ID: 1126618442

View in Genome Browser
Species Human (GRCh38)
Location 15:50611739-50611761
Sequence GGGATCCTATGGTTACTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 54}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126618442 Original CRISPR GGGATCCTATGGTTACTTAG TGG (reversed) Intronic