ID: 1126660829

View in Genome Browser
Species Human (GRCh38)
Location 15:51031470-51031492
Sequence AGAGGGACTGCAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126660829_1126660841 27 Left 1126660829 15:51031470-51031492 CCCACAATCACTGCAGTCCCTCT No data
Right 1126660841 15:51031520-51031542 TGCCACGTGGCCAGTGCTGGGGG No data
1126660829_1126660836 14 Left 1126660829 15:51031470-51031492 CCCACAATCACTGCAGTCCCTCT No data
Right 1126660836 15:51031507-51031529 TATTCTCTCTCCATGCCACGTGG No data
1126660829_1126660838 24 Left 1126660829 15:51031470-51031492 CCCACAATCACTGCAGTCCCTCT No data
Right 1126660838 15:51031517-51031539 CCATGCCACGTGGCCAGTGCTGG No data
1126660829_1126660840 26 Left 1126660829 15:51031470-51031492 CCCACAATCACTGCAGTCCCTCT No data
Right 1126660840 15:51031519-51031541 ATGCCACGTGGCCAGTGCTGGGG No data
1126660829_1126660842 28 Left 1126660829 15:51031470-51031492 CCCACAATCACTGCAGTCCCTCT No data
Right 1126660842 15:51031521-51031543 GCCACGTGGCCAGTGCTGGGGGG No data
1126660829_1126660839 25 Left 1126660829 15:51031470-51031492 CCCACAATCACTGCAGTCCCTCT No data
Right 1126660839 15:51031518-51031540 CATGCCACGTGGCCAGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126660829 Original CRISPR AGAGGGACTGCAGTGATTGT GGG (reversed) Intergenic
No off target data available for this crispr