ID: 1126600058

View in Genome Browser
Species Human (GRCh38)
Location 15:50419044-50419066
Sequence TGGACTTATACCCCTGTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126600056_1126600058 -8 Left 1126600056 15:50419029-50419051 CCTTCACCTGGTCTGTGGACTTA No data
Right 1126600058 15:50419044-50419066 TGGACTTATACCCCTGTGCTTGG No data
1126600050_1126600058 20 Left 1126600050 15:50419001-50419023 CCCATGTATTAATACTTTACCAT No data
Right 1126600058 15:50419044-50419066 TGGACTTATACCCCTGTGCTTGG No data
1126600054_1126600058 1 Left 1126600054 15:50419020-50419042 CCATCTAGGCCTTCACCTGGTCT No data
Right 1126600058 15:50419044-50419066 TGGACTTATACCCCTGTGCTTGG No data
1126600051_1126600058 19 Left 1126600051 15:50419002-50419024 CCATGTATTAATACTTTACCATC No data
Right 1126600058 15:50419044-50419066 TGGACTTATACCCCTGTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126600058 Original CRISPR TGGACTTATACCCCTGTGCT TGG Intergenic
No off target data available for this crispr