ID: 1126676126

View in Genome Browser
Species Human (GRCh38)
Location 15:51160570-51160592
Sequence CTAGAATTCCACATTTACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126676121_1126676126 23 Left 1126676121 15:51160524-51160546 CCCACCCAGAGAAACACCTAGAC No data
Right 1126676126 15:51160570-51160592 CTAGAATTCCACATTTACAGTGG No data
1126676124_1126676126 18 Left 1126676124 15:51160529-51160551 CCAGAGAAACACCTAGACTGTGA No data
Right 1126676126 15:51160570-51160592 CTAGAATTCCACATTTACAGTGG No data
1126676125_1126676126 7 Left 1126676125 15:51160540-51160562 CCTAGACTGTGAGAGACACTAAA No data
Right 1126676126 15:51160570-51160592 CTAGAATTCCACATTTACAGTGG No data
1126676122_1126676126 22 Left 1126676122 15:51160525-51160547 CCACCCAGAGAAACACCTAGACT No data
Right 1126676126 15:51160570-51160592 CTAGAATTCCACATTTACAGTGG No data
1126676123_1126676126 19 Left 1126676123 15:51160528-51160550 CCCAGAGAAACACCTAGACTGTG No data
Right 1126676126 15:51160570-51160592 CTAGAATTCCACATTTACAGTGG No data
1126676120_1126676126 24 Left 1126676120 15:51160523-51160545 CCCCACCCAGAGAAACACCTAGA No data
Right 1126676126 15:51160570-51160592 CTAGAATTCCACATTTACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126676126 Original CRISPR CTAGAATTCCACATTTACAG TGG Intergenic
No off target data available for this crispr