ID: 1126657754

View in Genome Browser
Species Human (GRCh38)
Location 15:50998328-50998350
Sequence TGTGCTTTAGAATCACCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 779
Summary {0: 1, 1: 2, 2: 21, 3: 152, 4: 603}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126657751_1126657754 3 Left 1126657751 15:50998302-50998324 CCAGAGCAAAAATTCCTGATACT 0: 1
1: 0
2: 3
3: 9
4: 160
Right 1126657754 15:50998328-50998350 TGTGCTTTAGAATCACCTGTGGG 0: 1
1: 2
2: 21
3: 152
4: 603
1126657750_1126657754 10 Left 1126657750 15:50998295-50998317 CCACTGACCAGAGCAAAAATTCC 0: 1
1: 0
2: 0
3: 15
4: 159
Right 1126657754 15:50998328-50998350 TGTGCTTTAGAATCACCTGTGGG 0: 1
1: 2
2: 21
3: 152
4: 603

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126657754 Original CRISPR TGTGCTTTAGAATCACCTGT GGG Intronic