ID: 1126645263

View in Genome Browser
Species Human (GRCh38)
Location 15:50869304-50869326
Sequence CAAATGGCATCAGTATACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126645263_1126645267 15 Left 1126645263 15:50869304-50869326 CCATTGTATACTGATGCCATTTG No data
Right 1126645267 15:50869342-50869364 TGGAGTCAATGCAGAACTGCTGG No data
1126645263_1126645266 -5 Left 1126645263 15:50869304-50869326 CCATTGTATACTGATGCCATTTG No data
Right 1126645266 15:50869322-50869344 ATTTGTACAATTTGGATAAATGG No data
1126645263_1126645268 16 Left 1126645263 15:50869304-50869326 CCATTGTATACTGATGCCATTTG No data
Right 1126645268 15:50869343-50869365 GGAGTCAATGCAGAACTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126645263 Original CRISPR CAAATGGCATCAGTATACAA TGG (reversed) Intergenic
No off target data available for this crispr