ID: 1126636089

View in Genome Browser
Species Human (GRCh38)
Location 15:50781148-50781170
Sequence AATAGGACATTCTGCAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126636089_1126636094 12 Left 1126636089 15:50781148-50781170 CCATCACTGCAGAATGTCCTATT No data
Right 1126636094 15:50781183-50781205 TCTAGAGAGCAAACCTTGCTGGG No data
1126636089_1126636098 26 Left 1126636089 15:50781148-50781170 CCATCACTGCAGAATGTCCTATT No data
Right 1126636098 15:50781197-50781219 CTTGCTGGGGTGGACTATAGTGG No data
1126636089_1126636093 11 Left 1126636089 15:50781148-50781170 CCATCACTGCAGAATGTCCTATT No data
Right 1126636093 15:50781182-50781204 CTCTAGAGAGCAAACCTTGCTGG No data
1126636089_1126636095 13 Left 1126636089 15:50781148-50781170 CCATCACTGCAGAATGTCCTATT No data
Right 1126636095 15:50781184-50781206 CTAGAGAGCAAACCTTGCTGGGG No data
1126636089_1126636096 16 Left 1126636089 15:50781148-50781170 CCATCACTGCAGAATGTCCTATT No data
Right 1126636096 15:50781187-50781209 GAGAGCAAACCTTGCTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126636089 Original CRISPR AATAGGACATTCTGCAGTGA TGG (reversed) Intergenic
No off target data available for this crispr