ID: 1126577338

View in Genome Browser
Species Human (GRCh38)
Location 15:50210040-50210062
Sequence CTTTGAATACAGCTGAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 179}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126577330_1126577338 26 Left 1126577330 15:50209991-50210013 CCAACAGGAAGGAAGCCAGTTGC 0: 1
1: 0
2: 1
3: 19
4: 222
Right 1126577338 15:50210040-50210062 CTTTGAATACAGCTGAAGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 179
1126577333_1126577338 4 Left 1126577333 15:50210013-50210035 CCTTCCTGAAGGCTGAGAAATTG 0: 1
1: 0
2: 1
3: 37
4: 244
Right 1126577338 15:50210040-50210062 CTTTGAATACAGCTGAAGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 179
1126577329_1126577338 27 Left 1126577329 15:50209990-50210012 CCCAACAGGAAGGAAGCCAGTTG 0: 1
1: 0
2: 1
3: 21
4: 242
Right 1126577338 15:50210040-50210062 CTTTGAATACAGCTGAAGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 179
1126577332_1126577338 11 Left 1126577332 15:50210006-50210028 CCAGTTGCCTTCCTGAAGGCTGA 0: 1
1: 0
2: 2
3: 35
4: 241
Right 1126577338 15:50210040-50210062 CTTTGAATACAGCTGAAGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 179
1126577334_1126577338 0 Left 1126577334 15:50210017-50210039 CCTGAAGGCTGAGAAATTGCAGG 0: 1
1: 0
2: 1
3: 25
4: 254
Right 1126577338 15:50210040-50210062 CTTTGAATACAGCTGAAGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126577338 Original CRISPR CTTTGAATACAGCTGAAGGT GGG Intronic
900585628 1:3431091-3431113 CTTTGACCACACCCGAAGGTGGG + Exonic
901739039 1:11330366-11330388 CTGTGACTACAGCAGAAGGGAGG + Intergenic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
907675167 1:56511264-56511286 CTCTGACTCCAGGTGAAGGTGGG - Intronic
908342687 1:63198218-63198240 CATTGAAAACAGCAGAGGGTTGG - Intergenic
909113134 1:71504609-71504631 CTTTTAATAAATTTGAAGGTGGG + Intronic
913153250 1:116066635-116066657 ATACGAATACACCTGAAGGTCGG - Exonic
915797811 1:158755317-158755339 CTTTGTATCCAGCTGACAGTTGG + Exonic
920957101 1:210629712-210629734 CTTTGAAAACAGAGGAAGGAAGG - Intronic
921363707 1:214354106-214354128 CTTTGTAGACTGCTGAGGGTGGG - Exonic
922382989 1:225052180-225052202 CTTTGAATACAGATGAATATTGG + Intronic
924404634 1:243730234-243730256 CCTTGAGTCCAGCTGAAGCTGGG - Intronic
1063009838 10:2011415-2011437 CTTTGATAACAGCTGGTGGTTGG + Intergenic
1063337848 10:5233954-5233976 CTGGGAATACAGCTATAGGTGGG + Intergenic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1063841381 10:10075876-10075898 CTTTAAAGGCAGATGAAGGTGGG - Intergenic
1068252135 10:54456235-54456257 CTGTGAAAGCAGCTGAAGGGGGG + Intronic
1068388617 10:56362554-56362576 CTATAAATACTGCTGAAGTTTGG - Intergenic
1068688054 10:59889477-59889499 CTTTGTGGACAGCAGAAGGTTGG - Intronic
1069070617 10:63987638-63987660 ACTAGAATACAGATGAAGGTTGG + Intergenic
1071379891 10:85048021-85048043 CTCTGTATAAAGCTGAAGCTAGG + Intergenic
1072438322 10:95433265-95433287 CTGTGAAGACAGCTGAGGCTCGG - Intronic
1073679601 10:105688043-105688065 CTTTGACTACAGCTGCAGAAGGG + Intergenic
1074131384 10:110580808-110580830 TTTTTAATACACATGAAGGTTGG - Intronic
1074799021 10:116980094-116980116 CTTTGATTAAAGATGAATGTGGG - Intronic
1080126492 11:28740593-28740615 CCTTGAATACAGCTGACTTTAGG + Intergenic
1083423599 11:62570849-62570871 CTTGGAAAACAGCTAGAGGTGGG - Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085867229 11:80308705-80308727 CTGTGACTACAGCTGCTGGTGGG - Intergenic
1086048815 11:82565021-82565043 CTATAAATAGAGCTGAAGTTTGG - Intergenic
1086127991 11:83369456-83369478 CTTTGAATACAACAGGAGGCAGG + Intergenic
1087268929 11:96091479-96091501 TATTGAATAAAGCTGGAGGTGGG - Intronic
1087600418 11:100307612-100307634 CTTTTAAGACAGGTGCAGGTGGG - Intronic
1090149669 11:124369564-124369586 CTTTGGATACAGGTGATTGTTGG - Intergenic
1091314346 11:134600896-134600918 TTTGGAATACAGTTGATGGTGGG + Intergenic
1091615906 12:2051608-2051630 TTCTGAATTCACCTGAAGGTAGG + Intronic
1091870568 12:3887159-3887181 CTATGAATGCAGCTGAAATTTGG + Intergenic
1096436456 12:51594181-51594203 CTTTGAATACATCCGTTGGTAGG + Intronic
1097773631 12:63620330-63620352 CTTCTAATTCAGCTGAATGTTGG - Intronic
1097877585 12:64657735-64657757 CTTTTAATCCAGAGGAAGGTTGG + Intronic
1100410873 12:94318137-94318159 CTAGGAATACAGCTAAATGTGGG - Intronic
1101458585 12:104864258-104864280 CTTTGTATAAAGCTGAAAGGAGG - Intronic
1102601179 12:114031980-114032002 CATTGAATAAAATTGAAGGTGGG + Intergenic
1107466119 13:40652208-40652230 ATTTGAATACAGGAGAAAGTGGG - Intronic
1112333977 13:98498951-98498973 CTTTGAAAACAGCTTCAGGCAGG + Intronic
1114504175 14:23196331-23196353 CTTGGAAGCCAGCTGGAGGTTGG - Intronic
1114919432 14:27308021-27308043 CTTTGAATAGAACGGAAGGCAGG - Intergenic
1117620149 14:57577313-57577335 CTTTGAAAACAGCTATAGTTTGG + Intronic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1120060168 14:79973169-79973191 CTTTGAAAAGAGCTGCTGGTTGG - Intergenic
1121175992 14:91891006-91891028 CTCTGAATATGGCTGAGGGTAGG - Intronic
1121691494 14:95880675-95880697 CCTTGAACTCAGCTGAAGCTGGG + Intergenic
1121743618 14:96270767-96270789 CTTTGAATGCAGCTGAGAGCTGG - Intergenic
1122257669 14:100490952-100490974 CTTTGAATGCAGATGAGAGTAGG + Intronic
1126577338 15:50210040-50210062 CTTTGAATACAGCTGAAGGTGGG + Intronic
1127431174 15:58910241-58910263 ATTTGAAAACAGCTGAAGCGAGG + Intronic
1130369379 15:83271343-83271365 GTTTGAACACAGCTGCAGCTAGG + Intronic
1132405553 15:101540203-101540225 CTTTGAACACTGCAGAGGGTGGG - Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1136901311 16:34041231-34041253 CTTAGAATACACCTGATGCTGGG - Intergenic
1138336832 16:56260083-56260105 CTTTGACTACAGCTGATGTCAGG + Intronic
1138472093 16:57245663-57245685 CTTTGCTGACAGCTGAGGGTTGG - Intronic
1138781376 16:59792125-59792147 CTTTGAAAACATTTGAAGGGTGG + Intergenic
1139120194 16:64007119-64007141 ATTTGAATATATTTGAAGGTGGG + Intergenic
1139713688 16:68795861-68795883 CTTTGAATAAAGCTAAATGCAGG + Intronic
1140198389 16:72874877-72874899 CTATGAAGACAGCAGAAGGTGGG - Intronic
1140419969 16:74811337-74811359 CTTTGAATAGAGCGGGAGGCAGG - Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1146495965 17:33322600-33322622 TTCTGTATACAGCTCAAGGTAGG - Intronic
1150121653 17:62608465-62608487 CCCTGAATACAGATGAAGCTGGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150721764 17:67619653-67619675 CTTTGATCAGAGATGAAGGTGGG - Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1157051588 18:44172362-44172384 CTTTGAATATGTCTTAAGGTGGG + Intergenic
1157240898 18:46008601-46008623 TTTAGAATACAGCTTAAGGCTGG - Intronic
1159150924 18:64522863-64522885 CTTTGATTCCAGATGAAAGTGGG + Intergenic
1159545049 18:69830318-69830340 CTTTAAATACAGTTGTATGTGGG - Intronic
1159824593 18:73191065-73191087 CTTTGAAGACCATTGAAGGTTGG - Intronic
1164595147 19:29527200-29527222 CTGTGAATGCAGCTGGGGGTGGG - Exonic
925575215 2:5353000-5353022 CTTTGATCACAGGTGCAGGTTGG + Intergenic
926811071 2:16755873-16755895 CTATGCAAACAGCTGAAGATGGG + Intergenic
928242893 2:29601934-29601956 CTCTGAGGACACCTGAAGGTGGG + Intronic
928628360 2:33164401-33164423 CTATGAATAAATCTGAAGTTTGG + Intronic
930050347 2:47210864-47210886 TTTTGAATTCAGCTGAAAGAGGG - Intergenic
933124350 2:78585705-78585727 ATATGATTACTGCTGAAGGTAGG + Intergenic
933615868 2:84482011-84482033 CTTTGAAAACGGCTGCAGGGTGG - Intergenic
934116477 2:88801364-88801386 ATTTGGTTACAGCTGAATGTTGG + Intergenic
934626135 2:95855185-95855207 ATTTGGTTACAGCTGAATGTTGG - Intronic
934807434 2:97246130-97246152 ATTTGGTTACAGCTGAATGTTGG + Intronic
934830076 2:97511057-97511079 ATTTGGTTACAGCTGAATGTTGG - Intronic
937740139 2:125341724-125341746 GCTTGAAAGCAGCTGAAGGTTGG - Intergenic
938196904 2:129336299-129336321 ATGTGAATCCAGCTGAAGTTGGG - Intergenic
939306319 2:140416092-140416114 TTGTGAATACAGATGAAGCTTGG - Intronic
1170029316 20:11928285-11928307 CTTTAAATACATCTGTATGTAGG + Intergenic
1172708582 20:36902101-36902123 GGATGAATACAGCTGGAGGTGGG + Intronic
1178305494 21:31487192-31487214 GTCTGAAAACAGCTGGAGGTGGG + Intronic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178784399 21:35639318-35639340 ATTTTAACACAGCTGTAGGTTGG + Intronic
1179651600 21:42813064-42813086 CTTTGAATACAATGAAAGGTAGG + Intergenic
1179979195 21:44887675-44887697 CTTTGAGGACAGGTGAAGGAAGG - Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1183112680 22:35662400-35662422 CTTTGAATAGAGTGGGAGGTGGG - Exonic
949672885 3:6420174-6420196 CTTTGAATACTGCAGATGTTTGG + Intergenic
957540822 3:81566754-81566776 AAATGAATACAGGTGAAGGTTGG - Intronic
960584484 3:119308471-119308493 CTTTGAAGACAGATGGAGGAAGG - Intronic
963704512 3:148669368-148669390 ATTTGAACACAGATGTAGGTAGG - Intergenic
970320115 4:14867229-14867251 CTTTGATAACAGGTGAAGCTCGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974341272 4:60617318-60617340 CTTAGGCTAGAGCTGAAGGTAGG + Intergenic
976625348 4:87174577-87174599 CTTTTAATAAAACTGCAGGTGGG - Intronic
976637401 4:87300708-87300730 CTTTGCATACAGTTGAAGATTGG + Intergenic
979285322 4:118917030-118917052 TTTTGAAAACAGCAGAAGGGCGG - Intronic
979930191 4:126619962-126619984 TCTTGAAGACAGCAGAAGGTTGG - Intergenic
980937506 4:139240365-139240387 CTTTGAATAGAGCGGGAGGCAGG + Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
982647300 4:158039768-158039790 TCTTGAATACAGCAGAAGGATGG - Intergenic
983877166 4:172891096-172891118 TCTTGAAGACAGCAGAAGGTTGG + Intronic
984632699 4:182077434-182077456 CTTTGACTTCAGCTGAAGCAGGG - Intergenic
985622043 5:960861-960883 CTGAGAAGACAGCTGAAGCTTGG - Intergenic
986457419 5:7933298-7933320 TTCTGAATACAGTTGAAGATTGG + Intergenic
987097183 5:14560401-14560423 CTTGGAAAACAGCAGATGGTCGG + Intergenic
990756404 5:59076042-59076064 CTTTGAATAAACCAGAAGGAAGG + Intronic
992465823 5:77002982-77003004 CACTGAATTCTGCTGAAGGTAGG - Intergenic
992546416 5:77818111-77818133 CTTTGAAAATAGCTGAGGCTGGG - Intronic
994493001 5:100472176-100472198 CTTTGAAGACAGCAAAAGGTAGG - Intergenic
994596118 5:101837806-101837828 TCTTGAAGACAGCAGAAGGTTGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994818487 5:104616192-104616214 CTGTGAAAACTGCTAAAGGTGGG - Intergenic
996331327 5:122332463-122332485 GTTTGGATACAGGTGAAGGCGGG + Intronic
999132765 5:149297154-149297176 CCTTGAAAACAGCTAAAGTTTGG + Intronic
999606591 5:153323594-153323616 CTCTGAAGACAGCTGAAGATAGG - Intergenic
1001865261 5:175098436-175098458 CTTTGAATATAGCTGGGGGCTGG - Intergenic
1002696640 5:181096666-181096688 TGTTGAATACAGGTGAATGTAGG - Intergenic
1002697982 5:181102707-181102729 TGTTGAATACAGGTGAATGTAGG + Intergenic
1005086226 6:22009593-22009615 CTTTGAATCCATCTAAAAGTAGG - Intergenic
1006786160 6:36668775-36668797 CTCTGACTGCAGCTGGAGGTAGG - Intergenic
1006929425 6:37678738-37678760 CTCAGAAGACAGCTGAAGGAAGG - Intronic
1009933117 6:70200214-70200236 CTTTGAATACAGCTTGTGGATGG + Intronic
1012597739 6:101059610-101059632 TTATGAGTATAGCTGAAGGTGGG + Intergenic
1013055871 6:106582423-106582445 CTAAGAATACAGCTGAAAGGTGG + Intronic
1014516348 6:122383550-122383572 CTATGAATACAGCTAACGGGGGG - Intergenic
1016256242 6:142109113-142109135 CTATGAAAACAGCTGAAGCAGGG - Intergenic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1020627634 7:10601550-10601572 CTTTAAATACGGTTTAAGGTTGG + Intergenic
1023308952 7:38862944-38862966 CTTTGAGTTCAACTGTAGGTTGG - Intronic
1024328093 7:48128913-48128935 CTTTGAATACCACTGCTGGTAGG + Intergenic
1025017305 7:55449588-55449610 CCCTGAAGGCAGCTGAAGGTTGG + Intronic
1026265189 7:68790293-68790315 ATATGAATACAGCTGAACCTGGG - Intergenic
1027929008 7:84507059-84507081 CTTTGAAAACACCTGAATGGAGG + Intergenic
1028225249 7:88243599-88243621 TTTTGAAAAAAGCTGAAGGCTGG + Intergenic
1032417161 7:131744635-131744657 CTGTGGAGACTGCTGAAGGTTGG - Intergenic
1033008364 7:137591893-137591915 ATTTGATGGCAGCTGAAGGTGGG - Intronic
1035919702 8:3663552-3663574 CTTTGAATAGAGTTGGAGGCAGG - Intronic
1036954711 8:13175036-13175058 TTTTGAATACAGTGAAAGGTAGG + Intronic
1037336679 8:17799160-17799182 CTTGAAATACAGTTGATGGTTGG - Intronic
1037604223 8:20423839-20423861 CATTGGAGACAGCTGAAGGAAGG + Intergenic
1038506507 8:28089545-28089567 ATTTGAATACAGTTAAAAGTGGG - Intergenic
1038674195 8:29608675-29608697 CTTTGAATAAAACCGGAGGTAGG + Intergenic
1039705588 8:40003457-40003479 CTATGAATAAAGCAGAAGATAGG - Intronic
1042879643 8:73472787-73472809 CCCTTAATACAGCCGAAGGTGGG - Intronic
1044058902 8:87608296-87608318 GTTTGAATACAACTGAAATTTGG + Intronic
1044172329 8:89070421-89070443 TATTGAAGACAGCTGATGGTTGG + Intergenic
1045502681 8:102755566-102755588 CTTTGAAAACAACTGCAGCTTGG + Intergenic
1045685766 8:104710012-104710034 CACTGAAAACAGCTGAAGGATGG - Intronic
1045691995 8:104768993-104769015 CTTTTGATACAGCTGGAGATAGG - Intronic
1046477535 8:114766331-114766353 CTTTGAATTTAGCTCAATGTAGG + Intergenic
1047116893 8:121852939-121852961 CCTTGAAGACAGCAGAAGGTTGG - Intergenic
1047504997 8:125472489-125472511 TTTTGAATTTAGCTGAAGCTCGG - Intergenic
1050545604 9:6706293-6706315 CTTTGAATACAGTGGGAGGCAGG + Intergenic
1051309852 9:15758180-15758202 CCTTGAAAACAGCTGGAGGAAGG + Intronic
1051798603 9:20905216-20905238 CTTCAACCACAGCTGAAGGTGGG - Intronic
1052342189 9:27374929-27374951 ATTTGATTACAGCAGATGGTGGG + Intronic
1057522812 9:95773239-95773261 GTTTGAATTCAGCTGAGGCTGGG - Intergenic
1060935406 9:127512074-127512096 CTTTGAATAGAACGGGAGGTGGG - Intronic
1061100990 9:128492348-128492370 CTTTGGATAGAGTTGAGGGTAGG + Intronic
1203583360 Un_KI270746v1:36469-36491 ATTTGGTTACAGCTGAATGTTGG + Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1187489159 X:19734691-19734713 GTTTGCCTAAAGCTGAAGGTGGG - Intronic
1189878344 X:45461322-45461344 TCTTGAAGACAGCAGAAGGTTGG + Intergenic
1192615739 X:72620277-72620299 CTGTGAATACAACTGAAGGAGGG + Intronic
1195880932 X:109591854-109591876 ATTTGAAATCATCTGAAGGTGGG + Intergenic
1196382805 X:115110342-115110364 CTTTGAATAGAACTGGAGGTAGG + Intergenic
1196763828 X:119224746-119224768 CAGAGAATACAGCTGCAGGTAGG + Intergenic
1197582467 X:128300598-128300620 CCTTGAAGACAGCAGAAGGTTGG - Intergenic
1197584764 X:128331878-128331900 TTTTGAACACAGCAGAAGGTTGG + Intergenic
1198379210 X:136068422-136068444 GTTTGAAGACAGCTCAAGGCCGG + Intergenic
1199887163 X:152031606-152031628 CTTTGAATACAGTGGGAGGCAGG + Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic
1201629775 Y:16058098-16058120 ATTTGAATATAGATGAAGATAGG - Intergenic