ID: 1126662753

View in Genome Browser
Species Human (GRCh38)
Location 15:51048555-51048577
Sequence CTCTTTGAAAAAAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126662753_1126662758 -10 Left 1126662753 15:51048555-51048577 CCTTCTTCCCTTTTTTCAAAGAG No data
Right 1126662758 15:51048568-51048590 TTTCAAAGAGAGCTTGGTAAGGG No data
1126662753_1126662761 7 Left 1126662753 15:51048555-51048577 CCTTCTTCCCTTTTTTCAAAGAG No data
Right 1126662761 15:51048585-51048607 TAAGGGAAAGCTAAAGGGATTGG No data
1126662753_1126662760 2 Left 1126662753 15:51048555-51048577 CCTTCTTCCCTTTTTTCAAAGAG No data
Right 1126662760 15:51048580-51048602 CTTGGTAAGGGAAAGCTAAAGGG No data
1126662753_1126662759 1 Left 1126662753 15:51048555-51048577 CCTTCTTCCCTTTTTTCAAAGAG No data
Right 1126662759 15:51048579-51048601 GCTTGGTAAGGGAAAGCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126662753 Original CRISPR CTCTTTGAAAAAAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr