ID: 1126664656

View in Genome Browser
Species Human (GRCh38)
Location 15:51065572-51065594
Sequence TGATGGTTATAAAACATGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126664656 Original CRISPR TGATGGTTATAAAACATGAC AGG Intronic
900970417 1:5989622-5989644 TGAATGTTATAAAACATCAGTGG - Intronic
902147827 1:14418550-14418572 TGATGGTGATAAATTCTGACTGG - Intergenic
902353303 1:15875631-15875653 GGATAGTTATAAAAAATTACTGG - Intronic
902456918 1:16540122-16540144 AGATTTTTATAGAACATGACGGG + Intergenic
902495251 1:16867791-16867813 AGATTTTTATAGAACATGACGGG - Intronic
904714409 1:32456467-32456489 TCATGGTTATGATACAGGACAGG + Intergenic
906923961 1:50094480-50094502 TGATGGTAATAATTCAAGACAGG + Intronic
908062652 1:60368567-60368589 TGGGGCTTATCAAACATGACAGG - Intergenic
910245662 1:85135599-85135621 TGAGTGTCATAAACCATGACTGG + Intergenic
910781353 1:90938348-90938370 TTCTGGTGATACAACATGACGGG + Exonic
912225315 1:107726446-107726468 AGATGGTTCTGAGACATGACTGG - Intronic
913464787 1:119129048-119129070 TTATGGTTATAAAGTATAACTGG + Intronic
917946965 1:179983756-179983778 TAATGTTTATCAAATATGACAGG + Intronic
920833486 1:209486420-209486442 TGATTTTTATAAAAGATGAATGG - Intergenic
920940681 1:210479073-210479095 TGATGCTGATAAAACTTGCCCGG - Intronic
923873116 1:238017890-238017912 TGCTGGTTATAAAAAATGACAGG - Intergenic
1063231679 10:4071655-4071677 TGGTGATAATAAAACATGAATGG - Intergenic
1063750878 10:8945493-8945515 TGATGGTTTTTAATCATGAAGGG + Intergenic
1063986762 10:11512709-11512731 TGATGGTGAGAAAACATGACAGG - Intronic
1064191690 10:13211985-13212007 TGATGGATAACAAACTTGACAGG + Intergenic
1066058236 10:31700787-31700809 TGATGTTTATAAAAAATAAATGG + Intergenic
1066360495 10:34726059-34726081 TGATGGTTAAAAGACATGTTAGG - Intronic
1075386019 10:122056047-122056069 TGATGGTTCTCAAACTTGAGTGG + Intronic
1076559986 10:131356041-131356063 TGATGATTATCAAGGATGACAGG + Intergenic
1079840383 11:25390435-25390457 TGATAGTTCTTAAACATAACAGG + Intergenic
1080273586 11:30477712-30477734 TGCTGGCTATAAAACATGTTGGG + Intronic
1082717140 11:56627991-56628013 TTATGTTTATAAAATATAACTGG + Intergenic
1085607368 11:77914084-77914106 TGATGGTTGTAAAACATCGCAGG + Intronic
1087279880 11:96198484-96198506 TGATGATTACAAAACTTGAATGG - Intronic
1090157499 11:124456901-124456923 TTATGATTTTAAAATATGACTGG - Intergenic
1090444522 11:126752344-126752366 TGATGGCTTTAAAAAATGTCAGG + Intronic
1092024079 12:5226262-5226284 TGAAGGATATCAAGCATGACTGG - Intergenic
1092310762 12:7349523-7349545 TGCAAGTAATAAAACATGACTGG + Intronic
1093469894 12:19489340-19489362 TGATGGTTTTTAAAAATGGCAGG - Intronic
1093828974 12:23731628-23731650 TGATGGATATGTTACATGACAGG - Intronic
1094625775 12:32122580-32122602 ACCTGATTATAAAACATGACTGG - Intronic
1096305253 12:50469265-50469287 TGAAGGTGATAAAACATGGGGGG - Intronic
1099010534 12:77286172-77286194 TGATGCTTATAAATTATTACAGG + Intergenic
1099205880 12:79725841-79725863 TGATGGTAATAAAAAATCAAGGG + Intergenic
1099829813 12:87827032-87827054 TGAGGGTAATAAGACATGAGAGG - Intergenic
1099964957 12:89436330-89436352 TAATGGCTATGAAACATAACGGG - Intronic
1107417858 13:40217965-40217987 TGATGGTAATTAAACACCACTGG - Intergenic
1107577469 13:41742417-41742439 TAATTGTGATAAAAAATGACAGG + Intronic
1108000225 13:45899243-45899265 TGATGTTTATAATATATGCCAGG + Intergenic
1110196416 13:72793667-72793689 TGATGGTCATAAAAAATGGTTGG + Intronic
1118152163 14:63201121-63201143 TGATGGTTATGAATCAGGAGGGG - Intergenic
1120431965 14:84430339-84430361 TGATCCTTATACAACATGATGGG - Intergenic
1121805979 14:96823160-96823182 TTATGTTTTTAAAACATGACTGG + Intronic
1124689197 15:31807669-31807691 TGATGGTTTTAAACCATCTCAGG - Intronic
1125408476 15:39379910-39379932 TGAGGGTTTTTAAACATGAAAGG - Intergenic
1126067532 15:44837513-44837535 TGGTGTTTATAAAGCATGAAAGG - Intergenic
1126092344 15:45063368-45063390 TGGTGTTTATAAAGCATGAAAGG + Intronic
1126664656 15:51065572-51065594 TGATGGTTATAAAACATGACAGG + Intronic
1126980248 15:54233945-54233967 TGTTGGTTATATTAAATGACTGG + Intronic
1130356522 15:83136201-83136223 TGATGGTTAAAAAACACAACTGG + Exonic
1136232129 16:28892748-28892770 TCATTTTTATGAAACATGACAGG - Intronic
1137260823 16:46828319-46828341 TGATGTATATAAAATATGTCTGG - Intronic
1137903778 16:52298035-52298057 TTAAGATAATAAAACATGACAGG + Intergenic
1139783063 16:69367743-69367765 TGTTGGTTAGACAACAAGACAGG - Intronic
1141249780 16:82344827-82344849 TGATGTATATAAAATATGTCTGG - Intergenic
1150115140 17:62540919-62540941 AGATGGTAGTAAAACATGTCAGG - Intronic
1150174757 17:63040562-63040584 TGATGGTTACAAATCAGCACAGG - Intronic
1153957991 18:10114460-10114482 TGATGGTTATACAATATCAAAGG + Intergenic
1155818440 18:30345660-30345682 TGATATCTATAAAACATGAATGG - Intergenic
1156562193 18:38137852-38137874 TAATGGTTCTAAAACATCAGTGG - Intergenic
1156794395 18:41025108-41025130 AAAAGGTTATAATACATGACAGG + Intergenic
1158808270 18:61001032-61001054 TGCTGGTTATCAATCATGAGAGG + Intergenic
925655580 2:6144675-6144697 TGATGCTTATAAAAAATCATTGG - Intergenic
926380656 2:12285766-12285788 TGTTAATTATAAAACATGATGGG - Intergenic
928144177 2:28756801-28756823 TGAAGGTTAAAAAAAATGAATGG + Intronic
930879360 2:56253940-56253962 TGATGGCTATGAGTCATGACTGG + Intronic
933773271 2:85756847-85756869 TGATTGTTAACAAACATCACAGG - Intronic
936053654 2:109244211-109244233 AGCTGGAGATAAAACATGACGGG + Intronic
937157073 2:119728580-119728602 TTCTTGTTATAAAACATGCCAGG - Intergenic
940014761 2:149092417-149092439 CGATCTTTATAAAACAAGACAGG + Intronic
943348883 2:186773812-186773834 TGATGATTTTAAAAAATGAGAGG - Intergenic
943358178 2:186884824-186884846 TGATGGTGATAACATATGACTGG - Intergenic
947258364 2:228191581-228191603 TGATAGTCATAAAACTTGAAGGG + Intergenic
947305722 2:228744388-228744410 TGATGTTTTTAAAACATCACAGG - Intergenic
1171368019 20:24639753-24639775 TAATGTTTAGAAAACAGGACTGG - Intronic
1172846668 20:37933773-37933795 TGATGGGCACAAAAAATGACAGG + Intronic
1174634122 20:51984215-51984237 GGAGGGTTATAAAACCTCACTGG + Intergenic
1174714668 20:52745091-52745113 TGATGTTTGCAAAACATGTCAGG + Intergenic
1178313690 21:31551940-31551962 GGATGGGAATAAAACAGGACCGG + Intronic
949553546 3:5132539-5132561 TGATGGTTAAAAATAATGAGAGG - Intronic
950164908 3:10789334-10789356 TGAAAGTTAGAAAACATGACTGG + Intergenic
951594598 3:24303629-24303651 TGATAGTTATGCAACATTACTGG + Intronic
957150443 3:76479418-76479440 TGAAGCTTATAAAACAAGATAGG - Intronic
957372141 3:79308844-79308866 TGATTGTTATAAAACAATCCTGG - Intronic
957612886 3:82491503-82491525 TAAAGATTATTAAACATGACAGG - Intergenic
963146254 3:141998281-141998303 TCAGGGTTAGAAAGCATGACCGG - Intronic
963348051 3:144119580-144119602 TCATGATTATAAAACAGGGCGGG - Intergenic
964036654 3:152207257-152207279 TGTTGTTTCTAAAACATGCCAGG + Intergenic
965770967 3:172180773-172180795 GAATGGTTATAAAATATGCCTGG + Intronic
965842906 3:172927751-172927773 TCATGGTTATAAAAATCGACGGG + Intronic
965999896 3:174935790-174935812 AAATGATTATAAAACATGAGAGG - Intronic
966078005 3:175962467-175962489 TGATGGTAATGATTCATGACTGG + Intergenic
966378979 3:179324293-179324315 TGTTGGTTGAAAAAAATGACAGG + Intronic
972668037 4:41186075-41186097 TTATGGTTATAAAATATTTCGGG - Intronic
973692127 4:53446390-53446412 TGATAATTATAAAAAATAACAGG - Intronic
974019757 4:56682431-56682453 TGACGGTTATAAAACATGTGTGG + Intergenic
974106961 4:57480728-57480750 TGATGGTGATAGAACAAGAGAGG - Intergenic
974125307 4:57688782-57688804 TGATTTTTATAAAGTATGACAGG - Intergenic
974241654 4:59256846-59256868 TGATGTCTATCAAACAAGACAGG - Intergenic
974311610 4:60217531-60217553 AGATGGTTAACAAATATGACAGG - Intergenic
974592416 4:63971196-63971218 TGATGATGATAAATCATCACTGG + Intergenic
976246959 4:83013877-83013899 TGATGGTTAAATAAAATGAAGGG + Intergenic
978713386 4:111812342-111812364 TCATGGTTATTAAATATGACAGG - Intergenic
979002976 4:115250061-115250083 TGTTGGTTCTGAAACTTGACTGG + Intergenic
979350058 4:119633027-119633049 TAAAAGTTATAAAACATTACTGG + Intergenic
981078390 4:140614293-140614315 TGGTGTTTATAAAAAATAACGGG + Intergenic
982031468 4:151305719-151305741 TGCTGGTGATAACACATAACAGG + Intronic
982602796 4:157472844-157472866 TGAAGTTTATAAAAGATTACAGG + Intergenic
982979883 4:162118715-162118737 TTATGGATATACAACATGAAAGG - Intronic
983247739 4:165308130-165308152 TGAAGGATATAAAAGAAGACAGG - Intronic
985141756 4:186847263-186847285 TTATGTTTATAAATCATAACTGG - Intergenic
986904638 5:12480578-12480600 TGATACTTATAAAACATAACAGG + Intergenic
987127928 5:14832384-14832406 TGAGGGTTAAAAAACATTTCTGG + Intronic
987386277 5:17332561-17332583 TGAAGTTGAAAAAACATGACCGG + Intergenic
988674860 5:33421967-33421989 TGATAGTTAGAAAACGTGAATGG - Intergenic
988818162 5:34854646-34854668 TGATGACTATAAAACATGAATGG - Intronic
989761614 5:45022934-45022956 TGGTGGTTGTACAACATTACTGG + Intergenic
990048010 5:51458199-51458221 GGATGATTAAAAACCATGACAGG - Intergenic
991638180 5:68727241-68727263 GGATGATTATAAAGGATGACAGG - Intergenic
992712341 5:79471809-79471831 TGATGTTTCTCAAACATGCCAGG + Intronic
993592297 5:89809052-89809074 GAATGGTTAGAAAAGATGACTGG - Intergenic
995351796 5:111185590-111185612 TTATGGTTGTATAACATGATGGG - Intergenic
998009040 5:138678511-138678533 TGATGGTTATAGAAGAAGGCAGG - Intronic
998559380 5:143156909-143156931 TGTTGGTTACAAATCAAGACAGG + Intronic
998836279 5:146205192-146205214 AAATGGTTATCAAACATGGCCGG - Intronic
1003869195 6:10388518-10388540 TTATGGTTATAAAACAGTAAAGG - Intergenic
1005085054 6:21997470-21997492 CAATGGTAATAAAAAATGACTGG + Intergenic
1006807592 6:36798625-36798647 TAATGGTTGGAAGACATGACAGG + Intronic
1007983245 6:46180558-46180580 TAATGGTTAGAAAACAGGTCTGG + Intergenic
1008897872 6:56578562-56578584 TGATATTTAGAAAACATAACAGG - Intronic
1010799485 6:80158499-80158521 TTATGGTTCTAGAATATGACAGG - Intronic
1012881757 6:104799708-104799730 TAAAGGTTATAAAACATAAAGGG - Intronic
1014135168 6:117880579-117880601 TGATGGTTATATAGCATTACAGG + Intergenic
1014391240 6:120868088-120868110 TGATGGGCATAAAACATTACTGG + Intergenic
1015496066 6:133884565-133884587 TGATGGGCATAAAACAATACAGG - Intergenic
1016600170 6:145849446-145849468 AGATTGTTACAAAACATGATTGG + Intergenic
1017873854 6:158507508-158507530 TGATGGTCATTCAGCATGACTGG + Exonic
1019039893 6:169095055-169095077 TGATGGTTAAGAAAGATTACAGG - Intergenic
1020795031 7:12668555-12668577 TCATGGTTATAAAACACATCTGG - Intergenic
1020811999 7:12859316-12859338 TGATGTCTATAAAAGATAACTGG - Intergenic
1023529992 7:41142981-41143003 TCATTGTTATAAAACAAAACAGG - Intergenic
1025241992 7:57284376-57284398 TGTTGTTTATGAAACATGAAAGG - Intergenic
1025895855 7:65699857-65699879 TGATGGTTGTAAAGCATCGCAGG - Intergenic
1026166757 7:67916870-67916892 TGTTGTTTATGAAACATGAAAGG - Intergenic
1027146395 7:75698113-75698135 TGATAGTTATAAAACTGGGCTGG - Intronic
1027748228 7:82106398-82106420 TGATGCGTATAACAAATGACAGG - Intronic
1028973934 7:96891274-96891296 TGGTGGTTATTAAAAATGATAGG + Intergenic
1033416077 7:141162278-141162300 TGAGGGATGTAAAACATGAGCGG - Intronic
1033708904 7:143917686-143917708 TGAAGGTTCCAAAACATGACAGG - Intergenic
1036040955 8:5080935-5080957 TGATGTTTATAAAACTTTAAAGG - Intergenic
1037246952 8:16845987-16846009 TGCTGGTAATAAAACAAGAAGGG - Intergenic
1037481517 8:19310662-19310684 TGCTGATCATAAAATATGACAGG + Intergenic
1038825282 8:30992424-30992446 TGATGATTATAAAAAATAACAGG + Intergenic
1045759630 8:105588995-105589017 TAAAGGTTTTAAAACATAACGGG - Intronic
1046798676 8:118399839-118399861 TGATGGTTTTAAAACAGCCCAGG + Intronic
1047717570 8:127609831-127609853 TGGTAGTTTTAAAACATGGCTGG - Intergenic
1048599299 8:135902120-135902142 TCATGCTTATAGAACATGCCAGG + Intergenic
1050650643 9:7772210-7772232 TGATGCTTATAACACTGGACTGG + Intergenic
1051783788 9:20720139-20720161 TCATGGCTATAAAACAAGGCTGG - Intronic
1052002827 9:23307620-23307642 TGATAGATATAAAAAAGGACAGG + Intergenic
1052441724 9:28505573-28505595 TGATGATTATAAATCATAAATGG + Intronic
1052808358 9:33033857-33033879 TGCTGGTACTAAACCATGACTGG - Intronic
1055048056 9:71951291-71951313 TGATGGCTATGAAAGATGAGGGG + Intronic
1055498534 9:76880218-76880240 GGATGGCTTTAAAAAATGACAGG - Intronic
1055629448 9:78208636-78208658 TGATGGTGAGAAAACGTGTCAGG - Intergenic
1056050643 9:82765096-82765118 TGTTGATTATAAAAATTGACAGG + Intergenic
1059866639 9:118521832-118521854 TGATGGTAAAAAAACATTAGTGG + Intergenic
1061026124 9:128050953-128050975 TGCTGGCAATAATACATGACAGG - Intergenic
1061731247 9:132615832-132615854 TGCTGGTTATTAACAATGACTGG + Intronic
1185496981 X:562241-562263 TGATGGATAGATAAGATGACTGG - Intergenic
1186280059 X:7982755-7982777 TGATAGTTAATAACCATGACTGG + Intergenic
1186353392 X:8763601-8763623 TGATAGTTAATAATCATGACTGG - Intergenic
1186620224 X:11232675-11232697 TGATAGTTAATAATCATGACTGG + Intronic
1186794630 X:13032719-13032741 TGATAGTTAATAACCATGACTGG - Intergenic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1189267656 X:39729309-39729331 TGACGGTTTTGAAACATGGCAGG - Intergenic
1189435988 X:40993090-40993112 GGAAGGACATAAAACATGACAGG - Intergenic
1192866258 X:75135780-75135802 TGATGGTTTTTTAACATGAAGGG - Intronic
1195608888 X:106841256-106841278 TCCTTGTTATAAATCATGACAGG - Intronic
1197555841 X:127952032-127952054 TGATGGTTATACAACATTATGGG - Intergenic
1198333619 X:135644953-135644975 TGATGTTCCTCAAACATGACAGG + Intergenic
1198566711 X:137912825-137912847 TTATTTTTCTAAAACATGACTGG - Intergenic
1200989140 Y:9333887-9333909 TCATGGAAACAAAACATGACTGG + Intergenic
1200991797 Y:9354217-9354239 TCATGGAAACAAAACATGACTGG + Intergenic
1200994451 Y:9374497-9374519 TCATGGAAACAAAACATGACTGG + Intronic
1200997114 Y:9394843-9394865 TCATGGAAACAAAACATGACTGG + Intergenic
1200999630 Y:9463381-9463403 TCATGGAAACAAAACATGACTGG + Intergenic
1201002288 Y:9483689-9483711 TCATGGAAACAAAACATGACTGG + Intronic
1201004947 Y:9503976-9503998 TCATGGAAACAAAACATGACTGG + Intergenic
1201007605 Y:9524303-9524325 TCATGGAAACAAAACATGACTGG + Intergenic
1201010233 Y:9544493-9544515 TCATGGAAACAAAACATGACTGG + Intergenic