ID: 1126645265

View in Genome Browser
Species Human (GRCh38)
Location 15:50869320-50869342
Sequence ATTTATCCAAATTGTACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126645265_1126645267 -1 Left 1126645265 15:50869320-50869342 CCATTTGTACAATTTGGATAAAT No data
Right 1126645267 15:50869342-50869364 TGGAGTCAATGCAGAACTGCTGG No data
1126645265_1126645269 20 Left 1126645265 15:50869320-50869342 CCATTTGTACAATTTGGATAAAT No data
Right 1126645269 15:50869363-50869385 GGGTATCCCAAACAATTGTTAGG No data
1126645265_1126645273 30 Left 1126645265 15:50869320-50869342 CCATTTGTACAATTTGGATAAAT No data
Right 1126645273 15:50869373-50869395 AACAATTGTTAGGTTAGTGGAGG No data
1126645265_1126645272 27 Left 1126645265 15:50869320-50869342 CCATTTGTACAATTTGGATAAAT No data
Right 1126645272 15:50869370-50869392 CCAAACAATTGTTAGGTTAGTGG No data
1126645265_1126645268 0 Left 1126645265 15:50869320-50869342 CCATTTGTACAATTTGGATAAAT No data
Right 1126645268 15:50869343-50869365 GGAGTCAATGCAGAACTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126645265 Original CRISPR ATTTATCCAAATTGTACAAA TGG (reversed) Intergenic
No off target data available for this crispr