815980 GTGAATGGACAGATGGATGATGG + Intronic
937295666 2:120808389-120808411 GAGAGGTCACAGGAGGATGATGG - Intronic
937518138 2:122679175-122679197 GAGAATGCAAACAAGTATGATGG - Intergenic
939113454 2:138034023-138034045 GAGAAGAAACAGAAAGATGGTGG + Intergenic
939251128 2:139682816-139682838 GAGATTACAGAAAAGAATGAGGG - Intergenic
939409676 2:141808283-141808305 CAGAATTCACAGGAGGATCAGGG + Intronic
939463019 2:142521781-142521803 TAGAATGCAGAAAAGGATGATGG + Intergenic
939894801 2:147778109-147778131 GTGAATACTCAGAAGACTGAAGG + Intergenic
940559660 2:155279878-155279900 GAAAATACACAGACAGAAGAGGG - Intergenic
940712062 2:157174437-157174459 GAGACTTCACATAAGAATGAAGG - Intergenic
941203986 2:162548540-162548562 GAGACCACAGAGAAGGATGAAGG + Intronic
942403160 2:175624756-175624778 AAGAATCCACAGACTGATGAGGG + Intergenic
943405218 2:187474282-187474304 GAGAATACAGAGAAGCATATGGG + Intronic
943762464 2:191624796-191624818 GTGAAGACACAGAAAGAAGATGG - Intergenic
943890543 2:193281094-193281116 GTGAAATCACATAAGGATGATGG - Intergenic
944082401 2:195802859-195802881 GAGGAGACTCAGAAGGGTGAAGG - Intronic
944117875 2:196208741-196208763 AGGAATACACAGAAGGAGGCTGG + Intronic
944306997 2:198189826-198189848 GATAATAATGAGAAGGATGATGG + Intronic
944309598 2:198218659-198218681 GAGAAGGCACTGAAGCATGAAGG + Intronic
946013154 2:216582818-216582840 GAGATTACACAGACAGAAGAGGG - Intergenic
946041312 2:216785086-216785108 GAAAACACACAGAAAGAAGATGG - Intergenic
946389462 2:219406747-219406769 GTGAGAAGACAGAAGGATGATGG + Intergenic
946466420 2:219916064-219916086 GAGAATACATAGCGGGATGGTGG - Intergenic
947344385 2:229175679-229175701 GACAATACAAAGAGGGATGGGGG + Intronic
947812983 2:233015823-233015845 GAGAGTGAGCAGAAGGATGAGGG - Exonic
948770597 2:240249667-240249689 GAGAAGACACAGACGGAGGCAGG - Intergenic
948783091 2:240336969-240336991 GAGCAAAGCCAGAAGGATGAAGG + Intergenic
948856915 2:240734544-240734566 GAGAATAAAAAGAAAGAAGACGG + Intronic
1169245053 20:4018523-4018545 GAGAATGAACGGAAGGAGGAGGG + Intergenic
1169249166 20:4046873-4046895 GAGAAGACAATGAAGGATGGTGG + Intergenic
1169754898 20:9033351-9033373 GAGAGTACAAGGAAGGAAGAGGG - Intergenic
1169762765 20:9114332-9114354 GAGAAGACAAAGTAAGATGATGG + Intronic
1170662665 20:18358243-18358265 GAGGATGAACAGGAGGATGAAGG + Intergenic
1170706297 20:18747413-18747435 GAGAAAACACAGAAACATGGCGG - Intronic
1171271795 20:23823882-23823904 GAGAAGACAGAGAAGGCTGCAGG - Exonic
1171335353 20:24380634-24380656 CAGAAAACAAAGAATGATGAAGG - Intergenic
1172766875 20:37355752-37355774 GAGAAAAAAAAGAAGGGTGAGGG + Intronic
1173134999 20:40431779-40431801 TGGAATCCAGAGAAGGATGAAGG - Intergenic
1173957601 20:47046434-47046456 GTAGATACACCGAAGGATGAAGG + Intronic
1174384378 20:50178418-50178440 GTGAACACACAGAGGGAAGAAGG + Intergenic
1174792860 20:53496635-53496657 GAGAAGTCACAGAAGGATGAAGG + Intergenic
1175081856 20:56427297-56427319 GGGAAGACAGAGAAGGAGGAAGG - Intronic
1175245060 20:57577215-57577237 GAGAATAGACAGATGGATAGTGG + Intergenic
1176349486 21:5781052-5781074 GAGAACACACAGAAACATGGAGG + Intergenic
1176356300 21:5901636-5901658 GAGAACACACAGAAACATGGAGG + Intergenic
1176543807 21:8179122-8179144 GAGAACACACAGAAACATGGAGG + Intergenic
1176562758 21:8362167-8362189 GAGAACACACAGAAACATGGAGG + Intergenic
1177507921 21:22041299-22041321 GGGAAGACACAGAAGGAAGCTGG - Intergenic
1177717937 21:24864880-24864902 GAAAATAGAAAGAAGCATGAGGG + Intergenic
1177916965 21:27100970-27100992 GTGAAGACATAGAAAGATGATGG - Intergenic
1179026534 21:37683453-37683475 GAGAAGACAGAGGAGGAGGAGGG - Intronic
1179086995 21:38226848-38226870 GAAAATGCACTGAAGGAGGATGG - Intronic
1179258467 21:39737974-39737996 GAGAGTACGCAGAAGGGTGATGG + Intergenic
1183889600 22:40915698-40915720 CAGAATAGCCAGAAAGATGAAGG + Intronic
1184888819 22:47367237-47367259 AAGAGTACAGGGAAGGATGAAGG - Intergenic
1185326653 22:50228892-50228914 GAGAATAGGCAGGTGGATGATGG - Intronic
1203248675 22_KI270733v1_random:95344-95366 GAGAACACACAGAAACATGGAGG + Intergenic
950036438 3:9889287-9889309 AAGAAAACACAGGAGGCTGAGGG - Intergenic
950051492 3:9994011-9994033 GAGAAAACTCAGAATGGTGAAGG + Intronic
951444437 3:22761996-22762018 GAGAACATATAGAAGGATTAAGG - Intergenic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
952382257 3:32814812-32814834 GAGAATTGCCAGAAGGAAGATGG - Intergenic
952686668 3:36157710-36157732 GAAAATACACAGAATGAGGCTGG + Intergenic
952961514 3:38594035-38594057 GAGAAGACATAGAAGAAAGAAGG - Intronic
953628436 3:44590357-44590379 GAGAATACATAGTAAGAAGATGG - Intronic
955473229 3:59308830-59308852 GAGAGTTTTCAGAAGGATGATGG + Intergenic
955612810 3:60775687-60775709 GAGAAGACTCAGAAGGGAGAGGG - Intronic
956419151 3:69067832-69067854 GAGAATACAGATAAGCAAGAGGG - Intronic
958461124 3:94397254-94397276 ATGAAGACCCAGAAGGATGAGGG + Intergenic
958466598 3:94467528-94467550 CAGGATAGAAAGAAGGATGAAGG + Intergenic
960082448 3:113555579-113555601 GATTATAAACAAAAGGATGAAGG + Intronic
960114305 3:113878275-113878297 GAGAATACTCAAAAGGATACTGG - Intronic
960138731 3:114131476-114131498 GAGAATTCAAAGAAGGAAGACGG + Intronic
960262904 3:115588572-115588594 GAGAATAGACTGAAGGGGGAGGG + Intergenic
960891911 3:122457975-122457997 GAAAAGACACAGGAGGATGAAGG + Intronic
961492873 3:127267356-127267378 GTGAATTCACAGTAGGAAGAGGG + Intergenic
961865620 3:129951533-129951555 GAGAATACAAAGAATCAAGAAGG + Intergenic
962060329 3:131920085-131920107 ATGAATCCACAGAAGGATGTTGG - Intronic
962132873 3:132701235-132701257 GAGAAGACACAGAATGAGAAAGG - Intronic
962277664 3:134028616-134028638 CAGATTACACAAAGGGATGATGG - Intronic
963863613 3:150336179-150336201 GAGGATATACAGAAGGAGGTGGG - Intergenic
963981430 3:151542391-151542413 GACAATACACAGAAGTATATAGG + Intergenic
964477968 3:157113649-157113671 GAGAATACATAGAAGGCCTATGG - Intergenic
965196991 3:165612506-165612528 GAGACTACCAAGAAGGATGGGGG + Intergenic
965563377 3:170083254-170083276 GAGAATACAGGGAAGGAACAGGG - Intronic
965802754 3:172511527-172511549 GAGAACACAGAGAAGGAGAATGG + Intronic
966313343 3:178618419-178618441 GTGAAGACAGAGAAGGATTAGGG - Intronic
966768618 3:183484424-183484446 GGCAATACACAGAAGGCAGAGGG - Intergenic
968009381 3:195263681-195263703 GAGAAAACAGACAAGGATCATGG + Intronic
968352167 3:198066916-198066938 GAGAAAACCCAGAAGTATGCAGG - Intergenic
969916713 4:10498562-10498584 GAGAAGATATAGAAGGATAAAGG + Intronic
970291121 4:14573375-14573397 GTGAAGACACAGGAGGAAGATGG + Intergenic
970730283 4:19095137-19095159 GAGAAGAAAGAGAAGGAAGAGGG + Intergenic
970825521 4:20268529-20268551 CAGAATACACACAATGATAAAGG - Intronic
971061479 4:22976842-22976864 TAGAATATACAGGAGGAGGAAGG + Intergenic
971243311 4:24907953-24907975 GTGAAGACACAGACGGAAGAAGG - Intronic
973996487 4:56464377-56464399 GTGAATACACAAAAGTAGGAAGG + Intergenic
974832002 4:67201182-67201204 GAGAATTCACAGAAAGAAGCAGG - Intergenic
975379713 4:73685014-73685036 GAGAGGACACAGAAGCAGGAAGG + Intergenic
975817268 4:78231337-78231359 GAAAATACAGATAAGGATAAAGG + Intronic
975953222 4:79800730-79800752 GTGAAGACACAGAAAGAAGATGG + Intergenic
976443653 4:85105589-85105611 GATAGTACACAGGTGGATGATGG - Intergenic
976844110 4:89467515-89467537 GAGAATACTGAGAAGGCTAATGG - Intergenic
977104601 4:92865412-92865434 GGAAATATTCAGAAGGATGAAGG + Intronic
977119775 4:93084522-93084544 GTGAATAAACAGAAAGATGAAGG - Intronic
978416753 4:108485027-108485049 GAAAATAGACAGATAGATGAAGG + Intergenic
980135284 4:128852866-128852888 GAGAACACACATGATGATGAAGG - Intronic
980627625 4:135393858-135393880 GAGAAGACACAGCAAGATGATGG - Intergenic
980771511 4:137379330-137379352 GTGAAGACACAGGAGGTTGACGG + Intergenic
980981473 4:139658051-139658073 GAGAAAACACAAAAGGTTGGTGG - Intergenic
981156119 4:141438353-141438375 TAGAAGACACAGAGGGAAGAAGG - Intergenic
982198852 4:152940066-152940088 GAGAATACACAAAAGAACGATGG - Intronic
982481458 4:155916784-155916806 TTAAATACACAGAAGCATGACGG - Intronic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983960169 4:173742831-173742853 GTGAAGACACAGAGAGATGATGG + Intergenic
984366031 4:178801394-178801416 GAGAAAACAGAGGAGAATGAAGG + Intergenic
984535487 4:180969685-180969707 GAGAATAGATAGAAGGAGTAAGG + Intergenic
984942740 4:184948726-184948748 GAAAATACACAGAAGAATTAAGG + Intergenic
986257943 5:6116626-6116648 GTGAAGATACTGAAGGATGATGG + Intergenic
987062367 5:14254644-14254666 GAGAAGAAACAGGAGGAGGAGGG - Intronic
987593140 5:19959101-19959123 GACAAGGCAAAGAAGGATGAAGG + Intronic
988284962 5:29201661-29201683 GAGAAAACAGAGAAGCAAGAAGG + Intergenic
988421945 5:31016561-31016583 GAGAATACACAGAAAACAGAAGG + Intergenic
988586406 5:32511313-32511335 AAAAATACACAGAAGGATATGGG + Intergenic
988589685 5:32538063-32538085 GAGAAGCCACAGAGGGAAGAAGG - Intronic
989510864 5:42286515-42286537 GAGAAGACAGAGAAGGAAGCAGG + Intergenic
990014960 5:51048965-51048987 AACAGTACACTGAAGGATGAAGG - Intergenic
990258784 5:53999116-53999138 GAGAATAAAGAGAAGGCTGTAGG + Intronic
990288915 5:54329041-54329063 GAAGAGACACAGAAGGAAGATGG - Intergenic
990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG + Intergenic
991329243 5:65475404-65475426 CAGAATACAGAAAAGGATTAAGG + Intronic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
992853535 5:80836491-80836513 GAGAACACACAGAGGAATAAAGG + Intronic
993003878 5:82410566-82410588 GTGAAGACACAGAACGAAGATGG + Intergenic
993936722 5:94013603-94013625 GAAAATACAATGAAAGATGAAGG + Intronic
994311923 5:98282953-98282975 TAGGAAACACAGAAGGAAGAAGG - Intergenic
994639785 5:102393163-102393185 GAGAATGCACAGAAGGGATAAGG - Intronic
995654091 5:114405038-114405060 AAGAAAACACACAAGCATGAAGG - Intronic
995949437 5:117691906-117691928 GAGAATACCCAGAGGAATGGGGG - Intergenic
998578286 5:143341899-143341921 GAAAATACAGAGAGGGAGGAGGG + Intronic
999585536 5:153085740-153085762 GAGAATGGAGAGAAGGAAGAAGG + Intergenic
999625172 5:153512981-153513003 GAGAACACACAGCAAGATGGCGG + Intronic
1000173415 5:158726702-158726724 GAGAATCTACATAAGGATGGGGG + Intronic
1000181966 5:158820279-158820301 GCGGAGACACAGAGGGATGAGGG + Intronic
1000859026 5:166434071-166434093 GAGAAGACACGGAAGCATGCGGG - Intergenic
1001145793 5:169183306-169183328 GAGAGTACACTGATGTATGAAGG + Intronic
1002372912 5:178769031-178769053 GAGGAAACACAGAGAGATGAGGG - Intergenic
1002851762 6:1003164-1003186 GAGAAGACAGGGAAGGATGGCGG - Intergenic
1003630952 6:7786716-7786738 GAGAATACACAGAAAGAAGAAGG + Intronic
1003637519 6:7846510-7846532 GGGGAAACACAGAAGGAGGAAGG + Intronic
1003862992 6:10338767-10338789 GAGAATACCCAGATGCATCACGG - Intergenic
1005120096 6:22380120-22380142 GGGGATACAGAGAAGGAGGAGGG - Intergenic
1006697478 6:35943474-35943496 CAGAATACAGAGAAGGGAGAAGG + Intergenic
1007093205 6:39197166-39197188 GAGAAGAGACAGAAGAGTGAGGG + Intronic
1007855714 6:44854295-44854317 AAGAGTCCATAGAAGGATGATGG - Intronic
1012646189 6:101684983-101685005 GAGAAGACACAGAAGCAGGAAGG - Intronic
1013097213 6:106956492-106956514 GAGAATACAGAAAAGTATGTGGG - Intergenic
1013661844 6:112306017-112306039 GAGAATACACATATAAATGAGGG + Intergenic
1013850874 6:114513922-114513944 GAGAATAAATTGAAGCATGAGGG + Intergenic
1013976726 6:116087632-116087654 GAGAAGATACAGAAGGAACAGGG + Intergenic
1014544635 6:122719417-122719439 AAGATTACACAAAAGGGTGAAGG + Intronic
1014544659 6:122719906-122719928 AAAAATACACAGAAGGATATAGG + Intronic
1016099771 6:140084878-140084900 GTGAAGACACAGAAAGAAGATGG + Intergenic
1016895994 6:149053773-149053795 GGGAATGCACAGAAGCCTGATGG + Intronic
1016935392 6:149445870-149445892 GAGAATAAACAGAAGGAAACAGG + Intergenic
1017409207 6:154151025-154151047 GACAAGACACAGGAGGAAGAGGG - Intronic
1018653680 6:166011826-166011848 AAGCAAACACAGAAGGATGATGG + Intergenic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1020429723 7:8106620-8106642 GACTTTACACAGAAGGATGCTGG + Intergenic
1020713845 7:11644078-11644100 CACAATACACAAAAGAATGAAGG - Intronic
1020910831 7:14128235-14128257 GAGAACACACAGACACATGATGG - Intergenic
1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG + Intronic
1023456874 7:40349056-40349078 GAGGATATACAGAAGGAGGGTGG - Intronic
1023518819 7:41030454-41030476 GAAAATACACATAAAGAGGATGG + Intergenic
1023522901 7:41066652-41066674 GAGGATAGACAGAGGAATGATGG - Intergenic
1023612656 7:41986928-41986950 GAGAATAGGAAGAAGGTTGAAGG + Intronic
1024007552 7:45238221-45238243 GAGACAACAGAGAAGGCTGAAGG - Intergenic
1024141721 7:46468877-46468899 GAGAATACAGAGAGGGAAGGAGG - Intergenic
1024472709 7:49779834-49779856 GAGAAAACACAGGAAGAAGATGG - Intronic
1024689268 7:51781456-51781478 GAGATTCCAGAGAAGGGTGAAGG + Intergenic
1026771569 7:73204251-73204273 GGGAGTAAACAGAAGGATAAGGG + Intergenic
1027012435 7:74757647-74757669 GGGAGTAAACAGAAGGATAAGGG + Intronic
1027075605 7:75188406-75188428 GGGAGTAAACAGAAGGATAAGGG - Intergenic
1028210542 7:88069071-88069093 GAGCACACACAGAAGCAAGAGGG - Intronic
1028235414 7:88355300-88355322 AACAATACTCAGAAGGATAAAGG + Intergenic
1028366182 7:90035534-90035556 AAGAAAACACACAAGTATGATGG - Intergenic
1028515087 7:91669538-91669560 CAAAGTACACAGAAGGATCAGGG - Intergenic
1028705550 7:93840745-93840767 GAGATTACACGGAAGTCTGATGG + Intronic
1030995357 7:116352819-116352841 GAGTCTACACAGAAGGATGTGGG + Intronic
1031187712 7:118503923-118503945 GAGAATAGAGAGAAGAATCAAGG + Intergenic
1031313319 7:120227160-120227182 GGGAAGACACAGAGGGAAGATGG - Intergenic
1032320217 7:130879481-130879503 TAGCATATACAGAAGGATGCAGG - Intergenic
1033684967 7:143630462-143630484 AAAAATGCACAGAAGGAAGAAGG - Intronic
1033688140 7:143709681-143709703 AAAAATGCACAGAAGGAAGAAGG - Intronic
1033699646 7:143827159-143827181 AAAAATGCACAGAAGGAAGAAGG + Intergenic
1034031689 7:147773699-147773721 GAGAGTACAAAGAAGAAGGAAGG - Intronic
1034315823 7:150132046-150132068 AGGAATACACAGAGGCATGAGGG + Intergenic
1034377680 7:150660185-150660207 GAGAATTCAGAAAAGGATAAAGG - Intergenic
1035030784 7:155857320-155857342 GATAATCCACAGCAGGGTGAGGG + Intergenic
1035987347 8:4449471-4449493 CATATTACACTGAAGGATGATGG - Intronic
1036048537 8:5170276-5170298 GAGAAGTCACAGGAGGATGAGGG + Intergenic
1036098219 8:5748875-5748897 GAAAATAGACTGAATGATGAAGG + Intergenic
1036188839 8:6650852-6650874 GAGAAGAGACAGAAGGAAGGAGG - Intergenic
1036425176 8:8638752-8638774 GTGTATACACAAAAGGCTGAAGG + Intergenic
1038364624 8:26918539-26918561 GAGAATTCTCAGAAGGTTAAAGG + Intergenic
1038844722 8:31217773-31217795 GAGAATACAAAGAAAGATTTGGG + Intergenic
1038901264 8:31846699-31846721 GGGAATACAATGAAAGATGAGGG - Intronic
1039567287 8:38560439-38560461 GAGAATGCACAGGGGGATGCGGG - Intergenic
1039861028 8:41457823-41457845 CAGCATACACTGAAGGATGAAGG - Intergenic
1041347883 8:56920442-56920464 GAGAAGACGGAGAAGGAGGAAGG + Intergenic
1041472012 8:58221074-58221096 GAGAATAAAAAGAAAAATGATGG - Intergenic
1042097296 8:65230943-65230965 GAGAGTTCACAGCAGGTTGATGG - Intergenic
1042365663 8:67933733-67933755 GAAAATACACAGAAGAGAGAAGG + Intergenic
1042987756 8:74603219-74603241 GAAACTACACAGATGGATCATGG + Intronic
1043075256 8:75690744-75690766 GAGAGTACAGAGATGGAGGAGGG - Intergenic
1043636762 8:82393977-82393999 GAAAATACAAAGTAGAATGATGG - Intergenic
1044122115 8:88410841-88410863 GAGGAAACACAGAAGGTGGATGG + Intergenic
1044357296 8:91237853-91237875 GAGAAAACAAAGAAAGATGAGGG - Intronic
1044564205 8:93646068-93646090 GAGAATACACACCAGGGAGAAGG + Intergenic
1044916180 8:97114752-97114774 CAGATTTCACTGAAGGATGAAGG - Intronic
1046037765 8:108864601-108864623 GAAAATTAACAGAGGGATGAAGG + Intergenic
1046208070 8:111029978-111030000 AAGAATATACATAAGGATTAAGG - Intergenic
1046252908 8:111656314-111656336 GTGGATACACAGAATGCTGAAGG + Intergenic
1046273564 8:111927230-111927252 GAGAGACCACAGAAGGATTATGG + Intergenic
1046766458 8:118074835-118074857 GAGAAAAAAAAGATGGATGAGGG + Intronic
1047033017 8:120904117-120904139 GAGTATACACAGATGAATAAGGG + Intergenic
1047071316 8:121347065-121347087 GAGACAACACAGAAGGTTGAGGG - Intergenic
1047566399 8:126048110-126048132 GGGAATCCACAGAAACATGAAGG - Intergenic
1047767666 8:128002636-128002658 GAGAGGACACAGGAGGATGGAGG - Intergenic
1047846226 8:128808390-128808412 GAGAATAAAGGGAAGGAGGACGG - Intergenic
1048075142 8:131061831-131061853 GGGAAGACAGAGAAGGAAGAAGG - Intergenic
1048149896 8:131884038-131884060 GAAGATAACCAGAAGGATGAAGG + Intergenic
1048527809 8:135219952-135219974 CAGGATACACAGAAGGATGCAGG + Intergenic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1048997965 8:139805795-139805817 GAAAATACACAGAACGAAGAAGG + Intronic
1049495383 8:142928511-142928533 GAGAATTCCCAGCAGGGTGAGGG - Intergenic
1051051435 9:12936977-12936999 TATAATACACAGAAAGAGGATGG - Intergenic
1051865856 9:21681554-21681576 GAGAAAACAAGGAAGGAAGAGGG + Intergenic
1052302643 9:26971486-26971508 AAGAAAACACAGAAGGAAAATGG - Intronic
1056409761 9:86313343-86313365 GGGAATACACAGAAGAAGCAAGG + Intronic
1056980297 9:91303833-91303855 GAGAATATACATTAGGATGAAGG - Intronic
1057154118 9:92825379-92825401 GAGAAAACTCAGAAGCATGCAGG + Intergenic
1057560955 9:96127351-96127373 GAGAATAGGCACACGGATGAGGG + Intergenic
1059252200 9:112895688-112895710 ATGAATAGACAGATGGATGATGG - Intergenic
1059728008 9:117028202-117028224 GTGAATAAACAGAAGGTTCAAGG + Intronic
1060273152 9:122161787-122161809 GAAAATACACAGAAGGCCAAAGG - Intronic
1060482095 9:124022634-124022656 GAGGTGACACAGAGGGATGACGG + Intronic
1060991088 9:127849572-127849594 GAGATTTCACCTAAGGATGAAGG + Intronic
1061572889 9:131488561-131488583 AAGAATAAAGAGATGGATGAGGG - Intronic
1062652777 9:137586842-137586864 CAAAATACACAGAAGCATCAGGG + Intronic
1203465075 Un_GL000220v1:78592-78614 GAGAACACACAGAAACATGGAGG + Intergenic
1186902877 X:14076876-14076898 GAGAAAACATAAATGGATGATGG - Intergenic
1187296206 X:18003308-18003330 AAGAATACACAGACGGAAAATGG - Intergenic
1187654357 X:21453359-21453381 GAGTTTAAACAGAAGGATGTGGG + Intronic
1188179295 X:27034401-27034423 GTGAACACACTGAAGGGTGAGGG + Intergenic
1188280605 X:28263224-28263246 GAGAACACACAGACGTAGGAAGG - Intergenic
1189986869 X:46561299-46561321 GAAAATCCAAAGAAGGCTGAGGG - Intergenic
1190154202 X:47974285-47974307 GAAAAGCCACAGAAGCATGAGGG + Intronic
1194027595 X:88772516-88772538 GAGAATGCACAGCAAGATGGTGG - Intergenic
1194055160 X:89122911-89122933 GAGATGACACAAAAGAATGAAGG - Intergenic
1194265198 X:91744453-91744475 GAGAAGACAGAGAAAGATGGTGG - Intergenic
1194793328 X:98178503-98178525 GAGAATACAAAGTAGAATCATGG - Intergenic
1194904493 X:99557886-99557908 GGGCATGCATAGAAGGATGATGG + Intergenic
1197841541 X:130752927-130752949 GAGAACACACAGAAGGAGCAAGG - Intronic
1197854561 X:130901683-130901705 GAGAACACAAAGAAGTGTGATGG - Exonic
1197923847 X:131626064-131626086 GAGAATTTAAAGAAGGAGGAGGG + Intergenic
1198839767 X:140843912-140843934 GAGAACTCACAGAAGAATGATGG + Intergenic
1199266513 X:145834075-145834097 GAGAATTCGCAGAAGCATGGAGG - Intergenic
1199516987 X:148689146-148689168 GTGAAGACACAGAAAGAAGATGG - Intronic
1199652476 X:149960189-149960211 GAGAACACACAGCAAGAAGATGG - Intergenic
1200326079 X:155240996-155241018 CAGAATACACAGAAATATCAAGG - Intergenic
1200582350 Y:4964901-4964923 GAGAAGACAGAGAAAGATGGTGG - Intergenic
1200821755 Y:7591505-7591527 GAGAAAACAGTGAAAGATGATGG + Intergenic
1201056910 Y:10003053-10003075 GAGAAAACAGTGAAAGATGATGG - Intergenic
1201965103 Y:19724168-19724190 GAGAATACACAGACACATAAGGG + Intronic
1202103779 Y:21339760-21339782 GAGAAAACAGTGAAAGATGATGG + Intergenic
1202238550 Y:22741249-22741271 GAGAAAACAGTGAAAGATGATGG - Intergenic
1202304258 Y:23451580-23451602 GAGTATACAGAGGAGGAGGATGG + Intergenic
1202566552 Y:26219011-26219033 GAGTATACAGAGGAGGAGGATGG - Intergenic