ID: 1126644868

View in Genome Browser
Species Human (GRCh38)
Location 15:50865437-50865459
Sequence ATGAAGAAACAGCCTCATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126644866_1126644868 23 Left 1126644866 15:50865391-50865413 CCTATAATTCTTGGAAGTAAGAA No data
Right 1126644868 15:50865437-50865459 ATGAAGAAACAGCCTCATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126644868 Original CRISPR ATGAAGAAACAGCCTCATAA AGG Intergenic
No off target data available for this crispr