ID: 1126678732

View in Genome Browser
Species Human (GRCh38)
Location 15:51184130-51184152
Sequence CTGAGTTTCGGCCCCGACGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126678724_1126678732 26 Left 1126678724 15:51184081-51184103 CCCGTCCCCGGGGGCACTTACAT No data
Right 1126678732 15:51184130-51184152 CTGAGTTTCGGCCCCGACGTTGG No data
1126678728_1126678732 19 Left 1126678728 15:51184088-51184110 CCGGGGGCACTTACATTGCTCTT No data
Right 1126678732 15:51184130-51184152 CTGAGTTTCGGCCCCGACGTTGG No data
1126678726_1126678732 21 Left 1126678726 15:51184086-51184108 CCCCGGGGGCACTTACATTGCTC No data
Right 1126678732 15:51184130-51184152 CTGAGTTTCGGCCCCGACGTTGG No data
1126678725_1126678732 25 Left 1126678725 15:51184082-51184104 CCGTCCCCGGGGGCACTTACATT No data
Right 1126678732 15:51184130-51184152 CTGAGTTTCGGCCCCGACGTTGG No data
1126678727_1126678732 20 Left 1126678727 15:51184087-51184109 CCCGGGGGCACTTACATTGCTCT No data
Right 1126678732 15:51184130-51184152 CTGAGTTTCGGCCCCGACGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126678732 Original CRISPR CTGAGTTTCGGCCCCGACGT TGG Intergenic
No off target data available for this crispr