ID: 1126671720

View in Genome Browser
Species Human (GRCh38)
Location 15:51121367-51121389
Sequence ACCTCAGCTTGAGCCAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126671720_1126671722 -3 Left 1126671720 15:51121367-51121389 CCTCTCCTGGCTCAAGCTGAGGT No data
Right 1126671722 15:51121387-51121409 GGTTGCCCTGAGCAACTCCTTGG No data
1126671720_1126671725 3 Left 1126671720 15:51121367-51121389 CCTCTCCTGGCTCAAGCTGAGGT No data
Right 1126671725 15:51121393-51121415 CCTGAGCAACTCCTTGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126671720 Original CRISPR ACCTCAGCTTGAGCCAGGAG AGG (reversed) Intergenic
No off target data available for this crispr