ID: 1126634216

View in Genome Browser
Species Human (GRCh38)
Location 15:50765730-50765752
Sequence GATGCGGAAACCCCCGCGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126634204_1126634216 19 Left 1126634204 15:50765688-50765710 CCGCCACAGCAGCGCGACTTCCT 0: 1
1: 0
2: 0
3: 10
4: 93
Right 1126634216 15:50765730-50765752 GATGCGGAAACCCCCGCGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 106
1126634205_1126634216 16 Left 1126634205 15:50765691-50765713 CCACAGCAGCGCGACTTCCTCTT 0: 1
1: 0
2: 0
3: 10
4: 136
Right 1126634216 15:50765730-50765752 GATGCGGAAACCCCCGCGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 106
1126634208_1126634216 -7 Left 1126634208 15:50765714-50765736 CCGGCCCCGCCCGTAAGATGCGG 0: 1
1: 0
2: 1
3: 3
4: 46
Right 1126634216 15:50765730-50765752 GATGCGGAAACCCCCGCGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 106
1126634207_1126634216 -1 Left 1126634207 15:50765708-50765730 CCTCTTCCGGCCCCGCCCGTAAG 0: 1
1: 0
2: 0
3: 12
4: 82
Right 1126634216 15:50765730-50765752 GATGCGGAAACCCCCGCGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126634216 Original CRISPR GATGCGGAAACCCCCGCGCC GGG Exonic
900300449 1:1974244-1974266 AATGCCGAAACCCCCACCCCAGG - Intronic
902294032 1:15454015-15454037 CATGCGTAAGCCCCCGTGCCTGG - Intergenic
902897046 1:19485896-19485918 GATGCGGAAGGCACCGCGGCTGG + Intergenic
903746771 1:25592343-25592365 CAGGCGGGAACCACCGCGCCTGG + Intergenic
903866217 1:26400226-26400248 CAGGCGTAAACCACCGCGCCCGG + Intergenic
913028802 1:114875534-114875556 GAGGCGTGAGCCCCCGCGCCCGG + Intronic
913069095 1:115283779-115283801 GCTGCGGAAACCACCGGGCGCGG + Intergenic
914856862 1:151358606-151358628 GAGGCGTGAACCACCGCGCCTGG + Intergenic
915530583 1:156500358-156500380 GATGGGGCAGCCCCCGGGCCGGG - Intronic
1065526022 10:26622253-26622275 GAAGCGGAAACCCTCGCCTCTGG + Intergenic
1065731511 10:28713548-28713570 CATGCGTAAGCCACCGCGCCTGG - Intergenic
1074745047 10:116524058-116524080 CAGGCGGGAGCCCCCGCGCCCGG - Intergenic
1076786758 10:132753659-132753681 GCTGCGGAAACTCCCAAGCCCGG - Intronic
1078812081 11:14778026-14778048 GGTGTGGAACCCCCCGAGCCAGG - Intronic
1083171237 11:60924967-60924989 GACGGGGAAGCCCCTGCGCCGGG - Intronic
1096406457 12:51347429-51347451 CAGGCGTAAACCACCGCGCCCGG - Intergenic
1096843175 12:54391254-54391276 GACGCGGAACCCCGGGCGCCTGG - Exonic
1102439236 12:112948809-112948831 GATGCAGAAACCACTGCGCCTGG + Intronic
1108939826 13:55939031-55939053 CAGGCGTAAACCACCGCGCCCGG - Intergenic
1115137533 14:30128793-30128815 CAGGCGCAAACCACCGCGCCCGG + Intronic
1115593531 14:34887013-34887035 CAGGCGTAAACCACCGCGCCCGG - Intergenic
1118770993 14:68942667-68942689 GATCCGGAAGCCCTCGTGCCCGG + Intronic
1119494132 14:75064018-75064040 GGCGCGCAAACCTCCGCGCCCGG + Exonic
1122347776 14:101071170-101071192 GATGTGGCCACCCCCGCCCCAGG - Intergenic
1124631942 15:31343027-31343049 GATGCGGAAACTCCATGGCCAGG - Intronic
1125255677 15:37760161-37760183 CAGGCGTAAGCCCCCGCGCCTGG - Intergenic
1126634216 15:50765730-50765752 GATGCGGAAACCCCCGCGCCGGG + Exonic
1126777432 15:52112146-52112168 GGTGAGGAACCCACCGCGCCAGG - Intronic
1128297379 15:66535396-66535418 CAGGCGTAAACCACCGCGCCCGG - Intronic
1128622856 15:69166640-69166662 GAGGCGTAAGCCACCGCGCCTGG - Intronic
1129361022 15:75024215-75024237 GATGTGGAAACCCCTGCTCCAGG - Intronic
1131757553 15:95581814-95581836 TATGCGGGAGCCACCGCGCCCGG + Intergenic
1132186516 15:99806326-99806348 CAGGCGGGAGCCCCCGCGCCCGG + Intergenic
1132186551 15:99806460-99806482 CAGGCGGGAGCCCCCGCGCCCGG + Intergenic
1132429135 15:101746251-101746273 CAGGCGGGAGCCCCCGCGCCCGG - Intergenic
1132804889 16:1770892-1770914 GATGCAGAAATCCCCGCGGATGG + Exonic
1133016379 16:2943656-2943678 CAGGCGTGAACCCCCGCGCCTGG - Intronic
1135675053 16:24408088-24408110 CAGGCGTAAACCACCGCGCCTGG + Intergenic
1136009919 16:27356787-27356809 GTTGCTGAAACCCCTGAGCCTGG + Intronic
1136470037 16:30473842-30473864 GATGGGGATGCCCCCGAGCCGGG - Intronic
1136630917 16:31488809-31488831 GGTGCGCAAGCCCCCGCCCCGGG - Intronic
1139826675 16:69762527-69762549 GAGGCCGGAACCGCCGCGCCAGG - Intronic
1141116709 16:81315379-81315401 GACGCGGGGACCCCGGCGCCGGG - Intronic
1142121433 16:88388448-88388470 AATGCGGAAAACCCCGCTCAGGG - Intergenic
1144461775 17:15464236-15464258 GATGTGGAGACCCCTACGCCAGG + Intronic
1147421490 17:40324124-40324146 GGTGGGGAAAGCCCCGTGCCAGG + Intronic
1152542067 17:80981511-80981533 GCAGCGGCGACCCCCGCGCCAGG - Intergenic
1155214807 18:23633844-23633866 GAGGCGTGAACCACCGCGCCCGG + Intronic
1157649546 18:49313819-49313841 GATGAGGAAACCCCTGACCCAGG + Intronic
1159162105 18:64655575-64655597 GAGGCGTGAACCACCGCGCCCGG + Intergenic
1160659345 19:291081-291103 GACGCGGGGACCCCCGAGCCTGG + Exonic
1160798276 19:955553-955575 GATGGGGAAACCGAGGCGCCAGG - Intronic
1161480720 19:4509030-4509052 CAGGCGGGAACCGCCGCGCCCGG - Intronic
1161575088 19:5050621-5050643 CAGGCGCAAACCACCGCGCCTGG - Intronic
1162312589 19:9915793-9915815 GAGGCGTGAACCACCGCGCCTGG + Intronic
1163508422 19:17721397-17721419 GAGGCGTAAGCCACCGCGCCCGG - Intronic
1166218486 19:41351546-41351568 GCTGGGGAAACCCCAGCGTCCGG - Intronic
1167242383 19:48351968-48351990 CAGGCGTAAACCACCGCGCCCGG - Intronic
1167354228 19:48993395-48993417 CACGCGGAAATCCCCGCCCCCGG - Intergenic
1167412552 19:49353597-49353619 AAAGCGGAAACCCCAGCGTCAGG + Intronic
926116311 2:10215630-10215652 GATGAGGAAACCGCAGCTCCAGG - Intergenic
929508488 2:42547606-42547628 CAGGCGTCAACCCCCGCGCCTGG + Intronic
930198788 2:48533104-48533126 CAAGCGGAAGCCACCGCGCCCGG - Intronic
934544979 2:95207273-95207295 GATGCGAAAAGTCCCACGCCGGG + Intergenic
938697031 2:133843770-133843792 GCTCCGGAAAGCCCCGCGTCAGG + Intergenic
939722837 2:145676767-145676789 CAGGCGTAAACCACCGCGCCCGG - Intergenic
1176595048 21:8685749-8685771 GAAGCGTTAACCACCGCGCCTGG - Intergenic
1178143241 21:29707757-29707779 CAGGCGTAAACCACCGCGCCTGG + Intronic
1181602305 22:23959852-23959874 CAGGCGTAAACCACCGCGCCCGG + Intronic
1181606207 22:23981456-23981478 CAGGCGTAAACCACCGCGCCCGG - Intronic
1183717151 22:39540196-39540218 GCTGAGGAAACCCCAGGGCCTGG - Intergenic
1183956242 22:41382170-41382192 GATGGAGAACCCCCCGCGCGAGG + Exonic
1184423257 22:44394149-44394171 GATGGAGAAACACCCACGCCTGG + Intergenic
1185390029 22:50554843-50554865 CAGGCGTAAACCACCGCGCCTGG - Intronic
1185398387 22:50603930-50603952 CCTGCGGAACCCCCTGCGCCAGG + Exonic
950111392 3:10420992-10421014 GATGCTGAAGCCGCCGCTCCAGG - Intronic
951609732 3:24479019-24479041 CAGGCGTTAACCCCCGCGCCCGG - Intronic
953906532 3:46871236-46871258 GATGCGGACACTACCGTGCCAGG - Intronic
954919231 3:54175337-54175359 CAGGCGTAAACCACCGCGCCCGG - Intronic
958785560 3:98593424-98593446 GCTGCGGAGGGCCCCGCGCCTGG - Exonic
961694887 3:128697870-128697892 CAGGCGTAAACCACCGCGCCCGG + Intergenic
969032535 4:4226426-4226448 GAGGCGGAGACCCGCTCGCCCGG + Intronic
970193744 4:13537347-13537369 GCTGCGGAAACCACCGCGATGGG - Intergenic
971178486 4:24304939-24304961 TATGTGGCAAACCCCGCGCCAGG + Intergenic
974246476 4:59325999-59326021 CAGGCGTAAACCACCGCGCCCGG + Intergenic
975710780 4:77157944-77157966 GAGGCGGATACCCCCGTCCCAGG - Intronic
986152339 5:5139756-5139778 GGTGCGGAAAACCGGGCGCCAGG - Intergenic
986815937 5:11411147-11411169 CAGGCGTAAACCACCGCGCCCGG + Intronic
988301180 5:29429442-29429464 CAGGCGGAAGCCGCCGCGCCCGG - Intergenic
988513306 5:31883933-31883955 CATGCGGGAGCCACCGCGCCCGG - Intronic
999539552 5:152556679-152556701 GATGTGGAATCCCCAGCTCCTGG - Intergenic
1004336845 6:14771750-14771772 CATGCGTGAACCACCGCGCCCGG - Intergenic
1004709340 6:18155299-18155321 GCTGCGCAAACCCCGGCGCTTGG - Intergenic
1005651878 6:27892461-27892483 GACGCATAAACCACCGCGCCCGG + Intronic
1006373282 6:33658334-33658356 GATGGGGAAACCAAGGCGCCAGG - Intronic
1007343439 6:41208849-41208871 GATGCAGAAACCCCCACCCCAGG + Intergenic
1007346873 6:41237337-41237359 GATGCAGAAACCCCCACCCCAGG - Exonic
1015244778 6:131063341-131063363 GGCGCGGAAACCCCCGCGGGCGG + Intergenic
1021454519 7:20815176-20815198 GAGGCGTGAGCCCCCGCGCCCGG - Intergenic
1023080752 7:36523998-36524020 GATGCAGAAAGGCCCGGGCCAGG + Intronic
1034158456 7:148974724-148974746 CAGGCGTGAACCCCCGCGCCCGG - Intergenic
1034520667 7:151616980-151617002 GAGGCGTGAGCCCCCGCGCCCGG - Intronic
1037846708 8:22289426-22289448 GAGGCGTAAGCCACCGCGCCCGG + Intronic
1038309636 8:26436384-26436406 GATGCTGAAACCCCAGTGCCTGG - Intronic
1039042553 8:33422263-33422285 CAGGCGGGAACCACCGCGCCAGG - Intronic
1046120768 8:109843192-109843214 CAGGCGTAAACCACCGCGCCTGG + Intergenic
1047246377 8:123148738-123148760 GAGGCGTAAACCACTGCGCCTGG - Intronic
1049530164 8:143150324-143150346 CATGCGTGAACCACCGCGCCTGG - Intergenic
1057439635 9:95073505-95073527 CAGGCGGGAGCCCCCGCGCCCGG - Intronic
1057622086 9:96645184-96645206 CAGGCGTAAACCACCGCGCCCGG + Intronic
1059380060 9:113916314-113916336 GATGCGGAATCCACCGGTCCAGG - Intronic
1200109128 X:153730313-153730335 CAGGCGGGAGCCCCCGCGCCCGG - Intronic