ID: 1126589188

View in Genome Browser
Species Human (GRCh38)
Location 15:50322460-50322482
Sequence CACTTGAATCAAGGAGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62854
Summary {0: 1, 1: 59, 2: 1271, 3: 12760, 4: 48763}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126589182_1126589188 9 Left 1126589182 15:50322428-50322450 CCCAGCTACTCAGGAGGCTAAGG 0: 3769
1: 105626
2: 210490
3: 240684
4: 150489
Right 1126589188 15:50322460-50322482 CACTTGAATCAAGGAGATGGAGG 0: 1
1: 59
2: 1271
3: 12760
4: 48763
1126589180_1126589188 17 Left 1126589180 15:50322420-50322442 CCTGTAGTCCCAGCTACTCAGGA 0: 40895
1: 157395
2: 217955
3: 208005
4: 130380
Right 1126589188 15:50322460-50322482 CACTTGAATCAAGGAGATGGAGG 0: 1
1: 59
2: 1271
3: 12760
4: 48763
1126589184_1126589188 8 Left 1126589184 15:50322429-50322451 CCAGCTACTCAGGAGGCTAAGGC 0: 2931
1: 92302
2: 198207
3: 231078
4: 156316
Right 1126589188 15:50322460-50322482 CACTTGAATCAAGGAGATGGAGG 0: 1
1: 59
2: 1271
3: 12760
4: 48763

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126589188 Original CRISPR CACTTGAATCAAGGAGATGG AGG Intronic
Too many off-targets to display for this crispr