ID: 1126676264

View in Genome Browser
Species Human (GRCh38)
Location 15:51161494-51161516
Sequence CAGTGTGAGTTGTGGGACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126676264_1126676269 26 Left 1126676264 15:51161494-51161516 CCTCAGTCCCACAACTCACACTG No data
Right 1126676269 15:51161543-51161565 ATGAGCCTTGCTTCCAGAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126676264 Original CRISPR CAGTGTGAGTTGTGGGACTG AGG (reversed) Intergenic
No off target data available for this crispr