ID: 1126662721

View in Genome Browser
Species Human (GRCh38)
Location 15:51048374-51048396
Sequence GGTCTTACTCAACCCCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126662718_1126662721 -4 Left 1126662718 15:51048355-51048377 CCAGCCCTCACTTTTGCAGGGTC No data
Right 1126662721 15:51048374-51048396 GGTCTTACTCAACCCCTGACAGG No data
1126662720_1126662721 -9 Left 1126662720 15:51048360-51048382 CCTCACTTTTGCAGGGTCTTACT No data
Right 1126662721 15:51048374-51048396 GGTCTTACTCAACCCCTGACAGG No data
1126662719_1126662721 -8 Left 1126662719 15:51048359-51048381 CCCTCACTTTTGCAGGGTCTTAC No data
Right 1126662721 15:51048374-51048396 GGTCTTACTCAACCCCTGACAGG No data
1126662713_1126662721 28 Left 1126662713 15:51048323-51048345 CCTGTTGTCAGATTAGAGGCATG No data
Right 1126662721 15:51048374-51048396 GGTCTTACTCAACCCCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126662721 Original CRISPR GGTCTTACTCAACCCCTGAC AGG Intergenic