ID: 1126580083

View in Genome Browser
Species Human (GRCh38)
Location 15:50234684-50234706
Sequence GGCAAATCAAGGCTGCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 733
Summary {0: 1, 1: 3, 2: 16, 3: 142, 4: 571}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126580083 Original CRISPR GGCAAATCAAGGCTGCAGTG AGG Intronic
900044690 1:495951-495973 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
900066093 1:730857-730879 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
900066490 1:734265-734287 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
900066887 1:737672-737694 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
900613069 1:3552623-3552645 GGGAGTTCAAGGCTGCAGTACGG + Intronic
901484638 1:9550083-9550105 AGGAGGTCAAGGCTGCAGTGAGG - Intronic
901528562 1:9839577-9839599 AGAAGGTCAAGGCTGCAGTGAGG - Intergenic
901591501 1:10347782-10347804 GGCAAGGCAAGCCTGCTGTGTGG - Exonic
901732294 1:11288837-11288859 AGCAGGTCGAGGCTGCAGTGAGG + Intronic
901986360 1:13078432-13078454 AGGAAATTGAGGCTGCAGTGAGG - Intergenic
901995452 1:13148335-13148357 AGGAAATTGAGGCTGCAGTGAGG + Intergenic
902017908 1:13323142-13323164 AGGAAATTGAGGCTGCAGTGAGG - Intergenic
902028527 1:13403142-13403164 AGGAGGTCAAGGCTGCAGTGAGG + Intergenic
902127966 1:14233202-14233224 AGGAAACCGAGGCTGCAGTGAGG - Intergenic
902570944 1:17346714-17346736 GGCAAAGCAAGGCAGTGGTGGGG - Intronic
902667591 1:17950509-17950531 AGGAGGTCAAGGCTGCAGTGAGG - Intergenic
902717930 1:18285368-18285390 AGCAAATCTAGGCTGCAGCCAGG - Intronic
903280928 1:22249376-22249398 GGCAAAGAAAGGCAGCTGTGGGG - Intergenic
903640675 1:24857773-24857795 GGCAATTGAAGGCTGGCGTGAGG - Intergenic
903704930 1:25278791-25278813 GGCAGACCAAAGCTGCAGTGTGG - Intronic
903722300 1:25414530-25414552 GGCAGACCAAAGCTGCAGTGTGG + Intronic
903879084 1:26496603-26496625 AGGAGATCAAGGCTGCATTGAGG - Intergenic
904117500 1:28173576-28173598 AGGAGATCGAGGCTGCAGTGAGG + Intronic
904468292 1:30720657-30720679 GGCTAACGAAGGCTGCAGTGGGG + Intronic
904549835 1:31306738-31306760 AGGAGATCAAGGCTGCAGTGAGG - Intronic
904634246 1:31867400-31867422 AGGAGGTCAAGGCTGCAGTGAGG + Intergenic
905427802 1:37897861-37897883 AGGAGTTCAAGGCTGCAGTGAGG + Intronic
906267319 1:44442585-44442607 GGGAAGTCAAAGCTGCAGTGAGG - Intronic
906637969 1:47422542-47422564 AGGAGGTCAAGGCTGCAGTGTGG - Intergenic
906712417 1:47940795-47940817 GAGAAATAAAGGCAGCAGTGTGG + Intronic
906830940 1:49031158-49031180 GGGAGGTCAAGGCTGTAGTGAGG - Intronic
907199733 1:52716190-52716212 GGAAAGTGGAGGCTGCAGTGAGG + Intergenic
907214533 1:52851115-52851137 AGGAGGTCAAGGCTGCAGTGAGG - Intronic
907338253 1:53714987-53715009 GGGAGGGCAAGGCTGCAGTGAGG - Intronic
907469832 1:54666093-54666115 GGCACAACAAAGCTGAAGTGAGG + Intronic
907933921 1:59025279-59025301 TGGAGGTCAAGGCTGCAGTGAGG + Intergenic
908285090 1:62588811-62588833 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
908502006 1:64753124-64753146 GGAAGGTCGAGGCTGCAGTGAGG - Intronic
910196262 1:84642547-84642569 GGGAGAGCAAGGCTGCAGTGAGG + Intergenic
910447887 1:87317374-87317396 GGGAGATGAAGGCTGCAGTGAGG + Intergenic
911007923 1:93247131-93247153 AGGAACTCGAGGCTGCAGTGAGG - Intronic
912320820 1:108711189-108711211 GGGAGGTCAAGACTGCAGTGAGG + Intergenic
912775842 1:112506077-112506099 AGGAAGTCAAGGCTGCAGTGAGG - Intronic
912878148 1:113383915-113383937 GGGAGGTCGAGGCTGCAGTGAGG - Intergenic
912916109 1:113816402-113816424 GGGAGGTCAAGGCTGCAGAGGGG + Intronic
913157160 1:116111217-116111239 GGAAAATCAAGGCTGTTTTGAGG + Intergenic
913709277 1:121465184-121465206 GACATATCAAGGCTGCAGCCCGG - Intergenic
913970761 1:143414454-143414476 AGCAGGTCAAGGCTGCAGTAAGG - Intergenic
914065138 1:144240065-144240087 AGCAGGTCAAGGCTGCAGTAAGG - Intergenic
914114013 1:144726289-144726311 AGCAGGTCAAGGCTGCAGTAAGG + Intergenic
914254782 1:145952982-145953004 AGGAAGTCAAGGCTGCAGTGAGG - Intronic
914793409 1:150899360-150899382 AGGAGTTCAAGGCTGCAGTGAGG + Intergenic
914881567 1:151550852-151550874 GGGAGGTCAAGGCTGCAGTGAGG + Intronic
915030321 1:152874380-152874402 AGGAGGTCAAGGCTGCAGTGAGG + Intergenic
916047935 1:161014637-161014659 AGGAGGTCAAGGCTGCAGTGAGG + Intronic
916505499 1:165424917-165424939 AGCAAAGCATTGCTGCAGTGTGG + Intronic
917532571 1:175850066-175850088 GGGAGATTGAGGCTGCAGTGAGG - Intergenic
918436063 1:184514230-184514252 AGGAATTCAAGGCTGCAGTGAGG + Intronic
918518883 1:185392789-185392811 GGGAGATCAATGCTGCAGTGAGG - Intergenic
918556618 1:185808444-185808466 GGAAAGTTGAGGCTGCAGTGAGG + Intronic
918676270 1:187289966-187289988 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
919067483 1:192711832-192711854 GTCATCTCAAGGCTCCAGTGGGG - Intergenic
919107211 1:193168595-193168617 GGGAAATGGAGGGTGCAGTGAGG - Intronic
919636590 1:200009270-200009292 AGCAAGTTGAGGCTGCAGTGAGG + Intergenic
919729626 1:200904803-200904825 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
919969415 1:202563985-202564007 GGGAGTTCAAGGCTGCAGTGAGG + Intronic
920218115 1:204375872-204375894 GGGAAATAAAGGCACCAGTGGGG - Intronic
920337527 1:205255128-205255150 GGGAGGTCAAGGCTGTAGTGAGG + Intronic
921197789 1:212776479-212776501 GGGAGGTCAAGACTGCAGTGAGG + Intronic
921793087 1:219312215-219312237 GGCAAGTGAGGGCTGCAGAGAGG + Intergenic
922262303 1:223953322-223953344 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
922407810 1:225334794-225334816 AGGAGGTCAAGGCTGCAGTGAGG + Intronic
922733405 1:227966458-227966480 GGGAGGTCAAGGCTGCAGCGAGG - Intergenic
922746764 1:228048635-228048657 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
923261271 1:232270030-232270052 AGCAAAGCAATCCTGCAGTGGGG - Intergenic
923839875 1:237658462-237658484 GGTAGTTCCAGGCTGCAGTGAGG - Intronic
924344138 1:243058323-243058345 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
924558324 1:245136153-245136175 AGCAAATCAAAACTGCAATGAGG - Intergenic
1063132368 10:3189244-3189266 GGGACATGGAGGCTGCAGTGAGG - Intergenic
1063211833 10:3887761-3887783 GGGAGATGGAGGCTGCAGTGAGG + Intergenic
1063408043 10:5814904-5814926 AGGAGATCAAGGCTGCAGTGAGG - Intronic
1063529959 10:6821353-6821375 AGGAATTCAAGGCTGCAGTGAGG + Intergenic
1063980047 10:11445507-11445529 TGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1064097390 10:12434041-12434063 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1064212443 10:13371490-13371512 AGGAGATCAAGGTTGCAGTGAGG + Intergenic
1064493062 10:15880752-15880774 AGCAATTCAAGGCTGTAGTGCGG - Intergenic
1064516981 10:16160938-16160960 GGAAACTCCAGGCTGAAGTGGGG + Intergenic
1064778492 10:18806900-18806922 GGGAGCTCAAGGCTGCTGTGAGG - Intergenic
1065224973 10:23534213-23534235 AGGAAGTCATGGCTGCAGTGAGG + Intergenic
1065731430 10:28713083-28713105 AGGAGATCAAGGCTGCAGTGAGG - Intergenic
1065784815 10:29203362-29203384 AAGAATTCAAGGCTGCAGTGAGG + Intergenic
1065919461 10:30379641-30379663 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1066363268 10:34751674-34751696 GGGAAGTCGAGGCTGCAGTGAGG - Intronic
1066662181 10:37747632-37747654 GGGAATTGAAGGCTGCAGTGAGG - Intergenic
1066669853 10:37825509-37825531 GGGAAGTTTAGGCTGCAGTGAGG - Intronic
1066732197 10:38446741-38446763 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1068024652 10:51628240-51628262 GGGAGGTCGAGGCTGCAGTGAGG - Intronic
1068190347 10:53643432-53643454 AGGAAGTCAAGGCTGCAGGGAGG + Intergenic
1068220992 10:54045173-54045195 GACAAATCAAGGGTTCAGGGTGG + Intronic
1068223486 10:54074931-54074953 TGCAAATCAAGGCCACAATGAGG - Intronic
1068553373 10:58430931-58430953 AAGAGATCAAGGCTGCAGTGAGG - Intergenic
1068860046 10:61838794-61838816 GGGAAGTTGAGGCTGCAGTGAGG + Intergenic
1068897404 10:62222179-62222201 AGAAGTTCAAGGCTGCAGTGAGG - Intronic
1069467281 10:68652759-68652781 GGGAGATCAAGGCTGCAGTGAGG - Intronic
1069525015 10:69162062-69162084 AGCAGGTGAAGGCTGCAGTGAGG - Intronic
1069603705 10:69726501-69726523 AGGAGTTCAAGGCTGCAGTGAGG - Intergenic
1070188598 10:74090871-74090893 GGGAGTTCAAAGCTGCAGTGAGG - Intronic
1070256961 10:74821217-74821239 GGGAAGTTGAGGCTGCAGTGAGG + Intergenic
1070416985 10:76200032-76200054 GGGAGGTCAAGGCTGCAGTAAGG - Intronic
1071419915 10:85483030-85483052 TGCAAATCCAAGCTGCAATGAGG - Intergenic
1071681113 10:87706684-87706706 GGGAGTTCAAGGCTGCAGTGAGG + Intronic
1071975129 10:90947957-90947979 AGGAGATCAAGGCTGCAGTGAGG - Intergenic
1072176372 10:92926604-92926626 GGGAGTTCAAGGCTACAGTGAGG - Intronic
1072264574 10:93714771-93714793 GGGAGATGGAGGCTGCAGTGAGG + Intergenic
1072352215 10:94567834-94567856 GGGAGGTGAAGGCTGCAGTGAGG + Intronic
1072641706 10:97215919-97215941 GCCAAATGCAGGCTGCAGAGGGG + Intronic
1072649265 10:97281326-97281348 AGGAGGTCAAGGCTGCAGTGAGG + Intronic
1072675551 10:97463242-97463264 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1073462395 10:103673489-103673511 GGGAGGTCGAGGCTGCAGTGAGG + Intronic
1073559305 10:104483106-104483128 GGAAGACCAGGGCTGCAGTGGGG + Intergenic
1074329194 10:112487194-112487216 GGGAGATGGAGGCTGCAGTGAGG - Intronic
1074978369 10:118599221-118599243 GGCACATCTAGTATGCAGTGGGG + Intergenic
1075076471 10:119354472-119354494 GGAAGGTCGAGGCTGCAGTGAGG - Intronic
1075103601 10:119522948-119522970 GGGAGGTCAAGGCTGCAGTGAGG - Intronic
1075437755 10:122458184-122458206 TGCAAATGAGGGCTGCAGAGAGG + Intergenic
1075879403 10:125837498-125837520 AGGAGGTCAAGGCTGCAGTGAGG - Intronic
1076572875 10:131444077-131444099 GGTAAATGAAGGCTGCCGGGTGG - Intergenic
1076971017 11:132426-132448 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1077880011 11:6341503-6341525 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1078016709 11:7621126-7621148 TGCAAATCAACCCTCCAGTGTGG + Intronic
1078644810 11:13131127-13131149 TGCAAATCAAAACTACAGTGAGG + Intergenic
1079164833 11:18030347-18030369 AGGAATTCTAGGCTGCAGTGAGG + Intronic
1080479515 11:32631762-32631784 GGCAGATTGAGGCTGCAGTGAGG + Intronic
1080577952 11:33617066-33617088 AGGAGGTCAAGGCTGCAGTGAGG + Intronic
1083018008 11:59476451-59476473 CGGAAGTCCAGGCTGCAGTGAGG - Intergenic
1083604735 11:63971417-63971439 GGGAGGTCGAGGCTGCAGTGAGG + Intergenic
1083713266 11:64561519-64561541 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1083819594 11:65160764-65160786 TGCAAATCAAAGCAACAGTGAGG + Intergenic
1083922603 11:65788561-65788583 GGGAAATGAGGGCAGCAGTGAGG + Intronic
1084137512 11:67197244-67197266 AGGAAGTCAAGGCTGCAGGGAGG - Intronic
1084156075 11:67313255-67313277 GGGAATTCAAGGCTGCACTGAGG - Intergenic
1084289229 11:68151217-68151239 GGGAGGTCAAGGCTACAGTGAGG + Intergenic
1085089838 11:73702232-73702254 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1085110502 11:73883587-73883609 GGGAGGTGAAGGCTGCAGTGAGG - Intronic
1085487686 11:76881180-76881202 GGGAGGTCAATGCTGCAGTGAGG + Intronic
1085771774 11:79331826-79331848 GGCAAAGCAAGGATGCTGTCTGG - Intronic
1085842353 11:80027047-80027069 GGCAAATCAAAACTGCAATGAGG + Intergenic
1086819961 11:91423661-91423683 GGCAAATCAAGACTGCCCTTGGG + Intergenic
1087816101 11:102660928-102660950 GGGAGATTGAGGCTGCAGTGAGG - Intergenic
1088962815 11:114686831-114686853 TGCAAATCAAAACTCCAGTGAGG - Intronic
1089096517 11:115924294-115924316 GGAAGGTCAAGGCTGCAGTTAGG - Intergenic
1089469884 11:118712286-118712308 GGGAGGTCTAGGCTGCAGTGAGG - Intergenic
1089983244 11:122789739-122789761 AGCAAATCAAGGATACAGTTAGG - Intronic
1091429682 12:423191-423213 GGTAGGTAAAGGCTGCAGTGAGG - Intronic
1091475172 12:765472-765494 GGGAGGTCAGGGCTGCAGTGAGG + Intronic
1091571021 12:1686089-1686111 AGGAGATCAAGGCTGCAGTGAGG + Intergenic
1091769568 12:3142229-3142251 GTAAAATAAAGGCTGCAGTGAGG - Intronic
1092035142 12:5327904-5327926 AGGAGTTCAAGGCTGCAGTGAGG + Intergenic
1092168565 12:6358785-6358807 AGGAAATCAAAGCTACAGTGAGG + Intronic
1092356239 12:7797724-7797746 GGGAAGTCGAGGCTACAGTGAGG - Exonic
1092449181 12:8585857-8585879 AGGAATTCGAGGCTGCAGTGAGG + Intergenic
1093142343 12:15523868-15523890 AGGAGATCCAGGCTGCAGTGAGG - Intronic
1093457521 12:19379455-19379477 GGGAGATGAAGGCTGCAGTGAGG + Intergenic
1093740720 12:22683325-22683347 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1094078575 12:26506433-26506455 GGGAAATCAAGGCTGCAGTGAGG + Intronic
1094696921 12:32829006-32829028 GGAAAGTTGAGGCTGCAGTGAGG - Intronic
1094855416 12:34400682-34400704 GCCAAATCAAGGCGGCAGGAAGG + Intergenic
1095441851 12:42245902-42245924 GGGAAGTTAGGGCTGCAGTGAGG - Intronic
1095905521 12:47373544-47373566 AGGAGTTCAAGGCTGCAGTGAGG + Intergenic
1096203359 12:49702228-49702250 GGGAGTTCAAAGCTGCAGTGAGG + Intronic
1096285883 12:50299679-50299701 GGCAGGTCCAGGCTGCAGTGAGG + Intergenic
1097132354 12:56821810-56821832 AGGAGTTCAAGGCTGCAGTGAGG - Intergenic
1098383242 12:69891769-69891791 GGGAGGTCAAGGCTGCAATGAGG - Intronic
1099119360 12:78668728-78668750 GGGAGATTGAGGCTGCAGTGAGG - Intergenic
1099533476 12:83817045-83817067 AGGAGTTCAAGGCTGCAGTGAGG - Intergenic
1100323179 12:93516607-93516629 AGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1100647963 12:96551183-96551205 GGGAAATCAAGGCTGCAGTGAGG + Intronic
1100661280 12:96701752-96701774 GGCAAAGTGAGGCTGCAATGAGG + Intronic
1101658597 12:106746457-106746479 GGGAGGTCAAGGCTGCAGTGAGG + Intronic
1101920574 12:108929392-108929414 GGGAAGTCAAAGCTGCAGTGAGG - Intronic
1102700967 12:114839276-114839298 AGGAAGTCAAGGCTGCAGTGAGG - Intergenic
1102825028 12:115941740-115941762 AGGAAGTCAAGGCTGCAGTGAGG + Intergenic
1102900923 12:116636179-116636201 GGGAGGTCAAGGCTGCATTGAGG - Intergenic
1103090884 12:118097311-118097333 TGCAAATCAAAACTGCAATGAGG + Intronic
1103630904 12:122259968-122259990 AGGAGGTCAAGGCTGCAGTGAGG + Intronic
1104252177 12:127105477-127105499 GGGAAATCAAGGCTGCAGTGAGG - Intergenic
1104385751 12:128350359-128350381 GGCAAAGCAATGCTGTAGAGAGG + Intronic
1106034833 13:26034261-26034283 GGCAAATCAAGGCCACAGGCCGG + Intergenic
1106622251 13:31381943-31381965 AGAAGGTCAAGGCTGCAGTGAGG + Intergenic
1107152207 13:37124813-37124835 GGGAAATCGAGGCTGCAGTGAGG + Intergenic
1107184314 13:37499503-37499525 TGCAAATTAAAACTGCAGTGAGG - Intergenic
1108563570 13:51671428-51671450 TGCAAATCAAAACTGCAATGCGG - Intronic
1110198217 13:72815736-72815758 AGGACTTCAAGGCTGCAGTGAGG - Intronic
1110286899 13:73760391-73760413 AGGAATTCAAGGCTACAGTGAGG - Intronic
1110708395 13:78622367-78622389 GGGAAATCAAGGCTGCAAGTGGG + Intronic
1111091225 13:83450762-83450784 AGGAATTCAAGGCTGCAGTGAGG - Intergenic
1111664394 13:91249036-91249058 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1112009647 13:95283440-95283462 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1112539676 13:100296311-100296333 AGGAAGTCGAGGCTGCAGTGAGG - Intronic
1113036717 13:106057688-106057710 GGGAATTCAAGGCTGCAGTGAGG + Intergenic
1113261686 13:108571990-108572012 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1113341260 13:109428378-109428400 GCCAACTCAAGGCTGTGGTGAGG + Intergenic
1114204642 14:20557410-20557432 AGGAAATCAAGACAGCAGTGGGG + Intronic
1114735951 14:25044096-25044118 GGGAGGTCGAGGCTGCAGTGAGG + Intronic
1115625905 14:35191628-35191650 AGGAATTCGAGGCTGCAGTGAGG + Intronic
1116059273 14:39900035-39900057 TGCAAATCAAAGCTACAATGAGG - Intergenic
1117450152 14:55842174-55842196 AGAAGGTCAAGGCTGCAGTGAGG - Intergenic
1118825609 14:69377732-69377754 GGGAGATTGAGGCTGCAGTGAGG + Intergenic
1118870024 14:69733736-69733758 GGCAGATCCAGACTACAGTGAGG - Intronic
1119623202 14:76148547-76148569 AGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1120160797 14:81142679-81142701 GGGAGGTCAAAGCTGCAGTGAGG - Intronic
1120847748 14:89140838-89140860 GGCAAATCAAGACTGTAAGGTGG + Intronic
1121013962 14:90537099-90537121 GTCAAATCAAGCTTTCAGTGGGG - Exonic
1121716737 14:96081669-96081691 AGGAAATCATGGCTGCAGTGAGG - Intronic
1123471765 15:20560646-20560668 GGGAGGTCAAGGCTGCAATGAGG - Intergenic
1123646241 15:22439705-22439727 GGGAGGTCAAGGCTGCAATGAGG + Intergenic
1123732067 15:23155637-23155659 GGGAGGTCAAGGCTGCAATGAGG - Intergenic
1123750202 15:23353019-23353041 GGGAGGTCAAGGCTGCAATGAGG - Intergenic
1123773523 15:23554068-23554090 GGCAAATCTAGTCTGTGGTGAGG - Intergenic
1124282572 15:28376935-28376957 GGGAGGTCAAGGCTGCAATGAGG - Intergenic
1124300131 15:28534675-28534697 GGGAGGTCAAGGCTGCAATGAGG + Intergenic
1125112451 15:36049040-36049062 GGCACATCAGGGCTTCAGGGAGG - Intergenic
1125814120 15:42569377-42569399 GAGAGGTCAAGGCTGCAGTGAGG - Exonic
1126463060 15:48934363-48934385 TGCAAATCAAAGCCACAGTGAGG + Intronic
1126580083 15:50234684-50234706 GGCAAATCAAGGCTGCAGTGAGG + Intronic
1126820804 15:52501524-52501546 AGGAGTTCAAGGCTGCAGTGAGG + Intronic
1126830306 15:52596039-52596061 AGGAGATCCAGGCTGCAGTGAGG + Intronic
1126949695 15:53867901-53867923 GGGAGATCCAGGCTGCAGTGAGG - Intergenic
1127333344 15:57959944-57959966 GGCAAAACAGGGTAGCAGTGGGG - Intronic
1127386316 15:58470003-58470025 GGGAGGTCAAGACTGCAGTGAGG - Intronic
1127878692 15:63136112-63136134 GGGAGTTCAAGGCTGCAGTGAGG - Intronic
1127908120 15:63392302-63392324 AGGAGATCAAGGCTGCGGTGAGG - Intergenic
1127984130 15:64055477-64055499 GGGAGGTCAAGACTGCAGTGAGG + Intronic
1129416280 15:75383494-75383516 GGGAGGTCGAGGCTGCAGTGAGG - Intronic
1129558561 15:76540327-76540349 AGGAGTTCAAGGCTGCAGTGAGG + Intronic
1131160012 15:90099538-90099560 AGGAGGTCAAGGCTGCAGTGAGG - Intronic
1131277806 15:90996640-90996662 AGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1131788066 15:95934440-95934462 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1131871136 15:96765784-96765806 GTGAGTTCAAGGCTGCAGTGAGG - Intergenic
1131958175 15:97760279-97760301 GGAAAAACTGGGCTGCAGTGAGG - Intergenic
1132196931 15:99921116-99921138 TGCAAATCAAAACTACAGTGAGG + Intergenic
1133233707 16:4378162-4378184 GACACTTCAGGGCTGCAGTGGGG - Intronic
1133342055 16:5043130-5043152 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1133626637 16:7576004-7576026 AGGAGATCAAGGCTGCAGTGAGG - Intronic
1133983268 16:10649504-10649526 GGAAGGTCGAGGCTGCAGTGAGG - Intronic
1134440085 16:14294260-14294282 GGGAAGTCAAAACTGCAGTGAGG + Intergenic
1134877120 16:17710713-17710735 GGGAAGTCGAGGCTGCAGTGAGG + Intergenic
1135044417 16:19143073-19143095 AGGAAGTCAAGGCTGCATTGAGG + Intronic
1136126399 16:28185285-28185307 AGGAGTTCAAGGCTGCAGTGAGG + Intronic
1136132813 16:28234654-28234676 GGAAGGTCAAGACTGCAGTGTGG - Intergenic
1136775812 16:32871280-32871302 GGCTAAGCATGGCTGCATTGGGG - Intergenic
1136894805 16:33990232-33990254 GGCTAAGCATGGCTGCATTGGGG + Intergenic
1137395992 16:48116570-48116592 GGTGAACCAGGGCTGCAGTGTGG + Intronic
1137691220 16:50429396-50429418 GGGAGTTCAAGGCTGCAGTGAGG + Intergenic
1138263777 16:55644781-55644803 AGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1138554482 16:57763694-57763716 GGCATATGAAGGCTGTTGTGGGG - Intronic
1138695975 16:58813937-58813959 GGGAGGTCAAGGCTGCAGTGTGG - Intergenic
1139164083 16:64545641-64545663 AGGAGTTCAAGGCTGCAGTGAGG + Intergenic
1139552809 16:67684975-67684997 GGCAATACAAGACTGCAGTTTGG + Intronic
1139566241 16:67778790-67778812 TGCAAATCAAAACTACAGTGAGG + Intronic
1139747449 16:69086239-69086261 AGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1140082785 16:71765252-71765274 GGGAGGTCGAGGCTGCAGTGAGG + Intronic
1140145737 16:72305962-72305984 TGCAAATCAAAACTACAGTGAGG - Intergenic
1140244165 16:73233133-73233155 GGCAAATCAAGTCTGCAGCTCGG + Intergenic
1141433624 16:83984656-83984678 GGGAAGTCGAGGCTGCAGTGAGG + Intronic
1141573015 16:84945936-84945958 AGGAAATCAAGGCTGCAGTGAGG - Intergenic
1141625592 16:85259501-85259523 GGCAAAACAAGCCGGCCGTGAGG - Intergenic
1142449236 16:90165092-90165114 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1203078228 16_KI270728v1_random:1133389-1133411 GGCTAAGCATGGCTGCATTGGGG - Intergenic
1142457859 17:66789-66811 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1142458254 17:70209-70231 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1142484895 17:240597-240619 GGCTCATCCAGGCTGCAGCGTGG + Intronic
1142824961 17:2504626-2504648 GGGAGATTGAGGCTGCAGTGAGG - Intronic
1143183109 17:4996302-4996324 GGGAGGTCAAGGCTGCAGTGAGG + Intronic
1143469466 17:7163099-7163121 GGGAATTCAAGGGTGCAATGAGG - Intergenic
1143737645 17:8924149-8924171 AGGAGGTCAAGGCTGCAGTGAGG - Intronic
1144804057 17:17952461-17952483 GGAAGGTCGAGGCTGCAGTGAGG - Intronic
1144811754 17:18004838-18004860 GGCAACTGCAGGCTGCAATGCGG - Intronic
1144958205 17:19030291-19030313 GGAAAAACAAGGCTGGGGTGGGG + Intronic
1144976953 17:19144233-19144255 GGAAAAACAAGGCTGGGGTGGGG - Intronic
1145073821 17:19834835-19834857 AGGAGGTCAAGGCTGCAGTGAGG + Intronic
1145818377 17:27811920-27811942 GGCAGAAGAAGCCTGCAGTGGGG + Intronic
1146230519 17:31103946-31103968 AGGAAATTAAGGCTGCAGTGAGG + Intronic
1146821974 17:35990726-35990748 GAGAGGTCAAGGCTGCAGTGAGG - Intronic
1147803958 17:43116436-43116458 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1148149160 17:45385797-45385819 GCCAATTCCAGGCTGCAGAGAGG + Intergenic
1148196771 17:45719701-45719723 CAGAAATCAAGGCTGCAGGGAGG + Intergenic
1148238811 17:45986524-45986546 GGCCAAGCCTGGCTGCAGTGTGG + Intronic
1148244813 17:46023766-46023788 GGGAGGTCAAGGCTGCAGTGAGG + Intronic
1148287699 17:46410347-46410369 GGGAAGTTGAGGCTGCAGTGAGG + Intergenic
1148309868 17:46627927-46627949 GGGAAGTTGAGGCTGCAGTGAGG + Intronic
1148781209 17:50123166-50123188 GGCAAATTAAGGCTGCCCTGGGG - Intronic
1148857315 17:50585817-50585839 GGCACAGACAGGCTGCAGTGAGG - Intronic
1148968961 17:51462631-51462653 AGGAGTTCAAGGCTGCAGTGAGG + Intergenic
1149751583 17:59150667-59150689 GGGAGTACAAGGCTGCAGTGAGG + Intronic
1150139649 17:62717223-62717245 GGACAGTCAGGGCTGCAGTGAGG + Intronic
1150663230 17:67104818-67104840 TGCAAATCAAAACTACAGTGAGG + Intronic
1150740341 17:67774432-67774454 AGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1151211613 17:72548625-72548647 GGAAGGTCGAGGCTGCAGTGAGG + Intergenic
1151782441 17:76256307-76256329 GGGAGGTCCAGGCTGCAGTGAGG + Intergenic
1152504665 17:80740960-80740982 CGCAAATCAAAACTACAGTGAGG + Intronic
1153027461 18:684454-684476 GGGAGGTCAAGGCTGCAGTGAGG + Intronic
1153786814 18:8543046-8543068 GGAAGGTCAAGGCTGCAATGAGG + Intergenic
1154338527 18:13484534-13484556 GGAGCATCGAGGCTGCAGTGAGG + Intronic
1154994670 18:21628305-21628327 AGGAGTTCAAGGCTGCAGTGAGG + Intronic
1155136338 18:22996923-22996945 AGGAATTCGAGGCTGCAGTGAGG + Intronic
1155788843 18:29937294-29937316 TGCAAATCAAAGCCACAGTGAGG - Intergenic
1155958314 18:31972818-31972840 AGGAAGTCGAGGCTGCAGTGAGG + Intergenic
1156184966 18:34651991-34652013 GGGGGGTCAAGGCTGCAGTGAGG + Intronic
1156894319 18:42228075-42228097 GGCCAACCAAGGATGCAATGGGG + Intergenic
1156903822 18:42331434-42331456 GGGAGTTCAAGGCTGCATTGAGG + Intergenic
1157119393 18:44895039-44895061 AGGAATTCAAGGTTGCAGTGAGG + Intronic
1157257940 18:46155009-46155031 GGCAGATCAAAGCTGGATTGGGG - Intergenic
1157401884 18:47395574-47395596 TGGCAATCCAGGCTGCAGTGAGG + Intergenic
1157436994 18:47678906-47678928 GGCACATCAAGGCAGGACTGAGG + Intergenic
1157516887 18:48317657-48317679 GTCACATCGAGGCTGCTGTGAGG - Intronic
1158363502 18:56704464-56704486 TGGAGTTCAAGGCTGCAGTGAGG + Intronic
1158503347 18:58023301-58023323 AGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1158611059 18:58941533-58941555 AGGAGGTCAAGGCTGCAGTGAGG - Intronic
1158806800 18:60983471-60983493 TGAAAATTCAGGCTGCAGTGAGG + Intergenic
1159527443 18:69611228-69611250 TGCAAATTAAAACTGCAGTGAGG + Intronic
1160514180 18:79469542-79469564 GGCCAATCGAGGCAGGAGTGTGG - Intronic
1160647971 19:202715-202737 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1160997280 19:1888619-1888641 AGGAGTTCAAGGCTGCAGTGAGG + Intergenic
1161437147 19:4270457-4270479 GGGAGATTGAGGCTGCAGTGAGG + Intergenic
1161617236 19:5278289-5278311 GGGAGATTGAGGCTGCAGTGAGG - Intronic
1161820099 19:6525225-6525247 AGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1162244826 19:9391111-9391133 CAGAAGTCAAGGCTGCAGTGAGG + Intergenic
1162324514 19:9991167-9991189 GGGAAGTCAAGGCTGCAGTGAGG + Intronic
1162377622 19:10314493-10314515 AGGAGTTCAAGGCTGCAGTGAGG + Intronic
1162450335 19:10750404-10750426 GGGAGTTCAAGGCTGCAGTGAGG + Intronic
1162539808 19:11288034-11288056 GGGAAGTCGAGGCTGCAGTGAGG - Intergenic
1163690972 19:18738242-18738264 GGGAAGCCAAGGCTGCAGTGAGG + Intronic
1165376760 19:35448533-35448555 AGGAAATCAAGGCTGGAGAGTGG + Intronic
1165873356 19:38988814-38988836 AGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1165913177 19:39242394-39242416 GGCTTTTCAAGGCTGCCGTGAGG + Intergenic
1165917945 19:39272346-39272368 GGCTTTTCAAGGCTGCCGTGAGG - Intergenic
1166273801 19:41736897-41736919 TGAAGGTCAAGGCTGCAGTGAGG - Intronic
1166390361 19:42405885-42405907 GGGAGGTCAAGGCTGCAGTGAGG + Intronic
1166392513 19:42417330-42417352 AGAAGTTCAAGGCTGCAGTGAGG - Intronic
1166600659 19:44091803-44091825 GGGAGGTCAAGGCTGCAGTGGGG + Intergenic
1166793555 19:45412457-45412479 TGCAAATCAAAACTACAGTGAGG - Intronic
1166874958 19:45891360-45891382 GGGAAATCAAGGCAGCATCGAGG - Intronic
1167009702 19:46799078-46799100 AGGAGATCGAGGCTGCAGTGAGG + Intergenic
1167053146 19:47092130-47092152 GGGAGCTCGAGGCTGCAGTGAGG + Intronic
1167338799 19:48903013-48903035 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1167702391 19:51057538-51057560 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
925588771 2:5489513-5489535 TGCAAATCAAAACTACAGTGAGG + Intergenic
926047991 2:9724297-9724319 GGGAAATGCAGGATGCAGTGGGG - Intergenic
926524785 2:13965855-13965877 GACAAATGAAGCCTGAAGTGAGG - Intergenic
927152066 2:20201938-20201960 GGCCAGTCCAGGCTGCCGTGGGG - Exonic
927762985 2:25777159-25777181 CGGAGGTCAAGGCTGCAGTGGGG - Intronic
928016832 2:27664982-27665004 AGGAGGTCAAGGCTGCAGTGAGG + Intronic
928027056 2:27749047-27749069 TGCAAATGAAGGATTCAGTGAGG + Intergenic
928117348 2:28555939-28555961 GGGAGATCAAGGCTGCAGTGAGG - Intronic
928344689 2:30480678-30480700 TGGAGTTCAAGGCTGCAGTGAGG + Intronic
928466665 2:31528691-31528713 GGGAGGTGAAGGCTGCAGTGAGG + Intronic
929007753 2:37412011-37412033 GGCAAAGCAGGGATGCAGGGAGG + Intergenic
929188040 2:39115485-39115507 GAGAGGTCAAGGCTGCAGTGAGG - Intronic
929386669 2:41415947-41415969 TGCATATAAAGGCAGCAGTGGGG + Intergenic
929719866 2:44356875-44356897 GGGAGGTCGAGGCTGCAGTGAGG - Intronic
929945256 2:46366516-46366538 AGCAGACCAAGGATGCAGTGAGG - Intronic
930103808 2:47623731-47623753 TGCAAATCAAAGCTACAGTGAGG - Intergenic
931595755 2:63941295-63941317 AGCAGGTCAAGGCTGCAGTGAGG - Intronic
931724453 2:65095420-65095442 AGGACTTCAAGGCTGCAGTGAGG - Intronic
931846995 2:66214288-66214310 GGGAGTTCGAGGCTGCAGTGAGG - Intergenic
933336419 2:80965328-80965350 GGCACATCAAGTAAGCAGTGAGG - Intergenic
933479413 2:82836545-82836567 TGCAAATCAAAACTGCAATGAGG - Intergenic
933525455 2:83432295-83432317 TGCAAATCAAAGATACAGTGAGG + Intergenic
933668340 2:84983397-84983419 GGGAGGTCAAGGCTGCAGTGAGG - Intronic
933768317 2:85726394-85726416 GGGAGATTGAGGCTGCAGTGAGG + Intergenic
934115670 2:88790177-88790199 TGCAAATCAAAGCTACAATGAGG - Intergenic
934175457 2:89575381-89575403 AGCAGGTCAAGGCTGCAGTAAGG - Intergenic
934285773 2:91649744-91649766 AGCAGGTCAAGGCTGCAGTAAGG - Intergenic
934611913 2:95745373-95745395 AGGATGTCAAGGCTGCAGTGAGG + Intergenic
934627913 2:95878737-95878759 TGCAAATCAAAGCTACAATGAGG + Intronic
934726347 2:96622347-96622369 AGGATATCAAGGCTGTAGTGAGG + Intronic
934763020 2:96866633-96866655 GGCAAATCCAGGCTGCTGGGAGG + Intronic
934805654 2:97222540-97222562 TGCAAATCAAAGCTACAATGAGG - Intronic
934831869 2:97534606-97534628 TGCAAATCAAAGCTACAATGAGG + Intronic
935258699 2:101335861-101335883 GGGAAGTCAAGGCTGCAGTGAGG + Intergenic
937100234 2:119263027-119263049 GGGAAAAAAAGGCTGGAGTGAGG - Intronic
937516867 2:122665309-122665331 GAGAGATCGAGGCTGCAGTGAGG - Intergenic
937775707 2:125773137-125773159 GGCAAATCAAAACAACAGTGAGG + Intergenic
938184739 2:129220248-129220270 TGCAAATCAAAGCTCCAGTGAGG + Intergenic
938411555 2:131068941-131068963 GAAAAGTCGAGGCTGCAGTGAGG + Intronic
938879261 2:135568126-135568148 GGGAAGTTGAGGCTGCAGTGAGG - Intronic
939391703 2:141576679-141576701 AGGAAATCAAGGCTGCAGTGAGG + Intronic
939855807 2:147357295-147357317 GGCAAAGCAGGGGTGGAGTGTGG + Intergenic
940128200 2:150351719-150351741 GGGAGTTCGAGGCTGCAGTGAGG - Intergenic
940671146 2:156669763-156669785 TGGAGTTCAAGGCTGCAGTGAGG - Intergenic
940977723 2:159964952-159964974 GGGAGATAAAGGTTGCAGTGAGG + Intronic
941149280 2:161893625-161893647 AGGAGTTCAAGGCTGCAGTGAGG + Intronic
941539110 2:166760499-166760521 GGGAGATCAAGGCTGCAGTGAGG - Intergenic
941718028 2:168784148-168784170 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
942050846 2:172139406-172139428 GGGAGGTCGAGGCTGCAGTGAGG - Intergenic
943259456 2:185640280-185640302 AGGAACTCAAGGCTGCAGTGAGG + Intergenic
944399741 2:199311676-199311698 GGTAAATCATGGCTGCCATGAGG - Intronic
945086807 2:206140274-206140296 AGGAGGTCAAGGCTGCAGTGAGG + Intronic
945523153 2:210854199-210854221 TGCAAATCAAAACTGCAATGAGG - Intergenic
946843969 2:223843084-223843106 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
947013853 2:225595859-225595881 GGGAAATTAAGGCTGGAATGAGG - Intronic
947238500 2:227969345-227969367 AGGAGATCAAGGCTGCAGTGAGG + Intergenic
947762154 2:232610803-232610825 GGGATGTCAAGGCTGCTGTGAGG + Intronic
948118631 2:235512639-235512661 GGGAAATCAAGGCAGGAATGGGG - Intronic
948212391 2:236204313-236204335 GCCAAGTGAAGGCTGCATTGAGG - Intronic
948644574 2:239396047-239396069 GGAAAGTCAAGGTTGCAGTGAGG - Intronic
1168779547 20:477265-477287 AAGAAGTCAAGGCTGCAGTGAGG - Intronic
1168849621 20:967556-967578 CGCAAACCAGGGCTGGAGTGAGG + Intronic
1169044344 20:2524236-2524258 GGGAGGTCGAGGCTGCAGTGAGG + Intronic
1169221969 20:3829158-3829180 GGGCAGTCAAGGTTGCAGTGAGG - Intergenic
1169446437 20:5675754-5675776 AGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1170877550 20:20264817-20264839 GGGAGGTCAAGGCTGCAGAGAGG + Intronic
1172256476 20:33522668-33522690 AGGAGTTCAAGGCTGCAGTGAGG + Intronic
1172908630 20:38388850-38388872 GGGACATCAAGCCTGCAGTTAGG - Intergenic
1173487755 20:43454197-43454219 TGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1173491198 20:43483645-43483667 GGGAGTTCAAAGCTGCAGTGAGG + Intergenic
1174620368 20:51869665-51869687 GGGAAGTCAAGGTTGCAGTGAGG + Intergenic
1175076117 20:56375195-56375217 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1175088154 20:56478420-56478442 AGGAATTCAAGGCTGCAGTGAGG + Intronic
1175675610 20:60944224-60944246 GGGAAGTGAAGGTTGCAGTGAGG + Intergenic
1176308860 21:5139167-5139189 GGGAGGTCAAGGCTGTAGTGAGG - Intronic
1176417136 21:6483010-6483032 GGTAAGCCGAGGCTGCAGTGAGG - Intergenic
1176512061 21:7756191-7756213 AGAAGTTCAAGGCTGCAGTGAGG + Intronic
1177579969 21:23008714-23008736 AGGAGATCAAGGCTGCAGTGAGG - Intergenic
1178426812 21:32485251-32485273 GGGAAGTGGAGGCTGCAGTGAGG - Intronic
1178646174 21:34386717-34386739 AGAAGTTCAAGGCTGCAGTGAGG + Intronic
1179262890 21:39774213-39774235 CGCCAACCAAGGCTGCAATGAGG - Intronic
1179407848 21:41140143-41140165 GGCAGAGCGAGGCTGCAGAGAGG + Intergenic
1179560159 21:42210733-42210755 GGGAAATCAAGGAGGCAGGGAGG - Intronic
1179692633 21:43091343-43091365 GGTAAGCCGAGGCTGCAGTGAGG - Intergenic
1179848202 21:44122866-44122888 GGGAGGTCAAGGCTGTAGTGAGG + Intronic
1179992499 21:44955490-44955512 GACAGACCAAGTCTGCAGTGGGG - Intronic
1181064094 22:20297557-20297579 GACACATCAAGGCAGCAGTATGG + Intergenic
1181554181 22:23658172-23658194 GGCAAGTGAAGGTTGCAGTGAGG - Intergenic
1182203425 22:28597862-28597884 GGGAGCTCAATGCTGCAGTGAGG - Intronic
1182581873 22:31318516-31318538 GGGAGGTTAAGGCTGCAGTGAGG + Intergenic
1183912285 22:41089013-41089035 GGGAAGTCGAGGCTGCAGTGAGG - Intergenic
1183962531 22:41420324-41420346 GGGAGTTCCAGGCTGCAGTGAGG + Intergenic
1184162122 22:42703022-42703044 TGCCAGCCAAGGCTGCAGTGTGG - Intronic
949238509 3:1840857-1840879 GGAAAATCTAGGTTGCACTGGGG - Intergenic
949461275 3:4297442-4297464 GCCCAATCCAGGCTGCAGTACGG + Intronic
949524292 3:4888151-4888173 AGGAATTCAAGGCTGCAGTGAGG + Intergenic
950977295 3:17261593-17261615 GGGATGTCAAGGCTGCAATGAGG - Intronic
952370263 3:32715876-32715898 AGGAGATCAAGGCTGCAGTGAGG - Intronic
953745973 3:45574346-45574368 GTCCTATCAAGGCTGTAGTGTGG - Intronic
954706953 3:52486055-52486077 GGCAAATCAAGGCCTGTGTGTGG + Intronic
954844353 3:53542505-53542527 AGGAGTTCAAGGCTGCAGTGAGG + Intronic
955314502 3:57925025-57925047 GGAAGGTCAAGGCTGAAGTGAGG - Intronic
956397603 3:68842259-68842281 TGCAAATCAAAACCGCAGTGAGG - Intronic
956770225 3:72519517-72519539 GGGAGGTCGAGGCTGCAGTGAGG + Intergenic
956779860 3:72595317-72595339 GGAAGGTCGAGGCTGCAGTGAGG + Intergenic
956793002 3:72694431-72694453 GGCAGCTCAGGGCTGCAGAGAGG + Intergenic
957626733 3:82662133-82662155 GCCAAATCAAGGCTACATAGTGG + Intergenic
957779667 3:84802329-84802351 GGGAGGTCAAGGCTGCTGTGAGG + Intergenic
959048859 3:101504944-101504966 AGGAGGTCAAGGCTGCAGTGAGG + Intronic
959168391 3:102811766-102811788 GGGATGTCAAGGCTGCAGTGAGG - Intergenic
959575551 3:107929110-107929132 GGCAAGTGAGGACTGCAGTGGGG - Intergenic
960826084 3:121786096-121786118 CGCAGATAAAGGCTCCAGTGGGG + Intronic
961143281 3:124573572-124573594 GGGAGGTCAAGGCTGCAGTGAGG - Intronic
961460763 3:127048932-127048954 TGCAAATCAAAGCTGCAGCAGGG - Intergenic
961484712 3:127208703-127208725 GGAGAATCCAGGCTGCAGTGGGG + Intergenic
961868726 3:129973397-129973419 GGGAGGTCAAGGCTACAGTGAGG + Intergenic
962113918 3:132481506-132481528 GGGAAGTCAAGGCTGCAGTGAGG + Intronic
962491536 3:135898159-135898181 GGCATTTCAAGGCTGCAGTGAGG - Intergenic
962779275 3:138696253-138696275 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
963312159 3:143721143-143721165 AGGAGGTCAAGGCTGCAGTGAGG + Intronic
963993320 3:151678777-151678799 GGAGGATCAAGGCTGCAGTAAGG - Intergenic
964895300 3:161588644-161588666 GGGATATGGAGGCTGCAGTGAGG + Intergenic
965182617 3:165424129-165424151 AGGAAGTCAAGGCTACAGTGAGG - Intergenic
968094118 3:195916004-195916026 AGCAGTTCGAGGCTGCAGTGGGG + Intergenic
968232757 3:197013778-197013800 TGCAAATCAAAGCCACAGTGAGG + Intronic
968369876 3:198217400-198217422 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
968796324 4:2707800-2707822 GGGAAATAAAGTCCGCAGTGAGG - Intronic
968925315 4:3544059-3544081 GGGAGATCGAGGCTGCAGTGAGG + Intergenic
969256004 4:6002337-6002359 CGGAAATCAAGGTGGCAGTGGGG - Intergenic
970149078 4:13069902-13069924 GGGAAATCATGGCTACATTGAGG - Intergenic
970586910 4:17523137-17523159 GGAAGGTCAAGGCTCCAGTGGGG - Intronic
970600538 4:17638046-17638068 GGCAAAACAAGGCCTCTGTGAGG - Intronic
971061202 4:22972340-22972362 TGCAAATCAAAGCTACAATGAGG - Intergenic
971285563 4:25285841-25285863 TGCAAATCAAAACTACAGTGAGG - Intergenic
971809612 4:31407614-31407636 GGCCAATTAAGGCTGAAATGTGG + Intergenic
971818750 4:31524625-31524647 GCCAAATCAAGGGTGGAGTGTGG - Intergenic
972074971 4:35075966-35075988 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
972492028 4:39596846-39596868 GGGAAGTCAAGGCTGCAATGAGG - Intronic
973582263 4:52355959-52355981 GGGAACTCAAGACAGCAGTGAGG + Intergenic
973620940 4:52725004-52725026 GGCAAATCTAATCTACAGTGAGG - Intronic
973827595 4:54724227-54724249 GGCAATTTAAGGCTTAAGTGTGG - Intronic
974134988 4:57804015-57804037 GGCAAAGAAAGGCAGCAGGGTGG + Intergenic
975127265 4:70797011-70797033 GGGAAATCGAGGCTGCAGTGAGG - Intronic
975980388 4:80151626-80151648 GGCAAAACTAGGCTGGAGTAAGG + Intergenic
976017486 4:80575396-80575418 GGGAAGTCAAGGCTGCAGTGAGG - Intronic
976577045 4:86685276-86685298 TGCAAATCAAAACTGCAGTGAGG + Intronic
977235300 4:94501143-94501165 GGGAGGTCGAGGCTGCAGTGAGG - Intronic
979258585 4:118629367-118629389 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
979329771 4:119411191-119411213 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
979438777 4:120726280-120726302 GGTAAAACAAGGCTGAATTGAGG + Intronic
979475643 4:121154456-121154478 ACAAAATCTAGGCTGCAGTGTGG - Intronic
980984318 4:139681087-139681109 GGCAGGTCAAGGCTGCAGTGAGG - Intronic
981041544 4:140227447-140227469 AGCAAATCAAAGCTGAAGGGAGG + Intergenic
981313921 4:143323172-143323194 TGGAAGTCGAGGCTGCAGTGAGG - Intergenic
981555048 4:145984037-145984059 GGGAGTTCAATGCTGCAGTGAGG + Intergenic
981914430 4:150018179-150018201 GGCAATTCAATGCTGAAGTGTGG - Intergenic
982100486 4:151962434-151962456 AACAAATCAAAGCTGCAGTAGGG - Intergenic
982641521 4:157967758-157967780 GGCACATCAAGGCTGAAGAAGGG - Intergenic
983272457 4:165579058-165579080 GCCAAAACAAGGCTCCAGAGTGG + Intergenic
983592353 4:169427895-169427917 AGGAGATCAAGGCTGCAGTGAGG - Intronic
983789434 4:171777735-171777757 AGGAATTCAAGGCTGCAGTGAGG - Intergenic
983868705 4:172799308-172799330 GACTAATCTATGCTGCAGTGGGG + Intronic
984212748 4:176870530-176870552 TGCAAATCAAAACTGCAATGAGG - Intergenic
984662034 4:182384695-182384717 GACAAGGGAAGGCTGCAGTGTGG - Intronic
984846778 4:184115163-184115185 GTCAACTCATGGCTGCAGTGAGG + Intronic
985151451 4:186951139-186951161 TGCAAATCAAAGCCGCAATGAGG - Intergenic
986294946 5:6430235-6430257 TGCAAATCAAAGCCACAGTGAGG - Intergenic
987223910 5:15820244-15820266 GCCAGAGCAAGGCTGGAGTGTGG - Intronic
988265039 5:28938023-28938045 TGCAAATCAAAACTACAGTGAGG - Intergenic
988681832 5:33491027-33491049 GGGAGGTCAAGGCTGCAGTAAGG - Intergenic
989004034 5:36789780-36789802 GCCTAATTAAGGTTGCAGTGGGG - Intergenic
989038194 5:37197526-37197548 GGCCAATCAAGGTGGCAGCGGGG - Intronic
989661545 5:43804170-43804192 AGGAGTTCAAGGCTGCAGTGAGG - Intergenic
990778831 5:59335004-59335026 GGGAAATCAAGGCTGCTGGAAGG - Intronic
991301262 5:65131670-65131692 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
991359467 5:65803877-65803899 GGCCCATCTCGGCTGCAGTGGGG - Intronic
991608723 5:68428865-68428887 GACAAATCAGGGCTGCATGGTGG + Intergenic
991724122 5:69519063-69519085 GGGAGGTCAAGGCTGCAGTGAGG + Intronic
992349271 5:75912418-75912440 GGGAGGTCAAGGCTGCAGTGGGG + Intergenic
992432997 5:76727958-76727980 GGGAGATCGAGGCTACAGTGAGG - Intronic
992731382 5:79673006-79673028 GGCAAATCAAAACTGCAATGAGG - Intronic
993353253 5:86875911-86875933 GGGAGGTCAAGGCTGCAGTAAGG + Intergenic
993823429 5:92650080-92650102 TGCAAATCAAAGCCACAGTGAGG + Intergenic
993860415 5:93129749-93129771 GGGAAATAAAGGATGCAATGGGG + Intergenic
993997141 5:94736408-94736430 GGGAGGTCGAGGCTGCAGTGAGG + Intronic
994400327 5:99271780-99271802 GGAAAATAGAGGCAGCAGTGTGG - Intergenic
994509030 5:100679994-100680016 TGCAAATCAAAACTGCAATGAGG - Intergenic
994986617 5:106941575-106941597 GGCAAATAAAGGCTGAAGCAGGG - Intergenic
995114227 5:108460878-108460900 GGGAAGTCAAGGTTGCAGCGAGG + Intergenic
995260163 5:110094558-110094580 AGGAAAACAAGGCTGGAGTGTGG - Intergenic
995488666 5:112666194-112666216 GGGAGAGCGAGGCTGCAGTGAGG - Intergenic
996720275 5:126623213-126623235 AGGAATTCGAGGCTGCAGTGAGG + Intronic
997100717 5:130966027-130966049 AGGAGCTCAAGGCTGCAGTGAGG - Intergenic
997802807 5:136883709-136883731 GGGAAGCCAAGGCTTCAGTGAGG + Intergenic
998020040 5:138761825-138761847 GGGAGGTCAAGGCTGCAGTGAGG - Intronic
998864889 5:146488505-146488527 TGCAAATCAAAACAGCAGTGAGG + Intronic
999205166 5:149842397-149842419 GGCAAATGAAGGGAGCAGAGAGG + Intronic
999453763 5:151697936-151697958 AGGAGGTCAAGGCTGCAGTGAGG + Intergenic
999638650 5:153648905-153648927 GGAAAATGAAGGCTGCAGTTGGG + Intronic
1000637664 5:163662174-163662196 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1001496659 5:172192662-172192684 TGGGATTCAAGGCTGCAGTGAGG + Intergenic
1001575555 5:172761506-172761528 GGCTATTCAAGTCTGCAGTTAGG + Intergenic
1001579006 5:172785631-172785653 AGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1002147240 5:177194330-177194352 TGGAGATCAAGGCTTCAGTGAGG - Intronic
1002647966 5:180671500-180671522 GGGAGGTCGAGGCTGCAGTGAGG - Intergenic
1002729154 5:181322978-181323000 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1002970961 6:2019045-2019067 TGCAAATCAAGACCACAGTGAGG - Intronic
1003183492 6:3811346-3811368 GGCATCACAAGGCTGCATTGTGG - Intergenic
1003202381 6:3973814-3973836 GACAACTCAAAGCTGGAGTGGGG - Intergenic
1003588874 6:7420024-7420046 GGGAGATGAAGGTTGCAGTGAGG - Intergenic
1004035640 6:11920414-11920436 AGGAGTTCAAGGCTGCAGTGAGG - Intergenic
1004446183 6:15700938-15700960 AGAAAGTCAAGGCTGCAGTGAGG + Intergenic
1004916635 6:20338903-20338925 GGGAAGTCAAGGCTGCAGTGAGG + Intergenic
1005404779 6:25474952-25474974 TGCAAATCAAAGCCACAGTGAGG + Intronic
1005484679 6:26288477-26288499 GGCAATTGAAAGCTGCAGTCTGG - Intergenic
1005636517 6:27758071-27758093 GGGAAGTCGAGGCTTCAGTGAGG + Intergenic
1005673575 6:28131689-28131711 AGGAGTTCAAGGCTGCAGTGAGG - Intergenic
1005749726 6:28871596-28871618 GGCCAAACAAGGCTGCTGTAGGG + Intergenic
1006682833 6:35809574-35809596 GGGAGGTCAAGGCTGCAATGAGG - Intronic
1006699960 6:35964134-35964156 GGGAGATGGAGGCTGCAGTGAGG + Intronic
1007005453 6:38358281-38358303 AGCAAAGGAAGGGTGCAGTGTGG - Intronic
1007243262 6:40442195-40442217 GGCTAATGAAGGGAGCAGTGGGG + Intronic
1007453170 6:41955877-41955899 AGGAGGTCAAGGCTGCAGTGAGG + Intronic
1007564151 6:42835856-42835878 GGAACGTCAAGGCTGCACTGAGG + Intronic
1007725591 6:43913878-43913900 GGCAAGACAAGGCTGCAGAGAGG + Intergenic
1007835942 6:44673880-44673902 GGCAAAGGAGGGCTGGAGTGAGG + Intergenic
1008273593 6:49518092-49518114 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1009592592 6:65691294-65691316 GGCAAATCAAAACCGCAATGAGG - Intronic
1010436020 6:75831815-75831837 AGGAGATCGAGGCTGCAGTGAGG + Intronic
1011581810 6:88876440-88876462 GGGAGGTCGAGGCTGCAGTGAGG + Intronic
1012252960 6:96999321-96999343 GGGAAGTCGAGGCTGCAGTGAGG + Intronic
1013166681 6:107600297-107600319 GCCTGGTCAAGGCTGCAGTGTGG + Intronic
1013319454 6:108972734-108972756 GGGACATTGAGGCTGCAGTGGGG - Intronic
1013519861 6:110923322-110923344 AGGAGTTCAAGGCTGCAGTGAGG + Intergenic
1013986982 6:116206178-116206200 GGCAATTCCATGATGCAGTGTGG + Intronic
1015003054 6:128243619-128243641 AGGAGTTCAAGGCTGCAGTGAGG + Intronic
1015061777 6:128975337-128975359 GGCAAATAAAACTTGCAGTGGGG + Intronic
1015764729 6:136704332-136704354 GTCATATCAAGGCTTCACTGAGG + Intronic
1016036859 6:139392179-139392201 AGGAGTTCAAGGCTGCAGTGAGG + Intergenic
1016185159 6:141189675-141189697 TGCAAATCAAAACTGCAATGAGG - Intergenic
1016413695 6:143810757-143810779 AGGAAATGGAGGCTGCAGTGAGG + Intronic
1017090539 6:150755046-150755068 AGGAGATCAAGGCTGCAGCGAGG - Intronic
1017431655 6:154377112-154377134 AGGAAGTCGAGGCTGCAGTGAGG + Intronic
1018095728 6:160385653-160385675 GGCAGAGGAAGGCTGCAGGGAGG - Intronic
1018419917 6:163632072-163632094 GGAAAATCAAGCCAGCAGGGAGG + Intergenic
1019124594 6:169829879-169829901 GGCAAAACAAGGGGGCAGTGGGG + Intergenic
1019134236 6:169898178-169898200 GGCAACCCAAGGCCACAGTGGGG - Intergenic
1019692016 7:2420710-2420732 AGGAGTTCAAGGCTGCAGTGAGG + Intronic
1022235359 7:28455594-28455616 TACAAATCAAAGCTGCAGAGTGG + Intronic
1022772009 7:33483701-33483723 AGGAATTCAAAGCTGCAGTGAGG - Intronic
1023400557 7:39790671-39790693 GGGAGGTCAAGGCTGCAGTCAGG - Intergenic
1024073490 7:45806420-45806442 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1024132717 7:46371870-46371892 TGCAAATCAAAGCTACAATGAGG - Intergenic
1024649843 7:51393782-51393804 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1024904285 7:54359005-54359027 GGGAGGTCGAGGCTGCAGTGAGG - Intergenic
1025053928 7:55749114-55749136 GGGAGGTCAAGGCTGCGGTGAGG + Intergenic
1025111359 7:56219076-56219098 AGGAATTAAAGGCTGCAGTGAGG - Intergenic
1025132035 7:56379587-56379609 GGGAGGTCAAGGCTGCGGTGAGG + Intergenic
1025202115 7:56968838-56968860 GGGACATCTAGGCTGCAGTGAGG + Intergenic
1025669832 7:63608090-63608112 GGGACATCTAGGCTGCAGTGAGG - Intergenic
1026193205 7:68148698-68148720 TGAAAATCAAGGCTGCCCTGGGG - Intergenic
1026350186 7:69508819-69508841 AGGAAGTCAAGGCTACAGTGAGG - Intergenic
1026409641 7:70106645-70106667 AGGAGTTCAAGGCTGCAGTGGGG + Intronic
1026546366 7:71326384-71326406 AGTAGCTCAAGGCTGCAGTGAGG + Intronic
1026731013 7:72911962-72911984 AGGAAGTCAACGCTGCAGTGAGG - Intronic
1026948574 7:74332438-74332460 GAGAATTCTAGGCTGCAGTGAGG - Intronic
1027113071 7:75456164-75456186 AGGAAGTCAACGCTGCAGTGAGG + Intronic
1027156365 7:75771155-75771177 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1027285318 7:76640775-76640797 AGGAAGTCAACGCTGCAGTGAGG + Intergenic
1027416937 7:77983639-77983661 AGCCACTAAAGGCTGCAGTGAGG - Intergenic
1029114441 7:98230067-98230089 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1029149017 7:98467062-98467084 GGGAGGTCAAGGTTGCAGTGAGG - Intergenic
1029199258 7:98827603-98827625 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1030647640 7:112081207-112081229 GGCAATTCAAGGAAGTAGTGAGG + Intronic
1031638152 7:124127128-124127150 GGCAAATAAAGGCTTTAGTAAGG + Intergenic
1032050883 7:128650115-128650137 GGGAGGTCAAGGCTGCAGTGTGG - Intergenic
1032658098 7:133953576-133953598 GGGATGTCAAGGCTGCGGTGAGG + Intronic
1033834069 7:145287214-145287236 AGGAAGTCAAGGCAGCAGTGAGG + Intergenic
1034604541 7:152299574-152299596 AGCAGGTCAAGGCTGCAGTAAGG + Intronic
1034835049 7:154344343-154344365 TGCAAATCAAAACTGCAATGAGG + Intronic
1035155206 7:156906630-156906652 AGGAGATCAGGGCTGCAGTGAGG - Intergenic
1036492543 8:9241347-9241369 GGCAAATCATGGTTACAGTTGGG - Intergenic
1036917551 8:12819465-12819487 GGGAGGTCGAGGCTGCAGTGAGG - Intergenic
1038285761 8:26205134-26205156 GGGAGGTGAAGGCTGCAGTGAGG - Intergenic
1038300078 8:26336354-26336376 GGGAGGTCAAGGCTGCAGTGAGG + Intronic
1038348183 8:26751135-26751157 TGCAAATGAGGCCTGCAGTGTGG + Intronic
1038530317 8:28313380-28313402 GGGAAGTTGAGGCTGCAGTGAGG - Intergenic
1038571713 8:28668192-28668214 AGGAGTTCAAGGCTGCAGTGAGG + Intronic
1039046531 8:33455449-33455471 AGGAGTTCAAGGCTGCAGTGCGG + Intronic
1039717029 8:40120744-40120766 GGGAACTCAAGGCTGCAGGGAGG - Intergenic
1040293448 8:46137136-46137158 GCGAAAACAGGGCTGCAGTGTGG - Intergenic
1040299791 8:46181963-46181985 GGCAAAATAGGGATGCAGTGTGG - Intergenic
1040302483 8:46195205-46195227 GGGAAAACAGGGCTGCAGTGTGG + Intergenic
1040315379 8:46258145-46258167 TGCAAATCATGGCCGCAGTGTGG + Intergenic
1040317967 8:46274973-46274995 GTGAAAACAAGGCTGCAGGGTGG + Intergenic
1040333581 8:46404756-46404778 GCGAAAACAAGGCTGCAGGGTGG + Intergenic
1040333619 8:46404949-46404971 GCAAAAACAAGGCAGCAGTGTGG + Intergenic
1040336848 8:46420434-46420456 GCAAAAACAAGGCTGCAGTGTGG + Intergenic
1040339240 8:46432089-46432111 GCGAAAACAAGGCTGCAGGGTGG + Intergenic
1040340856 8:46439890-46439912 GCGAAAACAAGGCTGCAGGGTGG - Intergenic
1040831615 8:51683285-51683307 TGCAAATCAAAGCCACAGTGAGG - Intronic
1040879618 8:52191104-52191126 AGCAAGTCCAGGCTGCAGTGTGG + Intronic
1041022145 8:53648697-53648719 AGGAGTTCAAGGCTGCAGTGAGG - Intergenic
1041367096 8:57118267-57118289 AGGAGTTCAAGGCTGCAGTGAGG - Intergenic
1041488678 8:58408279-58408301 GACAGATTGAGGCTGCAGTGAGG + Intergenic
1041555111 8:59145101-59145123 TGCAAATCAAAGCCACAGTGAGG - Intergenic
1041659272 8:60385333-60385355 AGGAACTCAAAGCTGCAGTGAGG + Intergenic
1041843023 8:62293955-62293977 GGAACTGCAAGGCTGCAGTGAGG - Intronic
1042222654 8:66488852-66488874 GGGAGGTCAAGGCTGCAATGGGG - Intronic
1043110694 8:76176943-76176965 TGCAAATCAAGACTACAATGAGG - Intergenic
1043381657 8:79708841-79708863 TGCAAATAGAGGCGGCAGTGTGG + Intergenic
1044197725 8:89397609-89397631 GGCAAATCACGTTTTCAGTGGGG + Intergenic
1044724507 8:95182062-95182084 GGTAGGTCACGGCTGCAGTGAGG - Intergenic
1046943178 8:119950998-119951020 GGAAAGTCAAGGCTGCAGTGAGG + Intronic
1047088607 8:121547754-121547776 AGGAAGTCAAGGCAGCAGTGAGG + Intergenic
1047334298 8:123921435-123921457 AGAAGTTCAAGGCTGCAGTGAGG - Intronic
1048291708 8:133186187-133186209 GGGAAACCAAGGCAGCAGTCAGG + Intergenic
1048389444 8:133947683-133947705 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1049132632 8:140861274-140861296 AGAAGTTCAAGGCTGCAGTGAGG + Intronic
1049264825 8:141662266-141662288 GGCGAGTCAAGGGTGCAGTCTGG - Intergenic
1049866225 8:144938772-144938794 TGCAATACAAGGCTGCAGAGTGG + Intronic
1049915247 9:311310-311332 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1050629794 9:7546290-7546312 GTCAAAGCAAGGCAGCAGTGAGG + Intergenic
1053365589 9:37520405-37520427 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1053437659 9:38087485-38087507 GGGAAGTCAAAGCTGCAGTGAGG - Intergenic
1053800204 9:41759241-41759263 GGGAGATCGAGGCTGCAGTGAGG + Intergenic
1054144989 9:61555594-61555616 GGGAGATCGAGGCTGCAGTGAGG - Intergenic
1054188632 9:61971393-61971415 GGGAGATCGAGGCTGCAGTGAGG + Intergenic
1054464685 9:65486551-65486573 GGGAGATCGAGGCTGCAGTGAGG - Intergenic
1054649889 9:67617224-67617246 GGGAGATCGAGGCTGCAGTGAGG - Intergenic
1054799815 9:69335909-69335931 AGAAAGTCAAGGCTGCAGTGAGG + Intronic
1055535160 9:77234247-77234269 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1056028016 9:82520932-82520954 GTCAGATCCAAGCTGCAGTGGGG + Intergenic
1056057155 9:82837726-82837748 TGCAAATCAAATCTACAGTGTGG + Intergenic
1056316865 9:85398612-85398634 GGCAAACTAAGGCTGGAGAGGGG - Intergenic
1057230150 9:93317079-93317101 GGCAAAGCAAGTGTGCAGGGAGG - Intronic
1057359247 9:94358298-94358320 TGCAAATCAAGACCACAGTGAGG + Intergenic
1057648517 9:96899292-96899314 TGCAAATCAAGACCACAGTGAGG - Intronic
1058650166 9:107168174-107168196 GGGAGGTCGAGGCTGCAGTGGGG - Intergenic
1059075504 9:111189232-111189254 TGCAAATCAAAACTACAGTGAGG + Intergenic
1059129984 9:111736988-111737010 TGCAAATCAAAGCTACAATGAGG + Intronic
1059582887 9:115570766-115570788 GGGAGATAGAGGCTGCAGTGAGG + Intergenic
1060341518 9:122781221-122781243 TGTAAATTAAGGCTACAGTGAGG + Intergenic
1060409966 9:123393895-123393917 GGCAAAGCAAGTCCCCAGTGGGG - Intronic
1060530503 9:124344761-124344783 GGCACCTCAAGGCTGCTGCGAGG - Intronic
1060632986 9:125176582-125176604 GGGAGGTCAAAGCTGCAGTGAGG + Intronic
1060759888 9:126238231-126238253 AGGTGATCAAGGCTGCAGTGAGG + Intergenic
1060819716 9:126654316-126654338 GTGAAATCAGGGCTGGAGTGGGG - Intronic
1060966587 9:127715287-127715309 CGCAGAGCAACGCTGCAGTGGGG + Intronic
1061211314 9:129195004-129195026 GGGAGTTCAAGGCTGCAGTGAGG + Intergenic
1061516726 9:131094420-131094442 GTAAAATCAAGGCTACGGTGGGG + Intronic
1061985638 9:134128774-134128796 GGGGGATCGAGGCTGCAGTGAGG + Intergenic
1203576733 Un_KI270745v1:14858-14880 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1203577132 Un_KI270745v1:18280-18302 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1186050283 X:5584911-5584933 GGGAAGTTGAGGCTGCAGTGAGG + Intergenic
1186334924 X:8576034-8576056 GGGAGTTCAAGGCTACAGTGAGG + Intronic
1186470407 X:9817042-9817064 AGGAATTGAAGGCTGCAGTGAGG - Intronic
1186567839 X:10683467-10683489 AGGAGGTCAAGGCTGCAGTGAGG + Intronic
1187289709 X:17941423-17941445 GGTAATTCAATGTTGCAGTGAGG + Intergenic
1187375331 X:18747547-18747569 AGGAGGTCAAGGCTGCAGTGAGG - Intronic
1189383747 X:40520185-40520207 GGAAAGTCGAGGCTGCAGTGAGG + Intergenic
1189778925 X:44495412-44495434 AGGAGATCAAGGCTGTAGTGAGG - Intergenic
1190164636 X:48062865-48062887 GGGAGGTCAAGACTGCAGTGAGG + Intronic
1190164914 X:48065360-48065382 GGGAGGTCAAGGCTGCAGTGAGG + Intronic
1190629131 X:52368169-52368191 AGGAGATCCAGGCTGCAGTGAGG + Intergenic
1191729869 X:64322114-64322136 AGGAGATCAAGGTTGCAGTGAGG - Intronic
1192531140 X:71887266-71887288 GCCAAATCAAGGCTGTAAGGTGG - Intergenic
1193648022 X:84092320-84092342 TGGAAATCAAAACTGCAGTGAGG + Intronic
1195165057 X:102211304-102211326 TGCAAATCAAAACTACAGTGAGG - Intergenic
1195193801 X:102475787-102475809 TGCAAATCAAAACTACAGTGAGG + Intergenic
1195549447 X:106150514-106150536 GGGAAATTGAGGCTGCAGTGAGG + Intergenic
1195916882 X:109944534-109944556 GGGAGGTTAAGGCTGCAGTGAGG + Intergenic
1196703342 X:118695329-118695351 AGCAGGTAAAGGCTGCAGTGTGG + Intergenic
1196715681 X:118808854-118808876 AGGAATTGAAGGCTGCAGTGAGG - Intergenic
1196759918 X:119191770-119191792 GCCAAATCAAGTTTGCACTGAGG + Intergenic
1196789572 X:119451868-119451890 GGCAAAGAATGGCTGCTGTGGGG - Intronic
1197408878 X:126091383-126091405 TGCAAATCAAAACTGCAATGAGG + Intergenic
1197663772 X:129201174-129201196 GGCTAATCATTGCTGCAATGGGG - Intergenic
1198046446 X:132908189-132908211 TGCAAATCAAAACTTCAGTGAGG + Intronic
1198167947 X:134075681-134075703 GGGAGATTGAGGCTGCAGTGAGG + Intergenic
1198343387 X:135736493-135736515 GGGAGGCCAAGGCTGCAGTGAGG - Intergenic
1198407557 X:136329743-136329765 AGGAGGTCAAGGCTGCAGTGAGG - Intronic
1200104079 X:153702758-153702780 GGCTAAGCATGGCTGCATTGGGG + Intronic
1200711836 Y:6491524-6491546 AGGAGTTCAAGGCTGCAGTGAGG + Intergenic
1201022100 Y:9670461-9670483 AGGAGTTCAAGGCTGCAGTGAGG - Intergenic
1201954730 Y:19610434-19610456 AGGAGGTCAAGGCTGCAGTGTGG - Intergenic