ID: 1126643836

View in Genome Browser
Species Human (GRCh38)
Location 15:50855108-50855130
Sequence CTTTATGCAAAATTGAATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126643836_1126643839 21 Left 1126643836 15:50855108-50855130 CCTACATTCAATTTTGCATAAAG No data
Right 1126643839 15:50855152-50855174 AAGCAGAAGTGAAATCAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126643836 Original CRISPR CTTTATGCAAAATTGAATGT AGG (reversed) Intergenic
No off target data available for this crispr