ID: 1126618223

View in Genome Browser
Species Human (GRCh38)
Location 15:50608547-50608569
Sequence CTGTCTCCACTGATGAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 236}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126618223 Original CRISPR CTGTCTCCACTGATGAAAAT AGG (reversed) Intronic
902736214 1:18402965-18402987 CTGGCTTCACAAATGAAAATGGG + Intergenic
904987599 1:34564732-34564754 CTGTCTTCACATTTGAAAATTGG - Intergenic
907566730 1:55442470-55442492 CTGTTTTCACTGAAGGAAATAGG - Intergenic
908824756 1:68122746-68122768 CTCTTTCCACTGATTGAAATGGG + Intronic
909747460 1:79115608-79115630 CTGCCTCCAGTGAGGAGAATGGG + Intergenic
910151693 1:84155577-84155599 CTTTTTCCACTGTTAAAAATTGG + Intronic
910283909 1:85531818-85531840 CTGTTTCCCCAGTTGAAAATGGG - Intronic
911939417 1:104022491-104022513 CAGTTTCCATAGATGAAAATGGG - Intergenic
914206110 1:145531167-145531189 CTGTTTCCCCAGTTGAAAATGGG + Intergenic
916763056 1:167834208-167834230 CCAGCTCCACTGATTAAAATGGG + Intronic
917525608 1:175785604-175785626 CTGTCTCCAGTGATGAGAACTGG + Intergenic
918064007 1:181087535-181087557 GTGTCTCCACTGCTGAAAAGGGG - Intergenic
919995181 1:202741443-202741465 CTTTCTCCACTGCTGAATACGGG + Exonic
922548045 1:226473302-226473324 CTGTCTCCCCTGAGCAAAAATGG - Intergenic
1063465802 10:6243523-6243545 CTGCCTCCACTGATGGGACTAGG - Intergenic
1063794644 10:9499252-9499274 CTGTCTCCACTGAAAACAATGGG + Intergenic
1065018715 10:21484872-21484894 GTGTCTCCACTGAAGAACACTGG - Intergenic
1065374344 10:25022350-25022372 ATCTCTCCACTGATGATTATAGG + Intronic
1067517075 10:46959081-46959103 TTCTATCCACTAATGAAAATGGG + Intronic
1067645175 10:48092749-48092771 TTCTATCCACTAATGAAAATGGG - Intergenic
1068204667 10:53834727-53834749 CTGCCTCCATTGATGGATATGGG + Intronic
1068482563 10:57611885-57611907 CTGTCTGCATTGAGGAAAACTGG + Intergenic
1068482643 10:57612859-57612881 CTGTCTGCATTGAGGAAAACTGG - Intergenic
1069776557 10:70930582-70930604 CAGTCTCCTTTGCTGAAAATGGG - Intergenic
1070387323 10:75937583-75937605 GTGTCTTAACTGATGGAAATTGG - Intronic
1070419037 10:76218191-76218213 CTGTGTGCACTGAGGAAAAGAGG + Intronic
1071205514 10:83271673-83271695 GTCTCTCCAGTGATGAAACTTGG - Intergenic
1071465638 10:85937331-85937353 CTTTTTCCCCTGCTGAAAATGGG - Intronic
1074741713 10:116491507-116491529 CTGTTGCCAATGATGTAAATAGG - Intergenic
1075898266 10:126017246-126017268 CTGTCTTCACTGTTGAAAAAAGG + Exonic
1076174936 10:128361060-128361082 CTGTCTCCACTGGAGAAATGTGG + Intergenic
1077758865 11:5068198-5068220 TAGTCACCACTGATGAAATTAGG + Intergenic
1078550848 11:12279718-12279740 CTGTCTCCACACATGGAACTCGG + Intronic
1078700228 11:13673105-13673127 CTGTCTCCACTCTTCAAATTGGG - Intronic
1080020633 11:27555946-27555968 CTGTCTCTTGTGATGAAACTGGG + Intergenic
1081214670 11:40381491-40381513 CTGTCTCTGGTGTTGAAAATTGG + Intronic
1081288406 11:41301723-41301745 CTCTCTCCTCTGATGAAATTGGG - Intronic
1081965539 11:47166920-47166942 CTGCCTCCCCTGATGATAATGGG - Intronic
1082081679 11:48017067-48017089 CTGTTTCCACTTGTAAAAATGGG - Intronic
1082975117 11:59063294-59063316 CTGTCTGGAGTGATGATAATTGG + Intergenic
1082979546 11:59107031-59107053 CTGTCTGGAGTGATGATAATTGG + Intergenic
1084994142 11:72958888-72958910 CTGTTTCCATAGATGGAAATGGG - Intronic
1089654564 11:119937448-119937470 CTATTTCCACTTCTGAAAATGGG + Intergenic
1091514574 12:1165901-1165923 CTTTCTGAAGTGATGAAAATTGG - Intronic
1092572853 12:9744260-9744282 CTCTTTCCACTGAGGACAATTGG + Intergenic
1092865033 12:12752929-12752951 CTATCTCCACTCAAGAAAAATGG + Intronic
1093707391 12:22289319-22289341 CTGTTTCCTCAGATGAGAATTGG - Intronic
1094455772 12:30631215-30631237 CTGTCTCTACTGCTGAAAGGGGG + Intronic
1095895760 12:47278971-47278993 CCAGTTCCACTGATGAAAATGGG + Intergenic
1096165240 12:49417091-49417113 CTGTCCCTACTGAAGAAAAGAGG - Intronic
1097825260 12:64168971-64168993 ATGCCTCCAATGATGTAAATAGG + Intergenic
1103145913 12:118595799-118595821 ATATCTCCACCCATGAAAATGGG - Intergenic
1103413618 12:120729794-120729816 CTGTCACCACTGATAAAATGGGG + Intronic
1104176523 12:126338341-126338363 CTGTATCCACTGATGGTTATCGG + Intergenic
1104374866 12:128256196-128256218 CTATCTCAACTGATGAAAAAAGG - Intergenic
1106402442 13:29443323-29443345 CTGTGTCCCCTGATGCAATTGGG + Intronic
1106661893 13:31808527-31808549 CTATCCTCCCTGATGAAAATAGG + Intergenic
1107300276 13:38958721-38958743 CAGACTCCAGTTATGAAAATTGG + Intergenic
1108300823 13:49073957-49073979 CTGCCTTGACAGATGAAAATAGG - Intronic
1109183668 13:59244956-59244978 CTATCTGCACGGTTGAAAATAGG + Intergenic
1110803210 13:79724538-79724560 CTGTCTGGACTGCTGATAATAGG + Intergenic
1115342424 14:32306757-32306779 GAGTCACCATTGATGAAAATTGG - Intergenic
1117610034 14:57473686-57473708 CTGTCTACACTGTGGAGAATGGG - Intronic
1119792308 14:77363042-77363064 ATGTATCCATTGTTGAAAATGGG - Intronic
1120260094 14:82173038-82173060 CTCTGTCCATTGATGAAAGTGGG + Intergenic
1121398365 14:93648319-93648341 CTGGCTTCTCTGTTGAAAATAGG + Intronic
1121996630 14:98607971-98607993 GTTTCTCCACTGATTAAAAGGGG + Intergenic
1126618223 15:50608547-50608569 CTGTCTCCACTGATGAAAATAGG - Intronic
1127066511 15:55245217-55245239 CTGTCTCCACTTATGGAAATGGG - Intronic
1128496819 15:68203449-68203471 CCATCTCCACTGATCACAATAGG + Intronic
1128565213 15:68696633-68696655 CTACCTCCACTGGTGAAAGTTGG - Intronic
1128700522 15:69801014-69801036 CTGTGTCCAGTGATCAAGATTGG - Intergenic
1131766232 15:95678482-95678504 CTCTCCCCAATAATGAAAATGGG - Intergenic
1135970436 16:27068188-27068210 CTGTCGCCACTGATGAGTTTTGG - Intergenic
1137775893 16:51054057-51054079 CTGTCTGCACAGATAAAACTTGG + Intergenic
1139656499 16:68390297-68390319 AAGACTCCGCTGATGAAAATAGG - Intronic
1140113926 16:72025696-72025718 CTGTCTCCACGGTGGGAAATGGG - Intronic
1140624300 16:76772863-76772885 CTGACTCCCCTGATGAAAGTTGG + Intergenic
1142558545 17:795951-795973 CTCCCTGCACTGATGAAAACAGG - Intergenic
1143559502 17:7684489-7684511 CTGTCTCCACTTGTTGAAATAGG - Intronic
1143874788 17:9983484-9983506 CTGTCTCAAAAAATGAAAATAGG + Intronic
1146014253 17:29219781-29219803 TTGTATCCACGGATGAAAATAGG - Intergenic
1146678098 17:34787218-34787240 TTGTCTCCACTGATGAGGAAAGG + Intergenic
1147880090 17:43647791-43647813 CTGTTTCCTCTGCTGGAAATCGG - Intronic
1150579624 17:66460521-66460543 CTGTCTGCACTGCTGCAATTCGG - Intronic
1150644755 17:66971083-66971105 CTGTCTCCTCATCTGAAAATGGG + Intronic
1151255070 17:72870440-72870462 CTGGCTTCACTGCTGAAAACGGG + Intronic
1152662568 17:81549577-81549599 CTGTCTCCACTGCGGAAGAGAGG - Intronic
1153147688 18:2052374-2052396 CTATCTTCACTGAAGAAAAGGGG - Intergenic
1153386582 18:4504599-4504621 ATGTATTCACTGCTGAAAATGGG - Intergenic
1153532123 18:6057390-6057412 CTATCACCACTGGGGAAAATTGG + Intronic
1153896077 18:9561674-9561696 CTGTCTTCAATGATAAAAAGAGG + Intronic
1154089926 18:11348568-11348590 GTCTCTCCATTGTTGAAAATTGG - Intergenic
1155487125 18:26357171-26357193 CTGTCTCCATTAATAAAAAGAGG + Intronic
1155505001 18:26524726-26524748 CTGTCTCTAAAGAGGAAAATGGG + Intronic
1157560264 18:48640531-48640553 TTGTCCCCACGGGTGAAAATGGG - Intronic
1157797235 18:50586058-50586080 GTTTTTCCACTGATGATAATGGG - Intronic
1162584096 19:11548535-11548557 CTGTCTCTAAAAATGAAAATGGG + Intronic
1164131845 19:22370468-22370490 CTGTTTCCACTGATATAAAGTGG - Intergenic
1164167775 19:22697854-22697876 CTGTTTCCACTGATATAAAGTGG + Intergenic
1167632866 19:50636668-50636690 CAGTTTCCTCTGTTGAAAATGGG + Intronic
925242475 2:2344036-2344058 GTGTCCCCACTGAAGAAAAATGG - Intergenic
925677555 2:6380908-6380930 TTGTCTCCACTGATGAGACTAGG + Intergenic
926776779 2:16430962-16430984 CTGTATCCACTGCTGAAGTTAGG + Intergenic
927247549 2:20969685-20969707 CTGTCACTACTGAAGAAAAGGGG + Intergenic
927521379 2:23700719-23700741 CGGTCTCCACTGACACAAATGGG + Intronic
928878642 2:36071484-36071506 ATGTCTATACTGATGAAAACGGG + Intergenic
929335952 2:40745888-40745910 GTGTCACAACTGATGAAAAATGG + Intergenic
929420497 2:41785174-41785196 CCTTCTCCACTGGTCAAAATTGG + Intergenic
930406155 2:50958207-50958229 CTGTCTTCTCTGTTGAACATAGG - Intronic
931926914 2:67083811-67083833 CTGTCTCCATTGAAGAGAAATGG - Intergenic
931947685 2:67329248-67329270 CTGTTTTCACTACTGAAAATAGG - Intergenic
932013112 2:67998263-67998285 CTTTGTCAACTGAGGAAAATTGG - Intergenic
935614690 2:105065043-105065065 CTGTCTCCACTGATAGAATGAGG + Intronic
936074940 2:109395767-109395789 CTGTGTCTCCTGATGAGAATAGG + Intronic
937739783 2:125336567-125336589 ATCTCTCCAGTGCTGAAAATCGG - Intergenic
937784529 2:125879542-125879564 CTGTCTCTACTGAAGAAAGGAGG - Intergenic
942246234 2:174011925-174011947 CAGTTTCCACTGCTGTAAATTGG - Intergenic
942743415 2:179205112-179205134 CTTTCTCCACTGATTAAAAGAGG - Intronic
943573510 2:189602570-189602592 CTGTCTTCACTGCTGAAAAGAGG + Intergenic
946878106 2:224150496-224150518 CTGTCTCCATTGTTGCACATGGG - Intergenic
948094865 2:235325412-235325434 TTGTCTCCACTTATGGAAAAGGG + Intergenic
1169118451 20:3082096-3082118 CAGTCTCCTGGGATGAAAATGGG + Intergenic
1173137222 20:40449109-40449131 CTGTCCCCACTAGTGAAATTTGG - Intergenic
1173177456 20:40775146-40775168 CAGTCTCCACTTCTGAAAAATGG + Intergenic
1173833631 20:46110442-46110464 CTGTCTCCAATAAAAAAAATAGG + Intergenic
1173914771 20:46698793-46698815 CAGTCTCCAGAGATGAGAATAGG + Intergenic
1174237470 20:49105685-49105707 CAGTTTTCACTAATGAAAATTGG + Intergenic
1176104899 20:63381317-63381339 CTTTCTCCTCTGATGGAAGTCGG - Intergenic
1176587389 21:8601315-8601337 CTGTCTCCCATGCTGAAAATCGG - Intergenic
1177800359 21:25822853-25822875 CTGTTTTCATTGATGAAAACTGG + Intergenic
1178249795 21:30991590-30991612 ATGTCTACACTGCTGAAAGTGGG + Intergenic
1180270220 22:10578312-10578334 CTGTCTCCCATGCTGAAAATCGG - Intergenic
1180709053 22:17827409-17827431 CTTTCTCCATTGATGCAAAATGG - Intronic
1181421032 22:22799182-22799204 CTGTCTCCACTCATGATAGAAGG + Intronic
1182441115 22:30364857-30364879 CTGTCACCGCTGGTGACAATAGG + Intronic
1183811159 22:40258812-40258834 CTGTTTCAACTGAAGAAATTTGG - Intronic
1184142728 22:42587685-42587707 CTGGCTCCACAGATGGAGATGGG + Intronic
1185388824 22:50548286-50548308 CTGTCCCCACTGAAGAAGAGGGG - Exonic
949140030 3:620742-620764 CTGTCTGCCATGCTGAAAATCGG + Intergenic
953190622 3:40683963-40683985 CTATCTCCACAGATCAAAACTGG - Intergenic
954900551 3:54015466-54015488 ATGTCTCCAGTGAAGAAACTGGG + Intergenic
958829532 3:99070760-99070782 AGGTCATCACTGATGAAAATCGG - Intergenic
959759631 3:109944983-109945005 CTGTCTCCACATAAGAACATGGG - Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
961533749 3:127556692-127556714 CAGTCACCACTGATGAGAAGCGG + Intergenic
964111306 3:153090609-153090631 CCGTCTGCACTAATAAAAATTGG - Intergenic
964465441 3:156986569-156986591 CTGTCTACCCTGATGCAAAAAGG - Intronic
965015962 3:163156819-163156841 CTTTCTCCAGTTATAAAAATGGG - Intergenic
967515170 3:190360228-190360250 CTGTTTCCAGGGAGGAAAATAGG + Intronic
969153685 4:5191730-5191752 CTATCTCCACTCATCAAAGTTGG - Intronic
974878816 4:67729646-67729668 CGGTATAGACTGATGAAAATAGG + Intergenic
975844329 4:78508924-78508946 CTGCCCCCACTGATGGCAATGGG + Intronic
977377414 4:96223481-96223503 GTGTCTCCTGTGTTGAAAATAGG - Intergenic
978161898 4:105558618-105558640 ATGTCTCTACTGAAAAAAATAGG - Intronic
978928584 4:114282327-114282349 TTGTATCCACTGTTGAATATTGG + Intergenic
979179090 4:117702817-117702839 CTGTCCCCACTGCATAAAATAGG - Intergenic
979403332 4:120278351-120278373 ATGTCTCCACTGAAAAGAATTGG + Intergenic
979415705 4:120435647-120435669 TTGGCTCCACTGGTGAAAAGGGG + Intergenic
980712972 4:136594303-136594325 ATATATCCAGTGATGAAAATGGG - Intergenic
981317434 4:143353466-143353488 CTGACTCCACTTTAGAAAATTGG + Intronic
981491097 4:145340323-145340345 CTGTTTCCACATTTGAAAATGGG + Intergenic
981648894 4:147033055-147033077 CAGTCTCCACTGAAGTACATGGG + Intergenic
982220947 4:153124804-153124826 CTCTCTACACTAATGAAACTGGG + Intergenic
982570729 4:157048115-157048137 CTGTCTCAGCTGAAGAAAATTGG + Intergenic
983265269 4:165501445-165501467 CTGTCTCTAGGGAGGAAAATGGG - Intergenic
983552626 4:169032989-169033011 CTGTTTCCACAGGTGTAAATTGG - Intergenic
983617073 4:169719292-169719314 CTGTCTCTACTGAAAATAATTGG + Intronic
984315923 4:178131222-178131244 GTGTCCTCACTGATAAAAATGGG - Intergenic
984455556 4:179962787-179962809 CTGTCTCCATCCATGAAAAGTGG - Intergenic
985610160 5:883415-883437 CTGTTTCCACTGAAGACACTGGG + Intronic
986640939 5:9871480-9871502 CTGTGTCCAGGGATGACAATTGG - Intergenic
989603740 5:43224202-43224224 TTGTATTCAGTGATGAAAATAGG - Intronic
990221708 5:53598323-53598345 CTTCATCCACTGATGAACATTGG - Intronic
990736155 5:58865071-58865093 ATCTGTCCACTGTTGAAAATAGG - Intergenic
991949157 5:71931256-71931278 CTGTCTCCAAAGATGAATTTGGG + Intergenic
993287615 5:86019905-86019927 CTGTCACCACGAATAAAAATAGG + Intergenic
994682288 5:102903669-102903691 CTGTTTCCTCTTCTGAAAATTGG - Intronic
994807147 5:104463392-104463414 ATCTGTCCAATGATGAAAATGGG + Intergenic
995172361 5:109131421-109131443 CTGTCTCCACTGAAGATCACAGG - Intronic
996037621 5:118776092-118776114 CTCTCTCAACTGATTAAAATTGG - Intergenic
996649746 5:125860788-125860810 ATCTCTCAACTGATTAAAATTGG + Intergenic
997609823 5:135208044-135208066 CTCTCTGCAGTGATGACAATGGG + Intronic
998099370 5:139419368-139419390 CTGTCTCCAGAGAGGGAAATAGG + Intronic
999165628 5:149546946-149546968 CTGTTTCCACTGAAGCAAAAAGG - Intronic
999270040 5:150291539-150291561 CCCTCTCCACTGAGGAAAAAGGG + Intergenic
999599284 5:153243111-153243133 CTCTCTTAACTGATGAAAACAGG + Intergenic
1004332988 6:14738431-14738453 CTGTCTTCACTGGAGAACATAGG + Intergenic
1007259191 6:40550705-40550727 CTTTCTCCACTGGTGTATATTGG + Intronic
1008491218 6:52089117-52089139 CTGTCTCCTCATAAGAAAATTGG - Intergenic
1008691718 6:53986765-53986787 CTGTTTCCTCAGCTGAAAATGGG - Intronic
1008791752 6:55243402-55243424 CTGTGTCCTCTGATGAACTTTGG - Intronic
1009331511 6:62427196-62427218 CTGTCTCATCTGAAGAGAATAGG + Intergenic
1009958348 6:70485535-70485557 CTGTATCCACTTATTAAAACTGG - Intronic
1012080186 6:94748451-94748473 CTGTTTCCTCTGATGAATCTGGG - Intergenic
1012303294 6:97617523-97617545 CTGCCTCCATTGATTAAAAAAGG + Intergenic
1015056095 6:128904971-128904993 ATTTCTCCATTGATTAAAATTGG - Intronic
1015462850 6:133512746-133512768 ATGTTTCCTCTGATGATAATGGG + Exonic
1016281251 6:142421690-142421712 CTGTTTCCATTAATGAGAATTGG + Intronic
1016904810 6:149137991-149138013 CAATCCCCACTGATGAAATTAGG - Intergenic
1018217288 6:161541141-161541163 CTTTCTGCAGTGATGAAAATGGG + Intronic
1018961059 6:168448664-168448686 CTGTCTCCACTGAGGCAATGAGG + Intronic
1019304255 7:325372-325394 CAGTCTCCACATTTGAAAATGGG + Intergenic
1019464717 7:1181375-1181397 CTGTCTCCACTGAAAAGAAAGGG - Intergenic
1019543997 7:1564304-1564326 CTGTCTCCACCTATAAAAACCGG - Intergenic
1020390638 7:7654299-7654321 CTGTATTCAGTGATGGAAATAGG + Intronic
1020463951 7:8455401-8455423 ATGGCACCACAGATGAAAATAGG - Intronic
1020987191 7:15150729-15150751 CTGTTTTCCCTGATGAACATAGG - Intergenic
1022171500 7:27836341-27836363 CTGTCCCCTCTGATGGAATTAGG + Intronic
1022448224 7:30487808-30487830 ATGTTACCACTGAGGAAAATTGG - Intergenic
1023239473 7:38128415-38128437 CTGTCTTCACTAATGTAACTGGG - Intergenic
1023286755 7:38629370-38629392 CTTTCCCCAGTGAAGAAAATAGG + Intronic
1023649600 7:42355123-42355145 CTGTCTGCAGTGATCACAATTGG + Intergenic
1024185486 7:46944346-46944368 CTGTTTCCACTGCTGTAAAATGG + Intergenic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1027265651 7:76493938-76493960 CAGTTTCCTCTAATGAAAATGGG - Intronic
1027317021 7:76992055-76992077 CAGTTTCCTCTAATGAAAATGGG - Intergenic
1028647959 7:93119579-93119601 CTGTCTCCACTGAGTGACATAGG - Intergenic
1030529565 7:110696023-110696045 CTGTTTCCACTTTTGAAAAGTGG - Intronic
1030695258 7:112578090-112578112 CTGTATCCACTGATGGTGATAGG - Intergenic
1030849752 7:114468820-114468842 CTGTGTTAACTGATGAGAATTGG - Intronic
1031418498 7:121521390-121521412 CTGGTTCCACTCATGAAATTTGG + Intergenic
1031762778 7:125735268-125735290 CTGTCTCCTCTTATGGAAAGTGG - Intergenic
1031920200 7:127594826-127594848 CTGGCTCCAGGGATGAAGATGGG - Intronic
1032506399 7:132437880-132437902 CTGTCTCCACTGAGAAAGAGAGG + Intronic
1032972416 7:137180287-137180309 CTGTCACAACTGATGTACATTGG - Intergenic
1033276405 7:139974888-139974910 CTTTCCCCACTGATGAAATGGGG - Intronic
1033563125 7:142553115-142553137 CTTTCTCCACTGATGCCAGTGGG + Intergenic
1033668930 7:143471305-143471327 AACTATCCACTGATGAAAATAGG + Intergenic
1033709316 7:143924427-143924449 ATGTTACCATTGATGAAAATTGG + Intergenic
1033782995 7:144694700-144694722 TTGTCCCTAGTGATGAAAATTGG - Intronic
1034433419 7:151051971-151051993 CTGTCTCCACAGGTGACATTGGG + Exonic
1041765134 8:61411396-61411418 CTGTCTCCACTGCTCAGAAAGGG - Intronic
1043182041 8:77097156-77097178 CTTTCTACACTGATGATATTTGG - Intergenic
1043378210 8:79673644-79673666 CTGTTTCCTCAGATGTAAATTGG + Intergenic
1045338253 8:101228237-101228259 CTTTGTCCACGGATGAAATTTGG - Intergenic
1045420242 8:102007414-102007436 ATGTATCAACTGATGAAATTCGG - Intronic
1047712915 8:127569788-127569810 GTGTCTCCTCTGATCAAAATTGG - Intergenic
1047944932 8:129866737-129866759 CTCTGTCCAGTTATGAAAATGGG - Intronic
1050231443 9:3529676-3529698 CTCTCTCAATTGAAGAAAATAGG - Intergenic
1050346227 9:4690935-4690957 CACTCTCCACTGATGGAACTTGG - Intronic
1052366523 9:27617931-27617953 ATGTCTCCAGTGAAGGAAATGGG - Intergenic
1053299620 9:36939727-36939749 CTATCAACACTGATCAAAATGGG + Intronic
1055773756 9:79745570-79745592 CTGTCTCCACGGATGAGTTTGGG - Intergenic
1057069216 9:92081703-92081725 CTGTTTCCTCTGGTTAAAATAGG - Intronic
1058004326 9:99899333-99899355 ATGTGTCCAATGCTGAAAATAGG - Intergenic
1058768070 9:108201665-108201687 ATCTCTCCAATGCTGAAAATGGG - Intergenic
1060842477 9:126804828-126804850 CTGACTACGCTGTTGAAAATAGG - Intergenic
1203617348 Un_KI270749v1:79497-79519 CTGTCTCCCATGCTGAAAATCGG - Intergenic
1185523244 X:757467-757489 CTGTCTGCACTGATAAAATATGG - Intergenic
1187046660 X:15654043-15654065 CTGGCGCCATTGATGAAAAATGG - Intronic
1188644330 X:32546004-32546026 GTGTCTCCAGTGATGAATATGGG - Intronic
1189540079 X:41977975-41977997 CTTTCTTCACTGAAGGAAATAGG - Intergenic
1189927045 X:45966783-45966805 CTCTCTCCATTGTTGAAAGTGGG + Intergenic
1190023213 X:46897965-46897987 CTATCTCCACTGGACAAAATAGG + Intronic
1193764942 X:85516188-85516210 TTGTCAACACTGATGATAATTGG - Intergenic
1195427499 X:104751101-104751123 TTCTGACCACTGATGAAAATGGG + Intronic
1196639556 X:118042272-118042294 ATGTGTCCAATGCTGAAAATGGG - Intronic
1197256161 X:124265516-124265538 CTGATACCACTGATGAAAATGGG - Intronic