ID: 1126640861

View in Genome Browser
Species Human (GRCh38)
Location 15:50825368-50825390
Sequence ATGCTCTCCTTAAAGACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126640861_1126640862 19 Left 1126640861 15:50825368-50825390 CCTTCAGTCTTTAAGGAGAGCAT No data
Right 1126640862 15:50825410-50825432 TTTCCTTTTCCTTAACCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126640861 Original CRISPR ATGCTCTCCTTAAAGACTGA AGG (reversed) Intergenic
No off target data available for this crispr