ID: 1126611737

View in Genome Browser
Species Human (GRCh38)
Location 15:50536870-50536892
Sequence TTGTATTTACAGATCAAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1137
Summary {0: 1, 1: 2, 2: 25, 3: 200, 4: 909}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126611737_1126611741 15 Left 1126611737 15:50536870-50536892 CCCAACTTGATCTGTAAATACAA 0: 1
1: 2
2: 25
3: 200
4: 909
Right 1126611741 15:50536908-50536930 AATCCCAGCAACTTATTTTGTGG 0: 2
1: 66
2: 164
3: 268
4: 490

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126611737 Original CRISPR TTGTATTTACAGATCAAGTT GGG (reversed) Intronic
900296322 1:1952984-1953006 TTGAATCTATAGATCAATTTGGG - Intronic
900811906 1:4809818-4809840 TTGAATCTATAGATCAAGTTGGG - Intergenic
901047186 1:6404118-6404140 TTGACTTTAAAGATCAGGTTAGG - Intergenic
902140922 1:14353851-14353873 TGGAATTTACAGATCAACTTAGG - Intergenic
902903930 1:19540353-19540375 TTGAATCCATAGATCAAGTTGGG + Intergenic
903150959 1:21408418-21408440 TTGAATCTATAGATCAATTTGGG + Intergenic
903611304 1:24615496-24615518 TTGAATTTGTAGATCAAATTGGG + Intergenic
904958823 1:34314033-34314055 TTGAATCTATAGATCAAATTGGG + Intergenic
904985295 1:34542314-34542336 TTGAATCTATAGATTAAGTTGGG - Intergenic
905157162 1:35994905-35994927 TTGAGTTTATAGATCAATTTGGG - Intronic
905288080 1:36898607-36898629 TTGAATCTACAGATCACTTTGGG - Intronic
905558102 1:38903650-38903672 TTGAATCTATAGATCAACTTGGG - Intronic
905713795 1:40130771-40130793 TTGAATCTGCAGATCAATTTGGG + Intergenic
905747734 1:40433625-40433647 TTGGCTATACAGATCAAGTAGGG - Intergenic
905754053 1:40492675-40492697 TTGAATTTCTAGATCAATTTTGG + Intronic
905767787 1:40616581-40616603 TTGTATCTAGGGATCAATTTGGG + Intergenic
905963893 1:42072231-42072253 TTGAATCTATAGATCAAATTGGG + Intergenic
906092139 1:43189309-43189331 TTGAATTTATAGATCAATGTGGG + Intronic
906368735 1:45234257-45234279 TTGAATCTACAGATAAATTTGGG - Intronic
906414968 1:45614441-45614463 ATCTTTTTAAAGATCAAGTTCGG - Intronic
906742429 1:48195898-48195920 TTGTTTGTACAGATCCATTTCGG - Intergenic
906951609 1:50339054-50339076 TTGAATCTATAGATCAAGTTAGG + Intergenic
907011284 1:50965862-50965884 TTGTATTTATAGATCAACAGAGG - Intronic
907102413 1:51849054-51849076 TTGAATTTATAGATTAATTTGGG - Intronic
907154312 1:52319273-52319295 TTGAAGCTACAGATCAATTTGGG - Intronic
907567941 1:55454581-55454603 TTGTATCTGTAGATCAATTTGGG - Intergenic
909098280 1:71317252-71317274 TTGAATCTATAGATCAAGCTGGG - Intergenic
909139137 1:71841281-71841303 TTTTATTTTCAGATGACGTTAGG + Intronic
909179261 1:72400342-72400364 TTGAATCTATAGATCAAGCTGGG + Intergenic
909589567 1:77330778-77330800 TTTAATCTACAGATCAATTTGGG + Intronic
909887013 1:80954525-80954547 CTGAATCTACAGATCAATTTGGG - Intergenic
910233860 1:85013783-85013805 GTTGATTTATAGATCAAGTTTGG + Intronic
910310442 1:85817835-85817857 TTATATTTAAACAGCAAGTTTGG + Intronic
910352510 1:86314687-86314709 GTCTGTTTACATATCAAGTTAGG - Intergenic
910365820 1:86464202-86464224 TTAAGTTTACAGATCAATTTTGG - Intergenic
910372668 1:86533652-86533674 TTGAATCTATACATCAAGTTGGG + Intergenic
910415332 1:86991514-86991536 ATGTATTTACACATCTACTTAGG + Intronic
910513436 1:88032777-88032799 TTGAATTTATAGATTAATTTAGG - Intergenic
910768238 1:90804038-90804060 ATGAATTTATAGATCATGTTGGG + Intergenic
911250068 1:95565559-95565581 TTGAATCTATAGATCAATTTGGG + Intergenic
911403186 1:97402189-97402211 TTGCATCTATAGATCAAGCTGGG + Intronic
911465177 1:98243040-98243062 TTCTATTTTCAGTTCAGGTTTGG - Intergenic
911879172 1:103212174-103212196 TTGTAGTTATATATCAAATTTGG - Intergenic
912083334 1:105967145-105967167 TTGAATTTATAGATTAATTTTGG + Intergenic
912275900 1:108258224-108258246 TTGAATTTATAGATCAGATTGGG + Intergenic
912292328 1:108436132-108436154 TTGAATTTATAGATCAGATTGGG - Intronic
912479357 1:109968320-109968342 TTGAATCTACAGATTGAGTTGGG - Intergenic
912767149 1:112424584-112424606 TTGAATCTAGAGATCAATTTGGG + Intronic
913028134 1:114867320-114867342 TTGAATCTGTAGATCAAGTTGGG + Intronic
913598516 1:120401018-120401040 TTGAATTCATAGATCAAATTAGG - Intergenic
913664953 1:121039062-121039084 TTGAATCTTTAGATCAAGTTGGG - Intergenic
914016344 1:143822333-143822355 TTGAATCTTTAGATCAAGTTGGG - Intergenic
914088811 1:144478300-144478322 TTGAATTCATAGATCAAATTAGG + Intergenic
914161440 1:145138666-145138688 TTGAATCTTTAGATCAAGTTGGG + Intergenic
914309802 1:146455911-146455933 TTGAATTCATAGATCAAATTAGG - Intergenic
914383616 1:147145318-147145340 TTGAATTTATAGTTCAAATTGGG + Intergenic
914511914 1:148340827-148340849 TTGAATTTATAGATCAAATTAGG + Intergenic
914592309 1:149117229-149117251 TTGAATTCATAGATCAAATTAGG + Intergenic
914654961 1:149730875-149730897 TTGAATCTTTAGATCAAGTTGGG - Intergenic
915388250 1:155517024-155517046 TTGAATCTACAGATCACTTTAGG - Intronic
915871728 1:159567802-159567824 TTAAATCTACAGATCAAGTTGGG - Intergenic
915880204 1:159662381-159662403 GTGTCTTTACAGATAAAGTGAGG + Intergenic
916249800 1:162725798-162725820 TTGTCTTCACACATTAAGTTTGG - Intronic
916673793 1:167048895-167048917 TTTAATTAATAGATCAAGTTGGG - Intergenic
916775635 1:167960909-167960931 TTGAATCTATAGAACAAGTTGGG + Intronic
916937934 1:169649522-169649544 TTAAATCTAAAGATCAAGTTGGG - Intergenic
917001084 1:170360526-170360548 TTGAATCTACAGATTAATTTAGG - Intergenic
917008332 1:170441407-170441429 TTGAATCTATAGATCAATTTGGG - Intergenic
917157129 1:172015334-172015356 TTGAATCTATAGATTAAGTTGGG + Intronic
917825650 1:178817686-178817708 TTGAATTTATAGATCACTTTGGG + Intronic
917990569 1:180373261-180373283 TTGTATTCAAAGAACATGTTTGG - Intronic
918090041 1:181282700-181282722 TTGAATCTACAGATCAAGTTGGG + Intergenic
918268859 1:182875362-182875384 TTGTATATACAGATCACCTGAGG - Intronic
918274127 1:182935245-182935267 CTGGATCTACAGATCAAGTTGGG + Intronic
918539895 1:185619727-185619749 ATGAATCTATAGATCAAGTTGGG + Intergenic
918539921 1:185620413-185620435 TTGACTCTATAGATCAAGTTGGG - Intergenic
918665658 1:187147259-187147281 TTGAATCTATAGATCAAGTTGGG + Intergenic
918698303 1:187574092-187574114 CTCTATTTAGAGATCAAGTATGG + Intergenic
919028946 1:192214232-192214254 TTGAATATACAAACCAAGTTGGG - Intergenic
919717051 1:200789725-200789747 TTGAATCTGTAGATCAAGTTGGG + Intronic
920780191 1:208982667-208982689 TTGAATTTATAGATCAATGTGGG + Intergenic
920926941 1:210350342-210350364 TTGAATCTATAGATTAAGTTGGG + Intronic
920985013 1:210880162-210880184 TTAAATCTACAGATCAATTTGGG - Intronic
921093289 1:211863545-211863567 TTGAATCTACAGATCAAGTTGGG + Intergenic
921434884 1:215107157-215107179 TTGAATTTATAGATCACTTTGGG + Intronic
922181444 1:223236917-223236939 TTGAATCTATAGAGCAAGTTGGG + Intronic
922254521 1:223881893-223881915 TTGAATATACAGATCAATTTTGG - Intergenic
922436175 1:225608943-225608965 CTGTATTTACAAGTCAAGGTTGG - Intronic
922656021 1:227384206-227384228 TTGAATTTATAGATCAAGTTAGG - Intergenic
922690654 1:227686812-227686834 ATGTATTTATAGATTAATTTTGG - Intergenic
923059840 1:230461338-230461360 TTGAATCTATAGATCAAGTTAGG - Intergenic
923307146 1:232698699-232698721 TTGTTTTTCCAGCTCAGGTTTGG - Intergenic
923420083 1:233804790-233804812 TTAAATCTATAGATCAAGTTGGG - Intergenic
923429043 1:233903278-233903300 TTGAATCTATAGATGAAGTTGGG + Intergenic
923619071 1:235562721-235562743 TTGAATCTACAGATCAAGTTGGG + Intronic
924123572 1:240827154-240827176 TTGTATTTACACATCCAGGCTGG + Exonic
924204011 1:241692225-241692247 TTGACTCTACATATCAAGTTGGG - Intronic
924214257 1:241804231-241804253 TTGAATTTTTAGATCAAGTTGGG - Intergenic
924260856 1:242229523-242229545 TTGGATCTATAGATCAATTTGGG + Intronic
924364575 1:243278056-243278078 TTGGATCTATTGATCAAGTTGGG + Intronic
924485918 1:244484254-244484276 TTGAATGTATAAATCAAGTTGGG - Intronic
1062962519 10:1583657-1583679 TTGAATCTACAAATCAAGTGAGG - Intronic
1063284281 10:4666365-4666387 TTGTATTTCCATATAAATTTAGG + Intergenic
1063401473 10:5750286-5750308 TTGTATTTACACTTGAAGTATGG - Intronic
1063732259 10:8711187-8711209 TTGAATCTCCAGATCAATTTGGG + Intergenic
1063895191 10:10672862-10672884 TTGAATTTGTAGATCAAGTTGGG + Intergenic
1063976475 10:11421572-11421594 TTGAATCTATAGACCAAGTTAGG - Intergenic
1064348094 10:14551196-14551218 TTGTTTTTTGAGATGAAGTTCGG + Intronic
1064607210 10:17055842-17055864 TTGAATTTACAGACCAATTTGGG - Intronic
1064796021 10:19012022-19012044 TTGTATTTCCATATAAATTTTGG + Intergenic
1064835908 10:19529978-19530000 TTGAATTTATACATCATGTTGGG - Intronic
1065243311 10:23730560-23730582 TTTAATTTATAGATCTAGTTGGG + Intronic
1065277703 10:24102464-24102486 TTGAATCTATACATCAAGTTGGG - Intronic
1065365531 10:24932708-24932730 TTGAATCTATAGATCAATTTGGG - Intronic
1065459541 10:25943444-25943466 TTGAATTTATAGATCACTTTGGG + Intronic
1065556914 10:26925055-26925077 TTGAATCTAGAGAGCAAGTTGGG - Intergenic
1065567790 10:27032461-27032483 TTGTATTTACAGTTAGAGATAGG - Intronic
1065818477 10:29503776-29503798 TCGAATGTACAGCTCAAGTTGGG - Intronic
1065941700 10:30570384-30570406 TTGAGTCTATAGATCAAGTTGGG + Intergenic
1065954441 10:30680723-30680745 TTGAATTTATAGATCGAGTTGGG + Intergenic
1066135588 10:32442468-32442490 TTGGATTTATAGATCAATTTGGG + Intergenic
1066176158 10:32908961-32908983 TTGAGTTTATAGATCAAATTGGG - Intronic
1066519659 10:36201809-36201831 CTGAATCTACAGATCAAGTTGGG + Intergenic
1067485117 10:46641576-46641598 TTGAATTTACATATTAACTTAGG + Intergenic
1067609639 10:47700081-47700103 TTGAATTTACATATTAACTTAGG - Intergenic
1067898148 10:50208735-50208757 TTGAATTTACAGATTAATTTGGG - Intronic
1068190109 10:53640488-53640510 TTCTATCTATAGATCAATTTGGG - Intergenic
1068677858 10:59786133-59786155 TTATCTTTAAAGATCAACTTAGG + Intergenic
1068724988 10:60290817-60290839 CTCTATTTAAAGATAAAGTTGGG - Intronic
1068758959 10:60686005-60686027 TTGAGTTTATAGATCAATTTTGG - Intronic
1068824829 10:61424482-61424504 TTGAATCTAAAGATCAATTTGGG - Intronic
1069022891 10:63508547-63508569 TTGAATCTATAGATCAAGTTGGG + Intergenic
1069080947 10:64087758-64087780 TTGTATTCACAGAGGATGTTGGG + Intergenic
1069154287 10:65006192-65006214 CTGAATCTATAGATCAAGTTGGG + Intergenic
1069468633 10:68665340-68665362 TTGAATCTAGAGATCAATTTTGG + Intronic
1069644594 10:69984205-69984227 CTGAATATACAAATCAAGTTAGG - Intergenic
1070317198 10:75325683-75325705 ATGAATCTACAGATCAATTTGGG + Intergenic
1070945203 10:80385177-80385199 TTGAATCTATAGTTCAAGTTGGG + Intergenic
1071081018 10:81811284-81811306 TTGAATCTATTGATCAAGTTGGG - Intergenic
1071214340 10:83381849-83381871 TTGTATCTACAGATCAAGTTGGG - Intergenic
1071426002 10:85552270-85552292 ATTCATTTACAGATCAAATTGGG - Intergenic
1071625230 10:87161693-87161715 TTGAATTTACATATTAACTTAGG - Intronic
1072123778 10:92427842-92427864 TTGAGTCTATAGATCAAGTTGGG - Intergenic
1072173362 10:92890037-92890059 TTGAATCTATAGATGAAGTTGGG + Intronic
1072174543 10:92905342-92905364 TTGAATCTGTAGATCAAGTTGGG + Intronic
1072279302 10:93851517-93851539 GTCTATTTACACATCCAGTTAGG - Intergenic
1072908546 10:99478921-99478943 TTGAATCTACAGATCATTTTGGG - Intergenic
1073283423 10:102371497-102371519 TTGAATTTACAGATCAATTTGGG - Intronic
1073826272 10:107326366-107326388 TTTTGTTTATAGATCAATTTAGG + Intergenic
1073867996 10:107827280-107827302 TTATATTTACAGCTTAGGTTTGG - Intergenic
1074099982 10:110347265-110347287 GTGCATTTACACATCCAGTTAGG - Intergenic
1074628805 10:115225793-115225815 TTAAATCTACAGATCAATTTGGG - Intronic
1075501210 10:122976353-122976375 TTGAATCTATAGATCAAGTTGGG - Intronic
1076473372 10:130735698-130735720 TTGGATTTGCAGAGCCAGTTGGG + Intergenic
1076575035 10:131459728-131459750 TTGGCTTTACAGAGCAATTTGGG + Intergenic
1076633076 10:131864037-131864059 TTGAACCTATAGATCAAGTTGGG - Intergenic
1076669950 10:132114666-132114688 TTGAATCTATAGATCAATTTGGG + Intronic
1077290810 11:1791105-1791127 TCGAATCTACAGATGAAGTTGGG + Intergenic
1077436796 11:2544072-2544094 TTGCATTTACATATAAATTTTGG + Intronic
1077520541 11:3030795-3030817 TTCTATTTTCAGATCCAGCTGGG - Intronic
1077864143 11:6209382-6209404 TTGAATTTACAAATCAAGGGGGG - Intronic
1078050255 11:7959481-7959503 TTGAATCTACAGATCAAACTGGG + Exonic
1078058371 11:8026825-8026847 TTGACTTTATAGATCAATTTGGG + Intronic
1078425401 11:11245630-11245652 TTTTCTTTAAAAATCAAGTTTGG + Intergenic
1078805592 11:14697647-14697669 TTGTATCTATAGATTAATTTGGG + Intronic
1078881604 11:15454835-15454857 TTGAATCTATAGATCAATTTGGG + Intergenic
1078936903 11:15959852-15959874 TTGCTTCTACAGATCTAGTTTGG + Intergenic
1078955311 11:16187578-16187600 TTGCCTTTACAGATGAACTTGGG - Intronic
1079072644 11:17361256-17361278 TTGAATCTAGAGATCAAGTTGGG + Intronic
1079107782 11:17583878-17583900 TTGAATTTATAGATCAATTTGGG + Intronic
1079170868 11:18094285-18094307 CTGTATTTTCAGTCCAAGTTTGG - Intronic
1079564300 11:21862865-21862887 TTGAATCTATAAATCAAGTTGGG + Intergenic
1079664734 11:23090456-23090478 ATGTAATTACAGCTGAAGTTGGG - Intergenic
1079866448 11:25741282-25741304 TTGAATTTATAGATCACATTGGG + Intergenic
1080273537 11:30476814-30476836 CTGAATCTACAGATCAATTTAGG + Intronic
1081422355 11:42884360-42884382 TTGAATCTACAGATAAATTTGGG - Intergenic
1081452503 11:43185443-43185465 TTGGATTTATAGATTAATTTGGG - Intergenic
1081576554 11:44322159-44322181 TTGGATTTACAGAACAAGGTTGG - Intergenic
1081970908 11:47198088-47198110 TTGTTTGTACAGATCCATTTGGG + Intergenic
1083916838 11:65751698-65751720 TTGAATCTATAGACCAAGTTAGG + Intergenic
1084282887 11:68110622-68110644 TTAAATCTACAGATCAAGTTGGG - Intronic
1084339409 11:68484953-68484975 TTGAATCTGTAGATCAAGTTAGG + Intronic
1085153895 11:74275741-74275763 TTCAATTTATAGATCAATTTTGG + Intronic
1085286076 11:75362251-75362273 TTGGATTTATAGAACAATTTTGG - Intergenic
1085504738 11:77051393-77051415 TTGAATTTAAAGATAAATTTGGG - Intergenic
1085918591 11:80923627-80923649 TTGTTTTTATTGAACAAGTTAGG + Intergenic
1085938617 11:81180921-81180943 TTGAACCTATAGATCAAGTTTGG + Intergenic
1086000651 11:81980962-81980984 TTGAATCTATAGATCAACTTTGG + Intergenic
1086037064 11:82428929-82428951 TTGAATTTATAAATAAAGTTGGG - Intergenic
1087574335 11:99971604-99971626 TAGTCTTTAGAGATCGAGTTAGG - Intronic
1087637882 11:100723345-100723367 TTCAATCTATAGATCAAGTTGGG + Intronic
1087808670 11:102585176-102585198 TTGAATCTACAGATCAATTTGGG + Intronic
1088564604 11:111155556-111155578 TGGTATTTACATTTCATGTTGGG - Intergenic
1088710343 11:112502390-112502412 TTGAATCTATAGATCAAATTGGG + Intergenic
1088863599 11:113824964-113824986 TTGAACTTACAGATCAGTTTGGG - Intronic
1088960624 11:114661175-114661197 TTGAATCTATAGATCAATTTTGG - Intergenic
1089421536 11:118335591-118335613 TTGCATTTATAGATCAATTTGGG - Intergenic
1090084126 11:123636009-123636031 TTGAATTTGAAGATCAATTTGGG + Intronic
1090113051 11:123937044-123937066 TTGAATCTATAGATCAAATTGGG + Intergenic
1090143125 11:124287303-124287325 TTGAATTTATAGATCAAATTGGG + Intergenic
1090754405 11:129776587-129776609 TGGAATCTATAGATCAAGTTGGG - Intergenic
1090841476 11:130492062-130492084 CTGGATCTATAGATCAAGTTAGG + Intergenic
1090993910 11:131847603-131847625 TTGTAATTCCAGAACAAGTGGGG - Intronic
1091454318 12:594753-594775 TTGAATCTATAGATCAAGTTAGG - Intronic
1091949130 12:4577695-4577717 TTGAATCTACAGATTAAGTTGGG + Intronic
1092169990 12:6368434-6368456 GTGTGTTTACATATCTAGTTAGG + Intronic
1093162874 12:15769354-15769376 TTGTATGTATATATCAAGTGTGG - Intronic
1093298550 12:17422955-17422977 TTGAATTTATAGATCAAGGTGGG + Intergenic
1093343203 12:18005433-18005455 TTGAATCTATAGATCAAGCTGGG - Intergenic
1093488198 12:19675793-19675815 CTGAATTTATAGATCAATTTGGG + Intronic
1093631175 12:21411645-21411667 TTGAAGCTACAGATCAATTTGGG + Intronic
1093759088 12:22886124-22886146 TTGAATCTATAGATCAAGTTGGG + Intergenic
1093900806 12:24629663-24629685 TTGAATCTACAGATAAATTTGGG + Intergenic
1093950454 12:25160183-25160205 TTATATTTACTGATGAAATTAGG - Intronic
1093975644 12:25418822-25418844 TTGAATTTGTAGATCAATTTGGG + Intronic
1094145404 12:27223249-27223271 TTAAATCTATAGATCAAGTTGGG - Intergenic
1095131959 12:38553377-38553399 TTGTATTTACAGTGGGAGTTTGG + Intergenic
1095835540 12:46634540-46634562 TTGAATCTGTAGATCAAGTTGGG + Intergenic
1096288311 12:50319404-50319426 TTGAATTTATAGATTAATTTGGG + Intergenic
1096568567 12:52502683-52502705 TTGAATCTGTAGATCAAGTTGGG + Intergenic
1096932709 12:55231930-55231952 TTGAATCTATAGATAAAGTTGGG - Intergenic
1097778682 12:63678012-63678034 TTGAATATATAGATCAAGTTGGG + Intergenic
1097965659 12:65577597-65577619 TTGAAGCTACAGATCAATTTGGG - Intergenic
1099243908 12:80171724-80171746 TTAAATCTACAGATCAATTTGGG + Intergenic
1099306426 12:80961940-80961962 TTAAATCTACAGATCAATTTGGG + Intronic
1099566722 12:84258355-84258377 TTGAATTTATAGATCATATTGGG + Intergenic
1100160255 12:91851369-91851391 TTGAATTTGTAGATCAATTTGGG - Intergenic
1100298376 12:93284207-93284229 TTGAATCTATAGATCAATTTAGG - Intergenic
1101228466 12:102713779-102713801 TGGTATTTACATATCATGGTGGG + Intergenic
1101279157 12:103233390-103233412 CTGAATCTATAGATCAAGTTGGG + Intergenic
1101525748 12:105528024-105528046 TTGAATTTATAGATCAATTTTGG + Intergenic
1102032274 12:109747552-109747574 TTACATTTACAGATGAATTTAGG + Intronic
1102033256 12:109756027-109756049 TTGGATTTATAGATCAACTTAGG + Intronic
1102319833 12:111923009-111923031 TTGAATCTGTAGATCAAGTTGGG - Intergenic
1104449414 12:128857077-128857099 GTGGGTTTACAGCTCAAGTTAGG - Intronic
1104702130 12:130914663-130914685 TTGAATTGATAGATCAATTTGGG - Intergenic
1104711005 12:130986216-130986238 TTGAATATATAGATCAATTTGGG + Intronic
1105388071 13:19950430-19950452 TTCTGTTTACATATCCAGTTGGG - Intergenic
1105554582 13:21433723-21433745 CTGAACTTACAGATCAACTTGGG + Intronic
1105647495 13:22337451-22337473 TTGAATTTGAAGATCAATTTAGG + Intergenic
1106182226 13:27379688-27379710 TTGTATTTCCATATAAATTTTGG + Intergenic
1106299997 13:28455076-28455098 TTGAATCTGCAGATCAAGTTGGG - Intronic
1106759386 13:32852843-32852865 TTCTTTTTACAGATTAATTTTGG + Intergenic
1106771644 13:32966834-32966856 TTGAATCTATAGATCAAGTTGGG + Intergenic
1107763417 13:43707323-43707345 TTGAATCTACAAATCAACTTTGG - Intronic
1107767542 13:43753235-43753257 TTGAATCTATAGATCAATTTGGG + Intronic
1107847333 13:44529996-44530018 CTGAATCTAAAGATCAAGTTGGG - Intronic
1108342170 13:49508030-49508052 TTGCATTTATAGATGAATTTGGG + Intronic
1108464635 13:50702417-50702439 TTGAATCTACAGATCACTTTAGG - Intronic
1108781391 13:53840369-53840391 TTGTTTATACAGTTGAAGTTTGG - Intergenic
1109158835 13:58946721-58946743 TTGTATTAACAGATGAAGTAGGG - Intergenic
1109632641 13:65071925-65071947 TTGCATTTATAGATCAATTGGGG - Intergenic
1109812638 13:67535081-67535103 TTGAATTTATAGACCACGTTGGG - Intergenic
1109836643 13:67867202-67867224 TTGCATTTATAGATCACTTTGGG - Intergenic
1109992434 13:70076058-70076080 TTTAATTTACAGATCAAGTTTGG - Intronic
1109999130 13:70171271-70171293 GTCTATTTACACATCCAGTTAGG + Intergenic
1110047723 13:70851855-70851877 TTGAATTTACACATCAATTTAGG - Intergenic
1110109877 13:71732671-71732693 CTGTATTTACAAATAAAGGTAGG - Intronic
1110233708 13:73194228-73194250 TTGTATTTGAAGTTCTAGTTTGG - Intergenic
1110673952 13:78216410-78216432 TTATATTTACAAATCCATTTTGG - Intergenic
1111067932 13:83122146-83122168 TGACATTTACAGATGAAGTTGGG - Intergenic
1111293566 13:86199920-86199942 TTGTATTTTTAGAAGAAGTTGGG + Intergenic
1111341129 13:86887859-86887881 TTGAATCTATAGATCAATTTGGG - Intergenic
1111592169 13:90363002-90363024 ACATATTTACACATCAAGTTAGG + Intergenic
1112863207 13:103861011-103861033 TTATATTTACAGCTAAAGTGTGG - Intergenic
1113275451 13:108723889-108723911 TTGAATCTACAGATCAATTTGGG + Intronic
1113658313 13:112085141-112085163 TTGCATTTCCATATAAAGTTTGG + Intergenic
1114171661 14:20279101-20279123 TTGAATTTACAGATAAGTTTAGG - Intronic
1114502037 14:23177255-23177277 GTCTATTTACACATCCAGTTAGG - Intronic
1114505931 14:23213430-23213452 TTGAATCTATAGATCAAATTGGG - Intronic
1114764628 14:25356830-25356852 TTGTATTAATACATCACGTTCGG + Intergenic
1114863411 14:26556078-26556100 TTGCATCTATAGATCAAGTAGGG - Intronic
1114901441 14:27064611-27064633 TTGAATTTATAGATCAATTCAGG + Intergenic
1114908730 14:27164627-27164649 TTGAATGTATAGATTAAGTTGGG + Intergenic
1115064979 14:29247799-29247821 TTGCATCTATAGTTCAAGTTTGG + Intergenic
1115169424 14:30487343-30487365 TTGAATCTATAGATCAAGTTGGG - Intergenic
1115581047 14:34758907-34758929 TGGTATTTATATATCCAGTTTGG - Intronic
1115639877 14:35327832-35327854 TTGAATCTATAGATCAAGTTGGG - Intergenic
1115678322 14:35706911-35706933 TTGAATCTACAGATTAAGTAGGG + Intronic
1115686542 14:35802596-35802618 TTGAATCTATAGATCAATTTGGG - Intronic
1115713807 14:36080059-36080081 ATGTACTTACAGATAAATTTGGG - Intergenic
1115719170 14:36141301-36141323 TTGAATCTATAGATCAAGTTGGG + Intergenic
1116356116 14:43933415-43933437 TTGAATCTATAAATCAAGTTTGG - Intergenic
1116665782 14:47773186-47773208 TTGAATTTACAGATCAAGTTTGG - Intergenic
1116692845 14:48132745-48132767 ATGAATGTACAGATCCAGTTTGG - Intergenic
1116832973 14:49740675-49740697 TTGGATTTACAAATCAAAATAGG + Intronic
1117068821 14:52037714-52037736 TTGAATTAATAGATCAATTTGGG + Intronic
1117259339 14:54014625-54014647 TTGAATCCAGAGATCAAGTTGGG + Intergenic
1117369043 14:55059123-55059145 TTATATTTACAGATTAATCTAGG - Intronic
1117607677 14:57447305-57447327 TTGACTCTATAGATCAAGTTTGG + Intergenic
1118421269 14:65606858-65606880 TTTAATTTATAGATCAATTTGGG + Intronic
1118463286 14:66006773-66006795 TTGAATGTAGAGATCAATTTGGG + Intergenic
1118840910 14:69510262-69510284 TTGAATCTATAGATCAAGTTGGG + Intronic
1119801159 14:77446517-77446539 TTGAATGTACAGATCAATTTTGG - Intronic
1120078988 14:80193765-80193787 TTGAATCTACAGATCACATTGGG - Intergenic
1120725711 14:87937950-87937972 TTAAATTTACACATCAATTTAGG - Intronic
1121430872 14:93887397-93887419 TTGAATCTATAGATCAAGTTGGG + Intergenic
1121480889 14:94272086-94272108 TTTAGTTTATAGATCAAGTTGGG - Intronic
1121771783 14:96551124-96551146 TTCTATATCCAGATCAAGTTTGG - Intronic
1122176483 14:99924008-99924030 TTTAATTTACAGATCAATATGGG + Intronic
1122305108 14:100760199-100760221 TTGACTCTACAGATCAATTTGGG - Intergenic
1123453463 15:20390735-20390757 TTGAATCTATAGATCAATTTTGG + Intergenic
1123953089 15:25303691-25303713 TTGAATCTACAGATCACTTTGGG + Intergenic
1124029553 15:25997467-25997489 TTGGATCTACAGATCAACTTGGG + Intergenic
1124460576 15:29886900-29886922 TTGTTTTTTCAGATGAACTTTGG - Intronic
1124468805 15:29964923-29964945 TTATATTTGCAGACCAACTTAGG - Intronic
1124599624 15:31122752-31122774 TTGCATCTATAGATCAAGTTGGG - Intronic
1124713746 15:32037481-32037503 TTGAATCTGTAGATCAAGTTGGG + Intronic
1125167001 15:36718421-36718443 TTGAATTTACAGATCAATTTGGG + Intronic
1125447526 15:39774112-39774134 TTGACTTTACAGATTAATTTGGG - Intronic
1125843330 15:42826506-42826528 GTCTATTTACACATCAAGTTAGG - Intronic
1126566920 15:50110912-50110934 TTTTTTTTACATTTCAAGTTTGG + Intronic
1126611737 15:50536870-50536892 TTGTATTTACAGATCAAGTTGGG - Intronic
1126658625 15:51008800-51008822 TTGAATCTAAAGATCAAGTTGGG + Intergenic
1127055728 15:55129227-55129249 TTTTATTTACATATTTAGTTAGG - Intergenic
1127202840 15:56675667-56675689 TAGAATTTCCAGATCAATTTGGG - Intronic
1127697670 15:61467701-61467723 TTGAATGTATAGATCAATTTGGG - Intergenic
1127951602 15:63812898-63812920 TTCAATTTATAGATCAATTTGGG - Intronic
1128339918 15:66814282-66814304 TTGAATCTATAGAACAAGTTGGG - Intergenic
1128406689 15:67348690-67348712 TTGAATTTATAGATCAATTTGGG - Intronic
1128421719 15:67497932-67497954 TTGAATCTATAGATCAATTTGGG - Intronic
1128436075 15:67649912-67649934 TTGAATTTTTAGATCAACTTGGG + Intronic
1128464855 15:67901801-67901823 ATTTATTTACACATCCAGTTAGG + Intergenic
1128508426 15:68297324-68297346 TTATTTTTCCAGATGAAGTTTGG + Intronic
1129369471 15:75080284-75080306 TTAAATCTACTGATCAAGTTGGG - Intronic
1130142651 15:81242226-81242248 TTGCATTTACATATAAATTTTGG + Intronic
1130323341 15:82857973-82857995 TTACATTTATAGATCAATTTAGG + Intronic
1130784069 15:87076151-87076173 TTGAATTTGTAGATCAATTTAGG + Intergenic
1130815871 15:87432103-87432125 CTGCATTTACAGATGAAGTAAGG + Intergenic
1131088768 15:89602356-89602378 TTGGCATTACAGATCAAGTAGGG - Intronic
1131320143 15:91381315-91381337 TTCAATTTACAGATCAAGTTGGG + Intergenic
1132032984 15:98453780-98453802 TTGAGTTTACAGATCATTTTGGG - Intronic
1132397572 15:101485875-101485897 TTGAATTTGCAGATTAAATTGGG + Intronic
1133332781 16:4986526-4986548 TTGTATTTCCATATGAATTTTGG + Intronic
1133540310 16:6746186-6746208 TTGAATCTACAGATCAATTAGGG - Intronic
1133863626 16:9620577-9620599 TTGAATCTATAGATCAAATTAGG - Intergenic
1134125042 16:11610619-11610641 TCTTATTTACTGCTCAAGTTGGG - Intronic
1134140948 16:11718424-11718446 TTGTATGTACAGATCAAGGCTGG - Intronic
1134200478 16:12194056-12194078 TTAAATTTATAGATCAATTTTGG + Intronic
1134213033 16:12294220-12294242 TAGCATTTATAGATCAAGTAGGG + Intronic
1134429300 16:14186715-14186737 GTGTATTTGCAGGTCAAGCTGGG + Intronic
1134438162 16:14280879-14280901 TTGAATCTACAGATGAATTTGGG - Intergenic
1135273732 16:21092038-21092060 TTGAATCTATAGATCAAGTTGGG - Intronic
1135466357 16:22689021-22689043 TTGAATCTATACATCAAGTTGGG + Intergenic
1135996076 16:27249828-27249850 TTGAATCTATAGATCAATTTGGG + Intronic
1137436634 16:48459875-48459897 TTGAATCTATAGATCAAGTTAGG + Intergenic
1138176602 16:54905222-54905244 TTGAATTTCTAGATCAAGTTGGG - Intergenic
1138306960 16:55986681-55986703 TTGAATTCATAGATCCAGTTGGG + Intergenic
1138721356 16:59084425-59084447 TTGAATTTATAGATCAGTTTGGG + Intergenic
1138793498 16:59938912-59938934 TTGAATCTAGAGATCAAGTAGGG + Intergenic
1139121825 16:64028190-64028212 TTGAATCTATAGATCAAGCTGGG + Intergenic
1139432826 16:66920248-66920270 TGGTATTTTCAGATCAAGTGAGG - Intergenic
1140015682 16:71181163-71181185 TTGAATTTTCAGATAAATTTGGG - Intronic
1140609326 16:76579379-76579401 GTTTGTTTACATATCAAGTTAGG - Intronic
1141037222 16:80638406-80638428 TTGAGTCTATAGATCAAGTTGGG - Intronic
1142424936 16:89997092-89997114 TTGTATTTAAAAATCAAGATAGG - Intergenic
1143308111 17:5964809-5964831 TTGAATCTATAGATCAAGTTAGG + Intronic
1143917476 17:10304552-10304574 TTGAACTTACAGATCAAGTAAGG + Intronic
1143989892 17:10948323-10948345 TTGAATCTACAGATCAAGTTTGG + Intergenic
1144048463 17:11474914-11474936 TTGAATCTATAGATCAAGTTGGG + Intronic
1145043929 17:19597355-19597377 TTGTTTTTAAAGATCAACTGAGG + Intergenic
1146098591 17:29956559-29956581 GTCTTTTTACACATCAAGTTTGG + Intronic
1146612227 17:34317741-34317763 TTGAAGGTACAGATCAAGTTGGG - Intergenic
1146802344 17:35836189-35836211 GTGTGTCTACAGATCAAGTTGGG + Exonic
1147033854 17:37664710-37664732 TTGAATTTATAGATAAATTTGGG + Intergenic
1149081141 17:52658599-52658621 TTGTACTTATACACCAAGTTGGG - Intergenic
1149290141 17:55209947-55209969 TTGTGTTTACAACACAAGTTAGG + Intergenic
1149508774 17:57219248-57219270 TTGAATCTATAGGTCAAGTTGGG - Intergenic
1149853613 17:60058180-60058202 CTGAATCTATAGATCAAGTTGGG + Intronic
1150376872 17:64688733-64688755 TTGTTTTTAGAGATGGAGTTTGG - Intergenic
1150461101 17:65353644-65353666 TTGAATCTACAGATCAGTTTAGG - Intergenic
1151531013 17:74704721-74704743 GTGTGTTTACAGATCAGGCTGGG - Exonic
1151678543 17:75612342-75612364 TTGTATTTACTGCTGAAGTCTGG - Intergenic
1152010811 17:77713553-77713575 TTGTATATATAAATCAATTTGGG + Intergenic
1203166231 17_GL000205v2_random:98860-98882 TTGTATTTGCAAATCAAGCAAGG + Intergenic
1153503976 18:5776452-5776474 TTGTATCTGCAGATCAATTTAGG + Intergenic
1153792507 18:8592474-8592496 TTGAACTGATAGATCAAGTTGGG - Intergenic
1154536987 18:15476948-15476970 TTCTCTTTACAGATCAGTTTTGG + Intergenic
1154542135 18:15552088-15552110 TTCTCTTTACAGATCAGTTTTGG + Intergenic
1154546080 18:15609922-15609944 TTCTCTTTACAGATCAGTTTTGG + Intergenic
1154546433 18:15615026-15615048 TTCTCTTTACAGATCAGTTTTGG + Intergenic
1154546892 18:15621831-15621853 TTCTCTTTACAGATCAGTTTTGG + Intergenic
1154548177 18:15640542-15640564 TTCTCTTTACAGATCAGTTTTGG + Intergenic
1154548403 18:15643946-15643968 TTCTCTTTACAGATCAGTTTTGG + Intergenic
1154550265 18:15671184-15671206 TTCTCTTTACAGATCAGTTTTGG + Intergenic
1154551444 18:15688202-15688224 TTCTCTTTACAGATCAGTTTTGG + Intergenic
1154556762 18:15765975-15765997 TTCTCTTTACAGATCAGTTTTGG + Intergenic
1154948947 18:21189216-21189238 TTGAATCTACAGATCACTTTTGG + Intergenic
1154951320 18:21212893-21212915 ATGAATCTATAGATCAAGTTGGG + Intergenic
1154962377 18:21322505-21322527 TTGTATTTATATAACAATTTAGG - Intronic
1155513602 18:26601582-26601604 TTGAATCTGCAGATCAATTTGGG + Intronic
1155539469 18:26852964-26852986 TTGAATTTACTGCTCTAGTTTGG + Exonic
1155861630 18:30908906-30908928 TTGAATTTATATATCAATTTGGG - Intergenic
1155998760 18:32360542-32360564 TTGTATCTACAGATCTTTTTTGG + Intronic
1156281653 18:35645073-35645095 TTGAATTTATAGATTAATTTTGG + Intronic
1156813844 18:41284781-41284803 TTGAATCTATAGATTAAGTTGGG - Intergenic
1157244819 18:46044062-46044084 TTGGATCTATAGATCAATTTGGG - Intronic
1157343156 18:46798401-46798423 TTGATTCTATAGATCAAGTTGGG - Intergenic
1157509324 18:48258613-48258635 TTGAATCTACAGATCAATTTGGG - Intronic
1157961840 18:52162981-52163003 TTGAATCTATAGATCAATTTGGG + Intergenic
1159112076 18:64070890-64070912 TTGCATTTACAGAAAAATTTAGG + Intergenic
1159367008 18:67479709-67479731 TCATATTTTCAGATCAATTTAGG - Intergenic
1159579831 18:70222652-70222674 TTGAATCTGCAGATCAATTTGGG - Intergenic
1159588488 18:70305625-70305647 TTGAATCTATAGATCAATTTTGG + Intronic
1159818418 18:73107417-73107439 TTTTATCTATAGATCAATTTGGG + Intergenic
1160056384 18:75485569-75485591 TTGAATCTAAAGATCAAATTAGG - Intergenic
1160472616 18:79151017-79151039 CTGAATCTACAGATCAATTTAGG - Intronic
1160536229 18:79595257-79595279 TTGAATCTATAGATCAAATTGGG - Intergenic
1161184791 19:2910038-2910060 TTGAATCTATAGATCAAGTTGGG + Intronic
1161881971 19:6961447-6961469 TTGGATCTATAGATCAAGTTGGG + Intergenic
1163226852 19:15968490-15968512 TTGAATCTATAGATCAAGTTGGG - Intergenic
1163852519 19:19672897-19672919 TTGAATTTGCAGATCATTTTGGG + Intronic
1164122645 19:22282005-22282027 GTCTATTTACATATCAAGTTAGG - Intergenic
1164308309 19:24024430-24024452 GTCTATTTACATATCCAGTTAGG + Intergenic
1164786893 19:30939715-30939737 TTGAATTTATAGATCACTTTGGG + Intergenic
1164819374 19:31233892-31233914 TTGCATTTTCAGATCAGTTTAGG + Intergenic
1164893784 19:31850296-31850318 TTGAATCTATAGATCAAGTTGGG - Intergenic
1165126061 19:33598450-33598472 TTACATTTACAGATTAATTTAGG + Intergenic
1166910931 19:46156192-46156214 TTGAATTTATCGATCAATTTGGG + Intronic
1166922997 19:46244243-46244265 TTGAATATATAGATCAATTTGGG - Intergenic
1167236025 19:48315942-48315964 TCGATTTTACAAATCAAGTTGGG + Intronic
925565364 2:5247968-5247990 CTGAATCTATAGATCAAGTTGGG - Intergenic
925793320 2:7515603-7515625 TTCTATTTCTAGATCTAGTTTGG + Intergenic
926481829 2:13408489-13408511 TTGAATCTATAGATCAATTTTGG - Intergenic
926540557 2:14174849-14174871 TTGAATTTATAGATTAATTTGGG - Intergenic
926587295 2:14701111-14701133 TTTTATTTACATATTAAGTTAGG + Intergenic
926887047 2:17607360-17607382 TTGTATCTCCAGATCAAAGTAGG - Intronic
927337832 2:21945958-21945980 TTGTATTCACTTATAAAGTTAGG - Intergenic
927877029 2:26664820-26664842 TTGGATTTATAGGTTAAGTTGGG + Intergenic
928050097 2:27983524-27983546 TGGGATCTACAGATCAACTTGGG + Intronic
928191257 2:29171165-29171187 TTGACTATATAGATCAAGTTGGG + Intronic
928812939 2:35251046-35251068 TTGTATGCATAGATAAAGTTAGG + Intergenic
929072045 2:38040785-38040807 TTAAATCTACAGATCAGGTTAGG + Intronic
929420733 2:41787134-41787156 ATGTATTTACAGAGCACCTTGGG - Intergenic
929491712 2:42402951-42402973 TTGAATTTATAGATCAATTTGGG + Intronic
929497841 2:42461918-42461940 TTTTATCTACAGAACAACTTGGG + Intronic
929766860 2:44851109-44851131 TGGGATTTACAGATTAATTTAGG - Intergenic
929900367 2:45995932-45995954 TTGAATATATAGATCGAGTTTGG + Intronic
929906718 2:46052569-46052591 TTGAATGTAGAGATCAATTTGGG - Intronic
930042313 2:47136049-47136071 TGGAATTTAAAGATCAAATTGGG + Intronic
930875853 2:56214938-56214960 TTGAACCTACAGATCAAGTTGGG + Intronic
930977720 2:57484341-57484363 TTGAATCTGTAGATCAAGTTGGG + Intergenic
931372289 2:61674844-61674866 GTCTATTTACACATCTAGTTAGG + Intergenic
931580619 2:63768455-63768477 TTGAATTTATAGATGAAATTGGG + Intronic
931865078 2:66400851-66400873 CTGATTTTACAGATTAAGTTGGG + Intergenic
931865216 2:66402588-66402610 TTGATTTTACAGATTAAGTTGGG - Intergenic
931965306 2:67526968-67526990 TTGAATCTACAGATAAAGTTGGG - Intergenic
931969517 2:67570089-67570111 TTGGATTTTCAGGTAAAGTTTGG + Intergenic
931993414 2:67814489-67814511 TTGAATATATAGATCAATTTAGG - Intergenic
932150238 2:69364326-69364348 TTTTAATAACAGATAAAGTTAGG + Intronic
932155246 2:69410821-69410843 TTAAATTTACAGATTAAATTTGG - Intronic
932189521 2:69728925-69728947 TTGAATTTATAGATCAATTTGGG + Intronic
932470840 2:71955149-71955171 TTGAATATATAGATCAAGTTGGG + Intergenic
932513448 2:72319791-72319813 TTGAATTCAGAGATCAATTTGGG - Intronic
932743368 2:74309589-74309611 TTGCATCTATAGATCAAGTTGGG + Intronic
933111254 2:78403504-78403526 TTATATTTAGAGATGAAGTTGGG + Intergenic
933661799 2:84933734-84933756 TTGAGTCTACAGATCAGGTTGGG - Intergenic
933838817 2:86268554-86268576 TTGAATCTATAGATCAAGTTGGG - Intronic
934016003 2:87882659-87882681 TTGAATTTATAGATCAATTTGGG + Intergenic
935510695 2:103969518-103969540 TTGAATCCGCAGATCAAGTTGGG + Intergenic
935518612 2:104077348-104077370 TTAAATCTATAGATCAAGTTGGG + Intergenic
935750438 2:106228135-106228157 TTTGATCTACAGATTAAGTTGGG + Intergenic
935814523 2:106834865-106834887 TTGCATTCATAGTTCAAGTTTGG - Intronic
935835359 2:107046133-107046155 TTGAATTTACAGATTAATTTGGG - Intergenic
935875944 2:107507847-107507869 TTGAATCTATAGAGCAAGTTGGG + Intergenic
936005167 2:108880342-108880364 TTGTATCTATAGATCAAGTTGGG - Intronic
936120828 2:109742596-109742618 TTGGATCTACAGATTAAGTTGGG - Intergenic
936149184 2:110002794-110002816 TTATTTTTACACATTAAGTTAGG + Intergenic
936176347 2:110224071-110224093 TTGAATTTACAGATAAATTGGGG + Intergenic
936195497 2:110368575-110368597 TTATTTTTACACATTAAGTTAGG - Intergenic
936223869 2:110628877-110628899 TTGGATCTACAGATTAAGTTGGG + Intergenic
936255962 2:110912191-110912213 TTATATCTACAGATTAATTTAGG - Intronic
936498411 2:113044032-113044054 TTGGATCTACAGGTCAAGTTGGG + Intronic
936575781 2:113653715-113653737 TTGAATTTGCAGGTCAATTTGGG - Intergenic
936772301 2:115928668-115928690 ATGAATCTACAGAACAAGTTGGG + Intergenic
937193398 2:120126842-120126864 TTGAATTTACACATCAGTTTGGG + Intronic
937698005 2:124829306-124829328 TTGCATTTACAGAACCAGTATGG + Intronic
937850646 2:126631277-126631299 TTGCATCTATAGTTCAAGTTGGG - Intergenic
937961243 2:127461151-127461173 TTGCATCTATAGATCAATTTGGG - Intronic
938172620 2:129093115-129093137 GTCTATTTACACATCAAGTGAGG - Intergenic
938198113 2:129350091-129350113 TTGAATGTATAGATCAAGTTGGG + Intergenic
938449632 2:131405617-131405639 ATGTATTTCCACTTCAAGTTTGG + Intergenic
938554326 2:132410533-132410555 TTGAATCTATAGATCAATTTTGG + Intergenic
939802294 2:146724920-146724942 TTGAATTTATAGATCAAGTTGGG - Intergenic
939911979 2:147994280-147994302 TTGAATTTATAGATCAAGGTTGG - Intronic
940278119 2:151960959-151960981 CTGTATTTAAAAATCAACTTTGG - Intronic
940472908 2:154121393-154121415 TTGAATTTATAGATCAAGTTGGG + Intronic
940619312 2:156090930-156090952 TTGAAACTATAGATCAAGTTGGG + Intergenic
940620189 2:156102959-156102981 TTGAATCTGAAGATCAAGTTGGG - Intergenic
940714156 2:157200147-157200169 TTGAATCTATAGATCAAGTTGGG - Intergenic
940732600 2:157410654-157410676 CTGAATCTACAGATTAAGTTGGG + Intergenic
940852038 2:158697134-158697156 TTGAATCTATAGATCAAGTTGGG - Intergenic
941242594 2:163058088-163058110 TTGAGTCTATAGATCAAGTTAGG + Intergenic
942012807 2:171780004-171780026 CTGAATTTATAGATCAATTTGGG - Intergenic
942271427 2:174279493-174279515 TTGAATCTATAGATCAATTTGGG + Intergenic
942532787 2:176930149-176930171 TTGAATTTACAAATCAATTTAGG - Intergenic
942686426 2:178537343-178537365 TTGTATTTCCACATCAAGGATGG + Exonic
942757076 2:179353999-179354021 TTGAATTTACAGATTAATTTAGG + Intergenic
942833893 2:180269215-180269237 TTGTATTTACAAAGGCAGTTTGG - Intergenic
942887587 2:180945964-180945986 TTGAATGTATAGATCAATTTGGG + Intergenic
943142516 2:184000357-184000379 CTGTAATTACACATCCAGTTAGG + Intergenic
943284953 2:185985904-185985926 CTGTCTTTACAGAAAAAGTTTGG - Intergenic
943415911 2:187603695-187603717 TTGAATTTATAGGTCAGGTTGGG - Intergenic
943502996 2:188715413-188715435 ATGTATATGTAGATCAAGTTGGG + Intergenic
943814313 2:192232338-192232360 TTATATTTGCAGTTAAAGTTAGG + Intergenic
943848162 2:192678432-192678454 TTGTAATTACAGATTACATTAGG - Intergenic
943918636 2:193673431-193673453 TTGAATTTATAGATGAATTTGGG - Intergenic
943948346 2:194096134-194096156 GTCTTTTTACACATCAAGTTGGG - Intergenic
944466646 2:200008146-200008168 TTGAATTTACAGATCATTTGAGG + Intronic
945021485 2:205576861-205576883 TTGAATCTGTAGATCAAGTTGGG + Intronic
945283006 2:208054712-208054734 TTGAATTTACAGATCATTTAAGG + Intergenic
945327836 2:208503348-208503370 TTGAATCTATAGATCAATTTTGG + Intronic
945674226 2:212835727-212835749 TTGAATCTATAGATGAAGTTAGG + Intergenic
945953198 2:216059956-216059978 CTGAATCTACAGATCAATTTGGG + Intronic
947030696 2:225790193-225790215 TTGAATCTATAGATCAAGTTAGG + Intergenic
947524723 2:230871184-230871206 TTGTATTTAGGGGTCAAGTGGGG - Intronic
947526552 2:230880102-230880124 ATGTTTTTACAGGTCAAGTTAGG + Intergenic
947526712 2:230881415-230881437 ATGTTTTTACAGGTCAAGTTAGG + Intergenic
947891414 2:233624731-233624753 TTGAATTTATAGATCAACTGGGG + Intronic
947896358 2:233677112-233677134 TTTTATTTATAGATCAACTGGGG + Intronic
1168999625 20:2158888-2158910 TTAAATTTAAAGATCAAATTAGG + Intronic
1169009186 20:2236068-2236090 TTTTATTTACAAACCATGTTGGG - Intergenic
1169032933 20:2426070-2426092 TTGAATCTATAGATCAAGCTAGG + Intronic
1169312567 20:4558233-4558255 TTGGATCTATAGATCAAGTCAGG - Intergenic
1170066741 20:12318785-12318807 TTGTATTTCAAGAGCAAGATGGG + Intergenic
1170161491 20:13317365-13317387 TTGAATCTATAGATCAAGTTGGG - Intergenic
1170378152 20:15725159-15725181 TTGAATCTATAGATCAAGTTGGG + Intronic
1170410910 20:16090390-16090412 TTGAATTTGTAGATCAATTTGGG - Intergenic
1171432921 20:25096608-25096630 TTGAATCTATAGATTAAGTTAGG - Intergenic
1172089235 20:32416033-32416055 TTGAATCTACAAATCAAATTGGG - Intronic
1172785115 20:37463675-37463697 TTGAATCTATAGATCAATTTGGG + Intergenic
1173368696 20:42414807-42414829 TTGAATTTATAGATTAATTTAGG - Intronic
1175043739 20:56082003-56082025 TTGGATATATAGATCAATTTGGG + Intergenic
1175317809 20:58063704-58063726 TTGAATCTACGGATCAACTTGGG - Intergenic
1175338537 20:58212623-58212645 CTGTACATACAGATCAAGTCAGG + Intergenic
1176335288 21:5591694-5591716 TTGTATTTGCAAATCAAGCGAGG - Intergenic
1176392469 21:6229254-6229276 TTGTATTTGCAAATCAAGCGAGG + Intergenic
1176405524 21:6360236-6360258 TTGTATTTGCAAATCAAGCAAGG - Intergenic
1176468950 21:7086920-7086942 TTGTATTTGCAAATCAAGCGAGG - Exonic
1176492511 21:7468698-7468720 TTGTATTTGCAAATCAAGCGAGG - Intergenic
1176508131 21:7669685-7669707 TTGTATTTGCAAATCAAGCGAGG + Intergenic
1176865482 21:14050468-14050490 TTGTATTTAAAAATCAATTAAGG + Intergenic
1177125498 21:17188406-17188428 TTGAATCTATAGATCAATTTGGG - Intergenic
1177349581 21:19919423-19919445 TTGAATCTCTAGATCAAGTTGGG - Intergenic
1177468740 21:21526552-21526574 CTGACTCTACAGATCAAGTTGGG - Intronic
1177799221 21:25811396-25811418 TTGAATCTATAGATCAATTTGGG - Intergenic
1178031500 21:28531867-28531889 TTGAATCTATAGATCAAGTTGGG + Intergenic
1178574874 21:33777510-33777532 TTGAATTTATAAATCAATTTGGG + Intronic
1179056580 21:37941706-37941728 TTGACTTTACAGATAAATTTGGG + Intergenic
1179391637 21:40997649-40997671 TAGTGTTTATAGATCAAGGTGGG + Intergenic
1179457804 21:41511261-41511283 TTGTCTTTAGAGATAAAGTATGG - Intronic
1180583566 22:16865403-16865425 TTATTTTTACACATTAAGTTAGG - Intergenic
1181158816 22:20944107-20944129 TTGTATTTGTAGATCACTTTGGG + Intronic
1182043385 22:27255683-27255705 TTGTATTTGTAGACCTAGTTCGG + Intergenic
1182407338 22:30147110-30147132 TTGAATGTATAGATCAATTTGGG - Intronic
1182581613 22:31316198-31316220 TTTGATCTATAGATCAAGTTGGG - Intergenic
1182824263 22:33250102-33250124 TTGAATCTACAGATAAAGTTAGG + Intronic
1182968080 22:34542448-34542470 TTGCATTTCTAGATCAATTTGGG + Intergenic
1183694159 22:39410776-39410798 TTAAATCTACAGATCAATTTGGG - Intronic
1185164149 22:49248627-49248649 TTGAATCTATAGATCAATTTAGG + Intergenic
1185263007 22:49880799-49880821 TTGAATTTATAGGTCAATTTGGG + Intronic
1185350589 22:50335005-50335027 TTGGATCCACAGATCAATTTGGG + Intergenic
1185364036 22:50427463-50427485 TTGAATTTATAGATCACTTTGGG + Intronic
1185424625 22:50759744-50759766 TTGAATTTGCAGATCAATTTGGG + Intergenic
949292227 3:2480680-2480702 TCGAATCTATAGATCAAGTTGGG - Intronic
949389875 3:3548423-3548445 TTGAATCTATAGATCAAGTTAGG + Intergenic
949637748 3:6002232-6002254 TTAAATTTATAGATCAACTTGGG - Intergenic
949915267 3:8957247-8957269 TTGAATCTAGAGATCAATTTGGG - Intronic
950321764 3:12061944-12061966 CTGCATCTACAGATCAAGTTGGG - Intronic
950352148 3:12365969-12365991 TTGAATCTATAGATCAAGTTGGG + Intronic
950610415 3:14123533-14123555 CTGTAGTTACACATCCAGTTAGG - Intronic
950822344 3:15774607-15774629 TTATCTTTACAACTCAAGTTAGG + Intronic
950843517 3:15990769-15990791 TTGAATCTATAGATCAATTTGGG + Intergenic
950959115 3:17085986-17086008 TTGAATCTATATATCAAGTTGGG - Intronic
951129506 3:19025002-19025024 TTTTATTTACAGACCATGTTAGG + Intergenic
951265920 3:20566657-20566679 TTGAATCTATAAATCAAGTTGGG + Intergenic
951277584 3:20707849-20707871 TTGAATTTATAAATCAATTTGGG + Intergenic
951430421 3:22600535-22600557 GTGAATTTATAGATCAATTTGGG - Intergenic
951616631 3:24553997-24554019 TTGAATCTGCAGATCAATTTTGG + Intergenic
951719470 3:25682792-25682814 TTGAATTTGTAGATCAATTTGGG - Intergenic
951872276 3:27377276-27377298 TTGTATTTATGAATCAAATTTGG - Intronic
951974078 3:28483551-28483573 TTGAATTTATATATCAAGTTGGG + Intronic
952128135 3:30327149-30327171 TTGAATCTATACATCAAGTTGGG - Intergenic
952426239 3:33177292-33177314 TTCAATCTATAGATCAAGTTGGG + Intronic
952473262 3:33678842-33678864 TTGAATCCATAGATCAAGTTGGG - Intronic
952559222 3:34570293-34570315 TTGAATCTACAGGTCAATTTGGG + Intergenic
952703930 3:36357450-36357472 TTGAATCTATAGATCAAGTTGGG + Intergenic
952954365 3:38548101-38548123 TTTTATTTATACATGAAGTTTGG + Exonic
953110226 3:39929310-39929332 TTATATTTACATATCAATTTGGG - Intronic
953192778 3:40703727-40703749 TTGACTCTATAGATCAAGTTGGG + Intergenic
953270638 3:41439792-41439814 TTGAGTTTACACATCAATTTTGG + Intronic
953422733 3:42767508-42767530 TTGAATCTATAGATCAAGTTGGG - Intronic
953600102 3:44354478-44354500 TTGAATCTATAGATCAAGTTGGG + Intronic
954694832 3:52417359-52417381 TTGAATTTATAGGTCAATTTGGG + Intronic
955169990 3:56554272-56554294 TTGAATCTATAGATCAAGTTGGG + Intergenic
955210034 3:56932392-56932414 TTGTATATACAGTACAATTTGGG - Intronic
955224754 3:57051519-57051541 TTGTAATTACAGATAAGGGTTGG + Intronic
955262881 3:57411754-57411776 TTGAATCTACATGTCAAGTTTGG - Intronic
956145785 3:66189324-66189346 GTGTATTTGGGGATCAAGTTGGG - Intronic
956195075 3:66646316-66646338 TTGTATCTACATATTAATTTAGG - Intergenic
956339017 3:68199427-68199449 TTGAAATTATAGATCAAGCTGGG + Intronic
957037200 3:75304929-75304951 TTGAATCTACAGATCAATTTGGG + Intergenic
957638165 3:82814662-82814684 TTGAATTTATAGATCAATTAGGG + Intergenic
957817984 3:85327747-85327769 TTTTATTTACAGATTTTGTTTGG + Intronic
958001732 3:87759324-87759346 TTGAATCTATAGATCAAGTTGGG - Intergenic
958141977 3:89572567-89572589 TTGAATTAACATATCAATTTCGG - Intergenic
958443724 3:94189085-94189107 TTGAATCTATAGACCAAGTTGGG + Intergenic
958581826 3:96035889-96035911 TTGCATCTATAGATCAAGTTGGG + Intergenic
958898359 3:99855945-99855967 ATGTATTTACAGATTTCGTTAGG - Intronic
959499935 3:107094949-107094971 TTGAATCTATAGATCAAGTTGGG - Intergenic
959646567 3:108709988-108710010 TTATATTTAGAGATCAATTTGGG - Intergenic
959660882 3:108866985-108867007 TTTTGTTTACATATCAATTTTGG - Intergenic
959666572 3:108929004-108929026 TTGAATCTACAGATCAACTTGGG + Intronic
959998450 3:112704345-112704367 TTGAATTTGCAGATCACTTTTGG - Intergenic
960020370 3:112945146-112945168 TTGAATACATAGATCAAGTTGGG - Intronic
960220557 3:115103274-115103296 TTGAATCTATAGATCAATTTGGG - Intronic
960227073 3:115181041-115181063 TTGAATCTACAGATCAAGTCAGG - Intergenic
960652736 3:119969422-119969444 TTGAATTTGCAGATCAAGTTGGG - Intronic
960822966 3:121753734-121753756 TTGAATCTACAGATAAAGTTGGG - Intergenic
960860909 3:122152812-122152834 TTGAATCTGCAGATCAATTTGGG + Intergenic
960889250 3:122429629-122429651 TTGAATCTATAGATCAAGTTGGG - Intronic
960900112 3:122545884-122545906 TTCAATTTACAGACCAAGTTTGG - Intronic
960982898 3:123248656-123248678 TTGAATCTATAGACCAAGTTGGG - Intronic
961662150 3:128475121-128475143 TAGTTTTTCCAGATAAAGTTTGG + Intergenic
961914790 3:130362694-130362716 TTAAATCTACAGATCAATTTGGG + Intronic
962194322 3:133347202-133347224 TTGAATCTGTAGATCAAGTTGGG + Intronic
962326386 3:134436715-134436737 TTACATCTACAGATCAATTTGGG + Intergenic
962730483 3:138278626-138278648 TTGTATTTATAAATAAATTTGGG + Intronic
963014992 3:140814744-140814766 TTGAATTTATAGATCAAGCTGGG - Intergenic
963406853 3:144876257-144876279 TTGAATCTACAGATCACTTTTGG + Intergenic
963514073 3:146286295-146286317 TTGTATCTATAGATCAATTTGGG + Intergenic
963823878 3:149930392-149930414 TTGAATTTATAAATCAAGTTGGG + Intronic
964397556 3:156261800-156261822 TTGAATTTCTAGATCAATTTGGG + Intronic
964460814 3:156925003-156925025 TTGAATCTATAGATCAATTTGGG + Exonic
964520194 3:157557579-157557601 TTGAATTTATAGATCACTTTGGG - Intronic
964885247 3:161474617-161474639 GTCTGTTTACACATCAAGTTAGG + Intergenic
965200701 3:165654442-165654464 TTGAATTCATAGATCAATTTAGG + Intergenic
965326527 3:167310917-167310939 ATGAATCTATAGATCAAGTTGGG - Intronic
965453652 3:168870394-168870416 TTTTATTTGAAGATCATGTTTGG + Intergenic
965538073 3:169845284-169845306 TTGAATTTATAGATCAATTCAGG - Intronic
965848922 3:172998104-172998126 TTGAATCTATGGATCAAGTTTGG + Intronic
966131542 3:176646228-176646250 TTAAATCTATAGATCAAGTTGGG - Intergenic
966178445 3:177165417-177165439 TTGAATTTGTAGATCAAGTTGGG - Intronic
966433196 3:179854143-179854165 TTGTATTGAAACATCAAGTCTGG - Intronic
966535571 3:181029560-181029582 TTGGATTTATACATCAAATTTGG + Intergenic
967423835 3:189303628-189303650 ATGAGTTTACAGACCAAGTTAGG - Intronic
967456861 3:189697619-189697641 TTGAATGTATACATCAAGTTGGG + Intronic
967490402 3:190084131-190084153 CTGAATCTACACATCAAGTTAGG + Intronic
967633347 3:191772837-191772859 TTGAATTCATAGATCAAATTCGG - Intergenic
968216364 3:196894871-196894893 TTATATTTATAGATTAATTTAGG + Intronic
968535130 4:1121549-1121571 TTGAATCTATAGAACAAGTTGGG - Intergenic
968623817 4:1617155-1617177 TTATATTTACAAATCAAGCAAGG + Intergenic
968825569 4:2894120-2894142 TTGTATGTGCAGGTCATGTTAGG + Intronic
968840250 4:2998784-2998806 TTGAATCTATAGATCAATTTGGG - Intronic
969062194 4:4445756-4445778 TTGAATTTATAGATCAATTTGGG - Intronic
969625164 4:8299051-8299073 TTGAATTTACAGATCAATTTGGG + Intronic
970352711 4:15219654-15219676 TTCAATTTATAGATCAAATTTGG - Intergenic
970451837 4:16176218-16176240 TTCTATTTACAGATCATCTCTGG - Exonic
970534470 4:17015799-17015821 TTGAATCTACAGATCAATATGGG + Intergenic
970707253 4:18819491-18819513 TTGTATTTGCATATCATCTTGGG + Intergenic
970997825 4:22288061-22288083 TTTTTTTTTCAGCTCAAGTTAGG + Intergenic
971458282 4:26865487-26865509 TAGTATTTTCAGATTAATTTAGG + Intronic
971521819 4:27562117-27562139 TTGTATTTACAAAACATGATGGG - Intergenic
971526004 4:27620038-27620060 TTGAATCTATAGATCAATTTGGG - Intergenic
971928115 4:33041272-33041294 TTCTATTTTCAGATCAGTTTAGG + Intergenic
971956269 4:33423353-33423375 TAGTATCTAAAGATCATGTTTGG - Intergenic
972227585 4:37031575-37031597 TTGAATTTAGATATAAAGTTTGG + Intergenic
972327416 4:38029976-38029998 ATGCATTTACAATTCAAGTTGGG + Intronic
972352509 4:38249074-38249096 GTGAATTTAAAGATCAATTTGGG + Intergenic
972830089 4:42804522-42804544 TTGAATCTACAGATCAAATTGGG + Intergenic
973986358 4:56357914-56357936 TTTAATTTACAGATCAATTTGGG + Intronic
974170238 4:58257524-58257546 TTGAATTTATAGATCAAGTTGGG - Intergenic
974364091 4:60923281-60923303 CTGTATTTACATATCAATTATGG + Intergenic
974380961 4:61139434-61139456 TTGTATTTAGGGATCAACTGAGG + Intergenic
974475012 4:62367291-62367313 TTGAATCTACAGATCAAATTGGG - Intergenic
974574058 4:63693764-63693786 GTGTGTTTCCAGATAAAGTTAGG - Intergenic
974655779 4:64819137-64819159 TTGAATCTACAGATCAATCTGGG + Intergenic
974744042 4:66046547-66046569 TTGTTTTTACAGATCAGTATTGG + Intergenic
975337110 4:73190986-73191008 TTGAATTTACAGATTAATTTGGG - Intronic
975958394 4:79870276-79870298 TTGAAGCTATAGATCAAGTTGGG - Intergenic
976060301 4:81119946-81119968 TTGAATTTATAGATCAAGTTGGG + Intronic
976346451 4:84008377-84008399 TTGACTCTACAGATCAAGTGGGG + Intergenic
976986831 4:91311112-91311134 ATGTATTTACAGAAGAAGATAGG + Intronic
977005284 4:91561014-91561036 ATGTATTTAAAGTACAAGTTTGG - Intronic
977111203 4:92957720-92957742 TATTATTTATAGATCAAATTGGG + Intronic
977112281 4:92973285-92973307 TTCTATTTAAACATCAAGGTGGG - Intronic
977454478 4:97240730-97240752 TTGAATCTATAGATCAAGTTGGG - Intronic
977482965 4:97601855-97601877 CTAAATTTATAGATCAAGTTGGG + Intronic
977488726 4:97684169-97684191 TTGTATCTATAGATCAAATTGGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978129397 4:105176690-105176712 CTGAATCTATAGATCAAGTTGGG - Intronic
978152345 4:105451946-105451968 TTTTATTTTCAGATAAAATTTGG - Intronic
978174272 4:105709792-105709814 TTGTTTTTACAGATAAGCTTAGG - Intronic
978213563 4:106169137-106169159 TTGAATCTACATATCAATTTGGG - Intronic
978262487 4:106777357-106777379 CTGTATTTATAGATAAATTTGGG - Intergenic
978415481 4:108471144-108471166 TTGAATCCATAGATCAAGTTGGG - Intergenic
978665763 4:111179441-111179463 TTGAATCTAAAGACCAAGTTTGG + Intergenic
978881918 4:113714950-113714972 TTGAATTTATAGATTAATTTGGG + Intronic
978948881 4:114532747-114532769 TTGAATATATAGATCAATTTGGG - Intergenic
979613570 4:122716226-122716248 TTGTATTTAAAAATGAGGTTAGG - Intergenic
979723293 4:123929273-123929295 TTGGATTTCCAGATCAATTTAGG - Intergenic
979749906 4:124266370-124266392 TTGAATCTACAAATCAATTTGGG - Intergenic
979903360 4:126252265-126252287 TTGAACCTATAGATCAAGTTGGG - Intergenic
979952594 4:126912718-126912740 TTGAATCTATAAATCAAGTTGGG - Intergenic
980006269 4:127545492-127545514 TTAAATTTATAGATCAACTTAGG - Intergenic
980348809 4:131662280-131662302 GTTTTTTTACAAATCAAGTTTGG + Intergenic
980533847 4:134089684-134089706 CTGTATTTTCAATTCAAGTTTGG - Intergenic
980584798 4:134797922-134797944 TTAAATCTACAGATCAAATTGGG - Intergenic
981198678 4:141951397-141951419 TTAAATTTATAGATCAATTTGGG - Intergenic
981328481 4:143480158-143480180 TTGAACTTAAAGATCAACTTTGG - Intergenic
981396583 4:144256759-144256781 TTAGATCTACAGATCAATTTAGG + Intergenic
981760996 4:148194177-148194199 CTATATTTACAGATTAACTTAGG + Intronic
981874719 4:149528284-149528306 TTCTATTTAAAAATCAAGATAGG - Intergenic
982134499 4:152260535-152260557 TTGAATCTATAGATCAATTTGGG - Intergenic
982491412 4:156034370-156034392 TTGAATCTATAGATCAAGTTGGG + Intergenic
982566053 4:156988226-156988248 TTAAATCTACAGATCAATTTGGG + Intergenic
982588818 4:157278042-157278064 TTGAATCTATAAATCAAGTTGGG - Intronic
982664179 4:158241193-158241215 TGGTATTTGCAGATAATGTTCGG + Intronic
983091621 4:163510212-163510234 TTGTTTTTTAAGATCAACTTTGG + Intronic
983158388 4:164380748-164380770 TTGTATTTCCAGAAAAAGTTAGG + Intronic
983161059 4:164414863-164414885 TTGAATTTACAGGTCAATTTTGG - Intergenic
983251636 4:165352425-165352447 TTGAATTTGCAGATAAATTTGGG - Intergenic
983461723 4:168032639-168032661 TTGAATCTATAGATCAATTTAGG + Intergenic
983571614 4:169214496-169214518 TTGAATCTATAGATCAAGTTGGG + Intronic
984017895 4:174447490-174447512 TTGTTTATACAGATCCATTTTGG + Intergenic
984183049 4:176508754-176508776 TTCTCCTTACAGATCAAGTAAGG - Intergenic
984259027 4:177422165-177422187 TTGAATCTGCAGGTCAAGTTGGG + Intergenic
984319799 4:178179346-178179368 TTGAATCTGCAGATCAATTTGGG - Intergenic
984426094 4:179587598-179587620 TTTTATATACAGTTCAAGGTAGG + Intergenic
984636632 4:182117856-182117878 TTGAATCTGTAGATCAAGTTGGG + Intergenic
985352344 4:189078419-189078441 TTGAATCTATAGATCAATTTTGG - Intergenic
985527076 5:410585-410607 TTATATCTACAGATCAATTTAGG + Intronic
985759647 5:1739661-1739683 TTGAATCTACAGATCAATTTGGG + Intergenic
985812591 5:2100913-2100935 TTGTATGGACAGACCACGTTGGG - Intergenic
986119063 5:4813794-4813816 TTGAATTTACACATCAAGCTGGG + Intergenic
986261342 5:6149973-6149995 GGGTATTGACAGATCAAGTGTGG + Intergenic
986344913 5:6825819-6825841 TCGAATATGCAGATCAAGTTTGG + Intergenic
986398380 5:7354047-7354069 ATGTATTTGCAGATAAAGTTGGG - Intergenic
987689654 5:21250674-21250696 TTGAATCTACAGATCACTTTGGG + Intergenic
987895840 5:23944697-23944719 TTGAACTTATATATCAAGTTAGG + Intergenic
988007438 5:25435066-25435088 TTGAATCTATAGATCAAGTTGGG - Intergenic
988186991 5:27877844-27877866 ATGAATCTATAGATCAAGTTGGG + Intergenic
988335131 5:29897729-29897751 TTTAATTTATAGATCAATTTAGG + Intergenic
988647701 5:33112282-33112304 GTGAATCTACAGATCAAGTTGGG + Intergenic
989015688 5:36930066-36930088 TTGTATTTTCCTATAAAGTTAGG + Intronic
989288689 5:39735423-39735445 TTGAATCTATAGATTAAGTTGGG + Intergenic
989300239 5:39882750-39882772 ACTTATTTACAGATTAAGTTTGG + Intergenic
989373874 5:40739320-40739342 CTGAGTTTACAGATCAATTTCGG + Intronic
989776717 5:45217628-45217650 TTGGATCTATAGATCAAGTCAGG - Intergenic
989955456 5:50354162-50354184 TTATATCTACAGATCAGTTTGGG + Intergenic
990035614 5:51314901-51314923 TTGTATCTATATGTCAAGTTGGG + Intergenic
990096978 5:52128087-52128109 TTGAATCTATAGATCAAGTTGGG - Intergenic
990142072 5:52716826-52716848 TTTAATCTACAGATCAAGCTGGG + Intergenic
990326684 5:54683689-54683711 TTGAATCTACAGATCAAGTAAGG + Intergenic
990548951 5:56853303-56853325 TTATATTTGCAGATTAATTTAGG + Intronic
990723567 5:58727041-58727063 TTATATTTACAGTTAAAGTGCGG - Intronic
990818220 5:59808837-59808859 TTGTCTTTACAGAAGAACTTGGG - Intronic
991008082 5:61851220-61851242 TTGAATTTATAGATCAAATTGGG - Intergenic
991119146 5:62991077-62991099 TTGAATCTGTAGATCAAGTTGGG + Intergenic
991133994 5:63159708-63159730 TTGTGTTTATAGATCAAGTTGGG + Intergenic
991537084 5:67681458-67681480 TTGCATTTACAGATTAAATGGGG - Intergenic
991647254 5:68813117-68813139 TTGAGTATACAGATCAAGTTGGG + Intergenic
992132855 5:73711392-73711414 TTATATCTATAGATCAAATTGGG + Intronic
992264001 5:74999620-74999642 TTGAACATACAGATTAAGTTGGG + Intergenic
992411170 5:76506941-76506963 TTGGACCTATAGATCAAGTTGGG - Intronic
992485812 5:77193734-77193756 TTGAATCTATAGATCAATTTAGG + Intergenic
992533653 5:77676186-77676208 CTGACTCTACAGATCAAGTTGGG - Intergenic
992544686 5:77801062-77801084 TTGAATCTATGGATCAAGTTAGG - Intronic
992601074 5:78400433-78400455 TTGAATCTGTAGATCAAGTTGGG + Intronic
992694269 5:79269503-79269525 TTGAATTTATAGATCAAGTTAGG + Intronic
993054067 5:82960286-82960308 TTGAATTTATAGATTAATTTTGG - Intergenic
993140850 5:84031406-84031428 TTGTATTTTCAGACAAATTTTGG + Intronic
993172856 5:84442478-84442500 TTGAATTTATAGATAAAGATGGG - Intergenic
993378496 5:87178649-87178671 TTGAATTTATGAATCAAGTTAGG - Intergenic
993445627 5:88009015-88009037 TTATATCTACAGCTCAATTTAGG - Intergenic
993588747 5:89766757-89766779 TTGAATCTACAGATCAATGTGGG + Intergenic
993603157 5:89953766-89953788 TTCTATTTACAGACCATGTAGGG - Intergenic
993785610 5:92131189-92131211 TTGGATCTATAGATCAATTTGGG + Intergenic
993825705 5:92683665-92683687 TTGCATTTACACTTAAAGTTCGG - Intergenic
993952177 5:94189835-94189857 TGGAATTTATAGATCAATTTGGG + Intronic
994466805 5:100145319-100145341 TTGTATTTAAATATGAAGTGAGG - Intergenic
994582949 5:101670894-101670916 TTGTTTTTCCATATCATGTTTGG - Intergenic
994617498 5:102123770-102123792 TTGAATCTATAGATCAAGTTGGG + Intergenic
994738808 5:103593034-103593056 TTGAATTTGTACATCAAGTTGGG + Intergenic
994864564 5:105250227-105250249 TTGTATCTACAGATCACTTTGGG - Intergenic
995021570 5:107372674-107372696 TAATTTTTACAGATTAAGTTTGG + Intergenic
995072670 5:107942417-107942439 AAGAATTTGCAGATCAAGTTGGG - Intronic
995207318 5:109495711-109495733 TTTTATTTTAAGATCATGTTAGG - Intergenic
995285344 5:110382309-110382331 TTAAATCTATAGATCAAGTTGGG + Intronic
995780059 5:115765385-115765407 GTCTATTTACACATCAATTTGGG + Intergenic
996345402 5:122483296-122483318 TTGAAGTTACAGATCAATTTGGG - Intergenic
996592897 5:125167779-125167801 TTGAATCTGTAGATCAAGTTGGG - Intergenic
996778931 5:127161914-127161936 TTGAATCTATAGATCAAGTTGGG + Intergenic
996803003 5:127424436-127424458 TTGAATCTATAGATCAATTTGGG + Intronic
996967835 5:129326134-129326156 TTGTTTTTACAAAACAAGATTGG - Intergenic
997314238 5:132918803-132918825 TTGGATCTATAGATCAATTTGGG - Intronic
997857578 5:137386295-137386317 TTAAATCTCCAGATCAAGTTGGG - Intronic
998178823 5:139921170-139921192 TTGAATCGATAGATCAAGTTGGG - Intronic
998503529 5:142653743-142653765 TTGTATTTTCTGATTAAGTCAGG + Intronic
998757187 5:145393707-145393729 AACTATTTACACATCAAGTTAGG + Intergenic
998962135 5:147499630-147499652 TCGAATCTAAAGATCAAGTTGGG - Intronic
999564765 5:152845922-152845944 TTGAATTTGTAGATCAAGTTGGG + Intergenic
999567678 5:152883621-152883643 TGCTATTTAAAGATCCAGTTGGG + Intergenic
1000054094 5:157588671-157588693 TTAATTCTACAGATCAAGTTAGG + Intergenic
1000235023 5:159349807-159349829 TTGAATTTACACATCAGTTTGGG + Intergenic
1000238745 5:159389015-159389037 CTGAATCTATAGATCAAGTTGGG + Intergenic
1000301288 5:159958683-159958705 TTGAATTTTCAGATTAATTTGGG + Intronic
1000402795 5:160849784-160849806 TTTTATTAAGAGATGAAGTTGGG - Intronic
1000405225 5:160880370-160880392 TTGAACCTATAGATCAAGTTTGG - Intergenic
1000802667 5:165748085-165748107 GTCTATTTAGAGATCACGTTTGG + Intergenic
1000817148 5:165937321-165937343 ATGAATTTGCAGATCAAATTAGG - Intergenic
1000839440 5:166198406-166198428 TTGAATTTACAGATCAATTTGGG + Intergenic
1000913824 5:167055474-167055496 TTGAATCTATAGATCAAGTTGGG + Intergenic
1001462630 5:171931098-171931120 TTGAATCTATAGATCCAGTTGGG - Intronic
1001870054 5:175145951-175145973 TTGAATCTATAGAACAAGTTGGG - Intergenic
1002383408 5:178847539-178847561 TTGCACTTATAGAGCAAGTTGGG - Intergenic
1002892211 6:1344914-1344936 TTGAACCTATAGATCAAGTTTGG - Intergenic
1003262853 6:4537859-4537881 TTGAATCTGCAGATCAATTTGGG - Intergenic
1004033418 6:11896287-11896309 TTGAATCTATAGATCAAGTTGGG + Intergenic
1004435349 6:15587321-15587343 TTGCATGTATAGATCAATTTGGG - Intronic
1004589928 6:17040500-17040522 TTGTAATTAAAAATAAAGTTAGG + Intergenic
1004788646 6:18998534-18998556 TTGAATTTATAAATCAAGTTGGG + Intergenic
1005007532 6:21303935-21303957 TTGAATCTATAGATCAACTTAGG - Intergenic
1005216836 6:23538856-23538878 TTGAATCTATAGATTAAGTTGGG + Intergenic
1005228199 6:23667590-23667612 TTGAATTTATAGATCAAATTGGG + Intergenic
1005265045 6:24102963-24102985 TTGTTTCAACAGATCCAGTTTGG + Intergenic
1005424460 6:25687254-25687276 TTGAATCTGCAGATCAATTTGGG + Intronic
1005658100 6:27964728-27964750 TTGGATCTATAGATCAATTTGGG + Intergenic
1005708675 6:28482295-28482317 TTGTATCTATAGATCAAATTGGG - Intergenic
1006431123 6:33996557-33996579 TTGAATCTACAGATCATTTTGGG - Intergenic
1006874422 6:37282870-37282892 TTCTATTTACAGATGAACTGAGG + Exonic
1007244103 6:40447726-40447748 TTCTATTTACAGATAAGGTGAGG + Intronic
1007303736 6:40888470-40888492 TTGTTTTTAAAGATAAAGTAAGG + Intergenic
1007920389 6:45604033-45604055 TTGAATCTACAGATAAATTTGGG - Intronic
1008013860 6:46495875-46495897 TTTAATCTACAGATCAAGGTGGG + Intergenic
1008258714 6:49337887-49337909 TTGAATCTACAGATCAGTTTGGG - Intergenic
1008740931 6:54607161-54607183 TTGAATCTATAAATCAAGTTGGG + Intergenic
1008863115 6:56175704-56175726 TTGAATCTGTAGATCAAGTTAGG - Intronic
1008907162 6:56691537-56691559 TTTTATTAAAAGATAAAGTTAGG + Intronic
1008948071 6:57121441-57121463 TTGAATATATAGATCAAGTTAGG + Intronic
1009284102 6:61792831-61792853 TTGTATTCACAAATTAATTTGGG - Intronic
1009633240 6:66227664-66227686 TTGAATTTATAGATCAGTTTTGG + Intergenic
1009879627 6:69549951-69549973 TTCAATCTACAGATCAATTTGGG + Intergenic
1010035052 6:71315626-71315648 TTGAATCTAAAGATCAATTTGGG - Intergenic
1010040173 6:71372449-71372471 CTGAATCTACAGATCAACTTGGG + Intergenic
1010338384 6:74717268-74717290 TTGAATTTATAGATCACTTTGGG + Intergenic
1010504420 6:76639934-76639956 TTGTATTTAGATTACAAGTTTGG + Intergenic
1010538318 6:77059342-77059364 TTGAATTTATAGATAAATTTGGG + Intergenic
1010564255 6:77390171-77390193 TTGAATTTGTAGATCATGTTGGG + Intergenic
1010679973 6:78787439-78787461 TTGGATATACAGATTAATTTGGG - Intergenic
1010770712 6:79826341-79826363 TTGTATCTAAAGGTCAGGTTGGG - Intergenic
1011010353 6:82696397-82696419 TTGTATTTCTAGATCACCTTTGG - Intergenic
1011017854 6:82778612-82778634 TTGAATCTACAGAGCAATTTGGG - Intergenic
1011505109 6:88033238-88033260 TTGAATCTACAGATCAAGTTGGG + Intergenic
1011913659 6:92473849-92473871 TTGTTTTTAGAGATCAGGTCTGG - Intergenic
1011963573 6:93123035-93123057 TTGTATCTATACATCAAGGTGGG + Intergenic
1012054489 6:94388438-94388460 ATGCATTTAAAAATCAAGTTGGG + Intergenic
1012293417 6:97488563-97488585 TTGCATCTACAGATCACGTTGGG + Intergenic
1012580136 6:100857935-100857957 CTGAATCTACAGATCAATTTGGG + Intronic
1012822184 6:104099795-104099817 TTGAATTGATAGATAAAGTTAGG - Intergenic
1013306956 6:108857135-108857157 TTGAATCTATAGATCAAGTTGGG + Intronic
1013440679 6:110163657-110163679 TTGAATCTACAGATCAAGTTGGG - Intronic
1013466496 6:110421810-110421832 TTGAATTTTTAGATTAAGTTAGG - Intergenic
1013683802 6:112555039-112555061 TTGAATCTATAGATCAAGGTGGG + Intergenic
1013933254 6:115561699-115561721 TTCTATTTACAGATCATGGAAGG - Intergenic
1014521013 6:122441954-122441976 TTGAATCTATAGATCAGGTTGGG - Intergenic
1014539580 6:122658207-122658229 TTATATTTGCAGAACTAGTTTGG + Intronic
1014634905 6:123833493-123833515 TTGAAGCTATAGATCAAGTTGGG + Intronic
1014784645 6:125604461-125604483 TTGAATCTGTAGATCAAGTTGGG - Intergenic
1014994732 6:128127358-128127380 TTGAATCTTAAGATCAAGTTAGG + Intronic
1015086715 6:129303022-129303044 TTGAATTGATAGATCAATTTGGG + Intronic
1015322386 6:131890724-131890746 TTGTATACATTGATCAAGTTCGG + Exonic
1015570520 6:134616928-134616950 TTGAACTTACAGATTAATTTAGG - Intergenic
1015740607 6:136449620-136449642 GTCTGTTTACAGATCCAGTTAGG + Intronic
1016169932 6:140999925-140999947 TTGAATCTATAGGTCAAGTTGGG + Intergenic
1016177085 6:141093678-141093700 TTGAATTTATAGATTAAGTTGGG + Intergenic
1016223858 6:141709438-141709460 TTATATTTATAGATCAGTTTTGG - Intergenic
1016537862 6:145128268-145128290 TTTTATTTGTAGACCAAGTTGGG + Intergenic
1016611332 6:145993175-145993197 TTGTATTTACAGAAAAAAATTGG - Intergenic
1017080145 6:150660671-150660693 TTGGAATTATAGATAAAGTTTGG - Intronic
1017205372 6:151799617-151799639 TTGAATTTACAGGCCAACTTGGG + Intronic
1017397670 6:154021524-154021546 TTGGATCTATACATCAAGTTGGG + Intronic
1017519662 6:155190607-155190629 TTGTATTTATAGTTAATGTTCGG - Intronic
1017597176 6:156042160-156042182 TTGATTGTACAGATCAATTTCGG - Intergenic
1017624375 6:156333286-156333308 TTGAATCTATATATCAAGTTGGG + Intergenic
1017723745 6:157262471-157262493 TTGTATTTCCAGATTAACATTGG + Intergenic
1018097571 6:160404516-160404538 TTGAATATATACATCAAGTTGGG - Intronic
1018376094 6:163214421-163214443 TTGAATTTACAGAACACTTTGGG + Intronic
1018789246 6:167133671-167133693 TTGTATCTACAGATCGATTTGGG + Intronic
1018863282 6:167728134-167728156 TTAAATCTACAGATCAAGTTGGG - Intergenic
1019180367 6:170183504-170183526 GTCTGTTTACAGATCCAGTTAGG + Intergenic
1019836829 7:3394587-3394609 TTGAATGTATAGATCAATTTGGG + Intronic
1020075732 7:5257508-5257530 TTGAATCTATAGATCAAGTAGGG - Intergenic
1020662716 7:11001461-11001483 TTGAATCTATAGATCAAGTTGGG + Intronic
1020880778 7:13760870-13760892 ATCTGTTTACACATCAAGTTGGG + Intergenic
1021086533 7:16426818-16426840 TTGAATTTATAGATTAATTTTGG + Intergenic
1021241371 7:18206410-18206432 TTGTATTTACAAATTAGGTCAGG + Intronic
1021381646 7:19974656-19974678 TTGTATCTATATATCAAGTTAGG + Intergenic
1021634115 7:22674398-22674420 TTGTATTTGCATAAAAAGTTAGG + Intergenic
1022075117 7:26961099-26961121 TTGAATCTATAGATCAAGTTTGG - Intronic
1022135679 7:27446107-27446129 TTGAATCTGCAGATCAATTTGGG + Intergenic
1022296367 7:29058088-29058110 TTGAATCTATGGATCAAGTTGGG + Intronic
1022381412 7:29863637-29863659 TTGAATTTACAGATCAACCTGGG + Intronic
1022420672 7:30219839-30219861 TTGACTTTATAGATAAAGTTGGG - Intergenic
1022900540 7:34805108-34805130 TTGAATTTATAGATCACGTTGGG - Intronic
1022937614 7:35195678-35195700 CTGAATATATAGATCAAGTTGGG + Intergenic
1023217582 7:37880706-37880728 TTTAATCTACAGACCAAGTTGGG + Intronic
1023597032 7:41840899-41840921 CTGAATCCACAGATCAAGTTGGG + Intergenic
1023649472 7:42353851-42353873 TTGAATCTACAGATCAATTTGGG - Intergenic
1023838756 7:44083722-44083744 TTGAATCTATAGATCAAGCTGGG + Intergenic
1024416244 7:49110439-49110461 TTGTAGTTACTGATAAATTTTGG - Intergenic
1024467380 7:49726473-49726495 TTGCATCTATAGATCAATTTAGG + Intergenic
1024477129 7:49824618-49824640 TTTAATTTACAGATTAATTTTGG + Intronic
1024690110 7:51791551-51791573 TTGAATCTATAGATCAAATTGGG - Intergenic
1024720511 7:52131914-52131936 TTGAATCTGCAGATAAAGTTGGG + Intergenic
1024794044 7:53002087-53002109 TTGTATGTACAAATCAATTTTGG - Intergenic
1024810016 7:53199021-53199043 TTCTATTTAAAGATTAATTTGGG - Intergenic
1025203346 7:56976049-56976071 TTGAATCTATAGATCAAGTAGGG + Intergenic
1025668598 7:63600878-63600900 TTGAATCTATAGATCAAGTAGGG - Intergenic
1026108729 7:67441407-67441429 TTTTATTTACAAGTCTAGTTGGG + Intergenic
1026142321 7:67716999-67717021 GTCTGTTTACACATCAAGTTAGG + Intergenic
1026248222 7:68642673-68642695 TTGAATTTACAGACTAATTTGGG - Intergenic
1026292600 7:69021587-69021609 TTGAATTTATAGATCAGCTTGGG + Intergenic
1026586923 7:71663259-71663281 TTGAATTTTTAGATCAATTTTGG + Intronic
1026713060 7:72760231-72760253 TTGTAGTTTCAGATGAATTTAGG - Intronic
1027334740 7:77137671-77137693 TTGAATCTACAGATCAATTTGGG - Intronic
1027387976 7:77677297-77677319 TTGAATCTATAGATGAAGTTGGG + Intergenic
1027502879 7:78977015-78977037 TTGGATTTATAGACCAAGTTGGG - Intronic
1027582003 7:80009171-80009193 TTGAATCTACAGATTAAGTTTGG - Intergenic
1027684255 7:81262588-81262610 TTGTATCTATAAATCAAGTCAGG + Intergenic
1028004314 7:85542877-85542899 TTGAATCTATATATCAAGTTGGG + Intergenic
1028294584 7:89112686-89112708 TTAAATCTATAGATCAAGTTGGG + Intronic
1028372516 7:90109918-90109940 TTGAATATATAGATCAAGTTGGG - Intergenic
1029016294 7:97318242-97318264 TTCTTTTTACATATCTAGTTAGG + Intergenic
1029038254 7:97545881-97545903 TTAAATCTACAGATCAATTTGGG - Intergenic
1029781061 7:102733431-102733453 TTGAATCTACAGATCAATTTGGG + Intergenic
1029833776 7:103288324-103288346 TTGAATATATAGATCAAGTTGGG + Intergenic
1029916709 7:104217508-104217530 TTGAATCTACACATCAATTTGGG - Intergenic
1030155064 7:106446588-106446610 TTGTATCTATAAATCAATTTTGG + Intergenic
1030180159 7:106698858-106698880 TTGAATCTATAGATCAAGGTAGG + Intergenic
1030224608 7:107135794-107135816 TTGAATCTACAGATCAACTTGGG - Intronic
1030257173 7:107523076-107523098 TTGAATTCATAGATCAAGTTGGG + Intronic
1030542419 7:110847497-110847519 TTGAACCTACAGCTCAAGTTAGG - Intronic
1030790424 7:113720403-113720425 TTGAATCTACAGATCAAGTTTGG - Intergenic
1030826486 7:114165691-114165713 TTGAATATACATATCAACTTAGG - Intronic
1031091075 7:117355370-117355392 TTGAATTTGTAGATCAATTTGGG - Intergenic
1031184871 7:118463892-118463914 TTGAATTTATAGACCAAATTGGG + Intergenic
1031773403 7:125874884-125874906 TTGAATCTACAAATCAATTTTGG + Intergenic
1031879836 7:127185042-127185064 TTGAATTTATAGACCAAGTTGGG - Intronic
1031924405 7:127625055-127625077 TTGAGTCTATAGATCAAGTTGGG + Intergenic
1032769906 7:135041194-135041216 TTAAATCTACAGATCAACTTGGG - Intronic
1033060494 7:138101847-138101869 TTGAATCTACAGATGAATTTGGG - Intronic
1033864711 7:145674544-145674566 TTGAATTTATAGATAATGTTTGG - Intergenic
1034024969 7:147691492-147691514 TTGAATCTGTAGATCAAGTTAGG - Intronic
1034320421 7:150174922-150174944 TTGAATCTACTGATCAATTTGGG - Intergenic
1034354370 7:150440973-150440995 TTGAATGTATAGATCAATTTTGG + Intergenic
1034524242 7:151646252-151646274 TTTGATCTACAGATCAATTTGGG + Intronic
1035193787 7:157197474-157197496 TTATTTTTACAGATAAATTTTGG - Intronic
1035409407 7:158626977-158626999 CTAAATTTACAGATCAAGCTGGG - Intergenic
1036580383 8:10068852-10068874 CTGAATCTCCAGATCAAGTTGGG + Intronic
1037105366 8:15100524-15100546 TTGAATCTACAGATAAAGTTGGG - Intronic
1037369552 8:18160931-18160953 ATAAATTTATAGATCAAGTTGGG - Intergenic
1037865101 8:22437134-22437156 CTGTATTTAGATCTCAAGTTGGG + Intergenic
1037912418 8:22751673-22751695 TTGTATTTACAGAACATTTTGGG + Intronic
1037979829 8:23244704-23244726 CTGGATCTACAGATCAATTTGGG + Intronic
1038025737 8:23588231-23588253 TTGAATTTATAGATCAATCTGGG + Intergenic
1038109356 8:24478383-24478405 TTGTTTTAAAAGATTAAGTTAGG + Intronic
1038273009 8:26091785-26091807 TTGAATCTACAGATCAAGTTGGG - Intergenic
1038297851 8:26312670-26312692 TTGTATTTCAATTTCAAGTTTGG + Intronic
1038403266 8:27302207-27302229 TTGTCTCTATAGATCAATTTGGG + Intronic
1038752513 8:30309154-30309176 TTGAATCTATGGATCAAGTTGGG + Intergenic
1038873727 8:31524336-31524358 TTGTATCTATAGATAAATTTAGG + Intergenic
1039624428 8:39032995-39033017 TTGAATGTATAGATCAAGTTGGG + Intronic
1039666074 8:39529789-39529811 CTGAATCTACAGATCAATTTGGG - Intergenic
1039775689 8:40733935-40733957 TTGTTTTTACAGATCACTTCTGG - Intronic
1039788044 8:40850693-40850715 GTGCATTTACAGATCACGTGGGG + Intronic
1039924873 8:41920624-41920646 TTGAGTCTATAGATCAAGTTGGG - Intergenic
1040004030 8:42602970-42602992 TTAAATTTATAGATCAACTTAGG + Intergenic
1040450017 8:47536217-47536239 CTGAATCTACAAATCAAGTTGGG - Intronic
1040475438 8:47772791-47772813 TTTTCTTTACAGATGAAATTTGG + Intergenic
1040525516 8:48220540-48220562 TTGAATCTACAGGTCAATTTCGG - Intergenic
1040766127 8:50913429-50913451 TTCTATTATCACATCAAGTTAGG - Intergenic
1040997512 8:53417083-53417105 GTGTGTTTACACATCCAGTTAGG - Intergenic
1041093175 8:54323339-54323361 TTGAATCTATAGATTAAGTTGGG - Intergenic
1041230683 8:55748142-55748164 TTATATTGCAAGATCAAGTTGGG - Intronic
1041492299 8:58447648-58447670 TTATTTTTACAGATAAATTTTGG + Exonic
1041892306 8:62883127-62883149 TTGAATCTATAGATTAAGTTGGG + Intronic
1042231828 8:66564454-66564476 TTGTTTTTAAAGAACAAGATGGG - Exonic
1042366657 8:67944941-67944963 TTGAATCTATAGATCAAATTGGG - Intergenic
1042374198 8:68030254-68030276 TTGTTTTTAAAAATTAAGTTAGG - Intronic
1042474277 8:69228601-69228623 TTGAATCTATAGATCAATTTGGG - Intergenic
1042538486 8:69883441-69883463 TTGAATCTAAAGATCAATTTGGG - Intergenic
1042673808 8:71294662-71294684 TTGAATTTATAGATCAAATTGGG - Intronic
1042974351 8:74449396-74449418 TTGAATTTATAGATCAATTTGGG + Intronic
1043234759 8:77849348-77849370 TTGAATTTATAGATCAAGTTAGG + Intergenic
1043291317 8:78605137-78605159 TTGTAATTAAAGAACAATTTAGG - Exonic
1043541941 8:81273864-81273886 TTGAATCTACAGATCACTTTGGG + Intergenic
1043707436 8:83369697-83369719 GTAAATTGACAGATCAAGTTGGG - Intergenic
1043828898 8:84964092-84964114 TTGAATTTATAGATCAAATTAGG - Intergenic
1043853721 8:85242248-85242270 GTCTATTTACACATCTAGTTAGG + Intronic
1044294191 8:90508591-90508613 TGGTATTTCCAGATTACGTTAGG - Intergenic
1044312912 8:90715333-90715355 TTGAATCTACAGGTAAAGTTAGG + Intronic
1045218213 8:100170109-100170131 TTGAATTTATGGATCAATTTTGG + Intronic
1045400762 8:101815042-101815064 TTGAATCTATAGATCAAGTTAGG - Intronic
1046024112 8:108701828-108701850 TTGAATCTATAGATCAATTTGGG - Intronic
1046113611 8:109757647-109757669 TTGAATCTATAGATCAAATTGGG + Intergenic
1046388669 8:113538783-113538805 TTGAATCTACAGATCAAGTTAGG + Intergenic
1046484238 8:114864712-114864734 TTGAATCTATAGATCAAGTTGGG - Intergenic
1047128329 8:121988311-121988333 TTGAATCTATAGATCAAGCTGGG - Intergenic
1047449091 8:124946912-124946934 TTGTTTTTAAAAATCAAATTTGG - Intergenic
1047476206 8:125233743-125233765 TTGTAATCACAGATCTAGGTTGG + Intronic
1047867093 8:129037189-129037211 TTGAATCTACACATCAATTTGGG - Intergenic
1048226598 8:132593576-132593598 TTGTATTTATATATAAATTTAGG - Intronic
1048548609 8:135411602-135411624 ATGAATTTATAGAACAAGTTGGG + Intergenic
1049049036 8:140177662-140177684 TTGAATATAAAGATCAATTTGGG + Intronic
1049630870 8:143656057-143656079 TGGGATTTATAGATCAATTTAGG + Exonic
1049869212 8:144960150-144960172 TTGAATTTATAGATCACTTTTGG + Intergenic
1050002146 9:1088700-1088722 TTGAATGTACAGATTAATTTGGG + Intergenic
1050403152 9:5278514-5278536 GTCTGTTTACACATCAAGTTAGG - Intergenic
1050695233 9:8271992-8272014 TTGAGTCTACAGATCAAGTTGGG + Intergenic
1050784257 9:9379603-9379625 TTGAATCTACAGATGAAGTTGGG + Intronic
1050914961 9:11120403-11120425 TTGAATATATTGATCAAGTTGGG + Intergenic
1051257431 9:15228778-15228800 TTTTATTAACAGATTAATTTAGG - Intronic
1051279582 9:15428295-15428317 CTGTTTATACAGATCAACTTTGG + Intronic
1051317239 9:15853142-15853164 TTGAATTTATAGATCAATTTGGG + Intronic
1051567199 9:18514058-18514080 TTGTATCTATAGATCACATTGGG + Intronic
1051607749 9:18932603-18932625 TTGAATCTACAGATCAATTTGGG + Intronic
1051797910 9:20895382-20895404 TTGAATGTATAGATGAAGTTAGG + Intronic
1051807660 9:21013570-21013592 CTGAATCTACAGATCAATTTGGG + Intronic
1051898742 9:22015532-22015554 TGGAATTTATAGATCAATTTGGG + Intronic
1052405002 9:28048262-28048284 CTGTATTTATAGATTTAGTTGGG - Intronic
1052513359 9:29450127-29450149 TGGAATTTACAGAGAAAGTTCGG - Intergenic
1052615611 9:30836482-30836504 TTGACTCTATAGATCAAGTTGGG + Intergenic
1052751902 9:32500291-32500313 TTGAATATACAGATCAATGTAGG + Intronic
1053552453 9:39098310-39098332 TTTTATTTACAGATATATTTGGG - Intronic
1053783955 9:41637795-41637817 GTTTTTTTACAAATCAAGTTTGG - Intergenic
1053816574 9:41918474-41918496 TTTTATTTACAGATATATTTGGG - Intronic
1054106834 9:61062156-61062178 TTTTATTTACAGATACATTTGGG - Intergenic
1054171910 9:61847936-61847958 GTTTTTTTACAAATCAAGTTTGG - Intergenic
1054446771 9:65376948-65376970 TTTTTTTTACAAATCAAGTTTGG - Intergenic
1054614023 9:67268969-67268991 TTTTATTTACAGATACATTTGGG + Intergenic
1054665625 9:67732876-67732898 GTTTTTTTACAAATCAAGTTTGG + Intergenic
1054880690 9:70141855-70141877 TTGTTTGTACAGATCCATTTTGG + Intronic
1054900625 9:70365401-70365423 TTGAATTTCCATATCAATTTTGG - Intergenic
1055222186 9:73949589-73949611 TTTAATCTACAGATCAAGATGGG - Intergenic
1055378671 9:75682028-75682050 TTGAATTTATAGATCAAGTAGGG - Intergenic
1055521502 9:77085678-77085700 TTGTACTTAGAAAACAAGTTTGG - Intergenic
1055906432 9:81299868-81299890 TTGAATCTATATATCAAGTTTGG - Intergenic
1056034813 9:82593228-82593250 TTTTATTCACAGATCAAATTGGG + Intergenic
1056079640 9:83078309-83078331 TTATATTTACAAATCAAGGCAGG - Intergenic
1056924801 9:90825295-90825317 TTGAATCTACAGATCAAGCTTGG - Intronic
1057473400 9:95378610-95378632 TTGAATTTATAGATCAATTTGGG + Intergenic
1057823738 9:98355648-98355670 CTGAATGTATAGATCAAGTTGGG - Intronic
1058145400 9:101405562-101405584 GTGTATATACAGAACAAGTAAGG + Intronic
1058205034 9:102094231-102094253 TTGAATCTATAGGTCAAGTTGGG - Intergenic
1058501774 9:105626591-105626613 TTGGGTTTACACATAAAGTTTGG + Intronic
1059615051 9:115941044-115941066 TTGAATTTATAGTTCAATTTGGG + Intergenic
1059667170 9:116458833-116458855 TTGAATCTACAGATAAATTTGGG - Intronic
1059720657 9:116957087-116957109 TTGTATTTTCATATGAATTTTGG - Intronic
1059881738 9:118697899-118697921 TTGAATCTATAGATCAAATTTGG - Intergenic
1060162514 9:121378617-121378639 TTGGATCTATACATCAAGTTGGG - Intergenic
1060433647 9:123573351-123573373 TTGAATCTATAGATCAATTTAGG + Intronic
1061739055 9:132686113-132686135 TTGTTTTTACAGATGAGATTGGG + Intronic
1061815693 9:133193602-133193624 TTGCATCTATAGATCAATTTGGG - Intergenic
1061906006 9:133698514-133698536 TTGTATTTTAATAGCAAGTTTGG - Intronic
1062127920 9:134874771-134874793 TTGCATCTGCAGATCAATTTGGG + Intergenic
1062552159 9:137093862-137093884 ATGGATTTACAGATGAATTTAGG - Intronic
1203426351 Un_GL000195v1:43226-43248 TTGTATTTGCAAATCAAGCGAGG + Intergenic
1203439906 Un_GL000195v1:179841-179863 TTGTATTTGCAAATCAAGCAAGG - Intergenic
1185808830 X:3086053-3086075 TTGCATCTACAGAGCAAGTATGG - Intronic
1185939945 X:4306002-4306024 TGGAATTTATAGATCAATTTAGG + Intergenic
1186911054 X:14166219-14166241 TTGAATTTATAGATTAATTTTGG + Intergenic
1187335803 X:18380463-18380485 TTGAATCTATAGATCAAATTGGG + Intergenic
1187808758 X:23152054-23152076 TTGAATTTATAGATCAATTTGGG - Intergenic
1187813413 X:23205702-23205724 TTATGTTTATAGATAAAGTTGGG - Intergenic
1188235618 X:27727718-27727740 TTGAATTTACTAATCAATTTTGG + Intronic
1188266285 X:28079761-28079783 TTGAATTTATAGGTCAATTTGGG - Intergenic
1188385999 X:29559017-29559039 TTGTAGTTACATATGAATTTGGG + Intronic
1188574243 X:31627185-31627207 TTATTTTCACAGATCATGTTAGG + Intronic
1188576773 X:31661176-31661198 TTGTATTCACAGCGAAAGTTAGG + Intronic
1189424765 X:40888871-40888893 TTAAATCTATAGATCAAGTTGGG + Intergenic
1189548176 X:42065563-42065585 TTGAATCTATAGATTAAGTTAGG + Intergenic
1189555029 X:42134123-42134145 TTGAATTTATAGACCAATTTGGG + Intergenic
1189797726 X:44661826-44661848 TTGAATTTATAGATCAGCTTTGG + Intergenic
1190402456 X:50051582-50051604 TTGAATCTATAGATCAAGCTGGG + Intronic
1190450477 X:50575137-50575159 TTGAATTTATAGATCGATTTTGG + Intergenic
1190492437 X:50995531-50995553 TTGAATATACAGATCAATTTTGG - Intergenic
1190547119 X:51539608-51539630 TTGAATCTATAGATCAAGTTGGG + Intergenic
1190551778 X:51589871-51589893 CTGAATCTATAGATCAAGTTGGG - Intergenic
1190689924 X:52905132-52905154 TTCATTCTACAGATCAAGTTGGG + Intronic
1190696059 X:52950660-52950682 TTCATTCTACAGATCAAGTTGGG - Intronic
1190836749 X:54108355-54108377 TTGAATTTATAGATTAATTTGGG - Intronic
1191684520 X:63875976-63875998 TTGAATCTGTAGATCAAGTTGGG - Intergenic
1192187871 X:68965530-68965552 TTTAATCTACAGATCAAGTTGGG + Intergenic
1192303408 X:69930958-69930980 TTGAATCTATAGATCAATTTTGG - Intronic
1192375864 X:70561078-70561100 TTGAATCTATAGATCAATTTGGG + Intronic
1192391706 X:70735648-70735670 TTGAATCTGCAGATCAATTTGGG - Intronic
1192540465 X:71965675-71965697 TTGAATCCATAGATCAAGTTGGG + Intergenic
1192995998 X:76513998-76514020 TTGTGTTTACAATTCAAATTAGG - Intergenic
1193393007 X:80951215-80951237 TTGAATCTAAAGATCAATTTGGG + Intergenic
1193399274 X:81022451-81022473 TTGAATCTATAGATCAAGTTGGG - Intergenic
1193819561 X:86146050-86146072 TTTTATTTGCAGAGCAATTTGGG - Intergenic
1193838703 X:86380451-86380473 TTCTATTCAGAAATCAAGTTTGG + Intronic
1193929823 X:87539920-87539942 GTGTATTTACAAACCAAGATGGG + Intronic
1194060724 X:89193789-89193811 TTGAATCTACAGATTTAGTTGGG + Intergenic
1194234353 X:91363550-91363572 TTTAATCTACAGATCAATTTTGG + Intergenic
1194234801 X:91369623-91369645 TTGAATCTATAGATCAAGTTAGG + Intergenic
1194323828 X:92485049-92485071 TTGTATTTACATATAAAATGAGG + Intronic
1194384174 X:93233275-93233297 TTAAATTTATAGATCAATTTTGG - Intergenic
1194532363 X:95067371-95067393 TTGAATCTACAGATAAAATTTGG - Intergenic
1194542194 X:95188644-95188666 TTAAATTTAGAGATCAAATTGGG + Intergenic
1194769854 X:97888786-97888808 TTGAATCTACAGATTAATTTGGG + Intergenic
1195279189 X:103313526-103313548 CTGAATTTACAGATGAATTTGGG - Intergenic
1195407401 X:104530704-104530726 TTTTATTTCTAGATCAATTTGGG + Intergenic
1195587339 X:106579931-106579953 TTGAATCTGTAGATCAAGTTGGG - Intergenic
1196699473 X:118652368-118652390 ATGTATTTTCTGAGCAAGTTTGG - Intronic
1196740689 X:119023251-119023273 TTGGATTTACATATAAAGTAGGG - Intergenic
1196849951 X:119927867-119927889 TTGAATATAAAGATCAATTTGGG + Intronic
1196852664 X:119952759-119952781 TTCAATCTACAGGTCAAGTTGGG + Intergenic
1197005100 X:121486942-121486964 TTGTATTAACTGAGAAAGTTAGG - Intergenic
1197351167 X:125385003-125385025 GTCTGTTTACACATCAAGTTAGG - Intergenic
1197539440 X:127738579-127738601 TTGAATGTATAGATCAAGTTGGG - Intergenic
1197599042 X:128505531-128505553 TTAAATCTACAGATCAATTTGGG - Intergenic
1197730835 X:129808143-129808165 TTGAATCTATAGATCAATTTGGG - Intronic
1198551280 X:137748039-137748061 TTCTATTTACAGTCCAAATTGGG + Intergenic
1198556861 X:137803825-137803847 TTGTATTTATAGGTTAATTTTGG + Intergenic
1198842549 X:140874146-140874168 TTGAATCTATATATCAAGTTAGG - Intergenic
1199080228 X:143568574-143568596 ATCTGTTTACACATCAAGTTAGG - Intergenic
1199128488 X:144155885-144155907 TTGAATTTATAGATCAATTTGGG - Intergenic
1199211537 X:145217082-145217104 TTGTCTTTATAAATCAATTTGGG + Intergenic
1199291370 X:146108385-146108407 GTGAATTTACAGATTAATTTTGG - Intergenic
1199379607 X:147154412-147154434 TTGTATATACAGTTTAAATTAGG - Intergenic
1199444443 X:147905717-147905739 TTGAATCTATAGATCAAGTAGGG - Intergenic
1199584498 X:149399539-149399561 TTGAATCTACAGATCAATTTGGG + Intergenic
1199613786 X:149639516-149639538 TTAAATATATAGATCAAGTTAGG - Intergenic
1199898079 X:152144415-152144437 TTGTATGTACAGAACATATTGGG + Intergenic
1200631929 Y:5598140-5598162 TTGTATTTACATATAAAATGAGG + Intronic