ID: 1126683629

View in Genome Browser
Species Human (GRCh38)
Location 15:51227771-51227793
Sequence CTGCTTACCTTTCATAAAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126683629 Original CRISPR CTGCTTACCTTTCATAAAGA AGG Exonic
900032326 1:380792-380814 AGGCTTTCCTTTCATAAAGTGGG - Intergenic
900052877 1:608978-609000 AGGCTTTCCTTTCATAAAGTGGG - Intergenic
900553320 1:3267716-3267738 CTGCTCAACTTTCAGAAGGAGGG - Intronic
902241780 1:15094693-15094715 CTGCCCACCTTTCATACAGTGGG - Intronic
902752991 1:18530302-18530324 CTGTTTCCCTTTCAGGAAGATGG + Intergenic
904334511 1:29787931-29787953 CCCCTTACCTTTCATAAGCATGG - Intergenic
908923217 1:69221637-69221659 CTGCTATCCTTTTATAAAGAAGG - Intergenic
916291552 1:163172144-163172166 CTGCTTCCCTTCCAGATAGAGGG + Intronic
917136304 1:171791437-171791459 CTTCTTCCCTTTCCTAGAGAGGG + Intronic
918544080 1:185662644-185662666 CTGGTTACCTGTCATCAAGCTGG - Intergenic
922293391 1:224227862-224227884 CTGCTCTCCTTACAAAAAGAGGG + Intronic
1064272145 10:13875182-13875204 CTTCTTTGTTTTCATAAAGACGG - Intronic
1066543812 10:36477513-36477535 CTGTTTACCTTTCATTAAATTGG + Intergenic
1071685973 10:87756991-87757013 ATGCTTAACTTTCTTTAAGATGG - Intronic
1071977094 10:90965942-90965964 CTGCTTCCCTCTTATGAAGAGGG + Intergenic
1073766578 10:106689172-106689194 CTTCTTACCTAACATATAGAAGG - Intronic
1078068299 11:8092269-8092291 CTGCTCACTTTTTTTAAAGATGG - Intronic
1078434291 11:11311659-11311681 CTGGTTATCTTTCTTAATGATGG - Intronic
1079080870 11:17412866-17412888 CTTCTCACCTTGCATAGAGAAGG + Intronic
1079630170 11:22665564-22665586 CTCCTTAGCTTTCTAAAAGAAGG - Intronic
1079711508 11:23688905-23688927 CTGCTTGCCTTGAAGAAAGAAGG - Intergenic
1080866292 11:36198351-36198373 TTTCTAACCATTCATAAAGAAGG - Intronic
1083117840 11:60480876-60480898 CTGCTTCACATTCACAAAGACGG - Intergenic
1083913382 11:65723992-65724014 CTGCTAACCTCACAAAAAGAGGG - Intergenic
1085964669 11:81508174-81508196 TTGCTTTCCCTTTATAAAGATGG + Intergenic
1086361050 11:86059835-86059857 CTGCCTAACTTTCACAAAAAAGG + Intronic
1086891822 11:92267238-92267260 GTGCCTACATTTCTTAAAGATGG + Intergenic
1086928293 11:92664921-92664943 CGGATTACATTTAATAAAGAAGG + Intronic
1089206920 11:116772078-116772100 CTGTTTGCCTTTTAAAAAGAGGG - Intronic
1090303741 11:125672207-125672229 CTCCTTTACTTTCATAAATATGG + Exonic
1090558618 11:127903942-127903964 CTGCTTTGCTGTCCTAAAGATGG - Intergenic
1090935440 11:131337626-131337648 CTGCTAGACTATCATAAAGATGG + Intergenic
1096662684 12:53137747-53137769 CTACTGACCTTTCAAAAATAAGG - Intergenic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1102718724 12:114997792-114997814 CTGCTTTCCTTTGATAGAGAGGG + Intergenic
1105423063 13:20270220-20270242 CTGTTTACTTTCCATAATGAAGG - Intergenic
1109512725 13:63400934-63400956 CTGTTTATCTTTTATAAAAATGG + Intergenic
1109862680 13:68221331-68221353 ATGTTTACCTTTCAAAGAGATGG - Intergenic
1110241964 13:73278212-73278234 TTACTTACCTTTAAAAAAGAAGG + Intergenic
1111889113 13:94059698-94059720 CTGCTTGCTTTATATAAAGATGG + Intronic
1113355890 13:109579725-109579747 CAGCTTACCTTTCTTTTAGATGG - Intergenic
1114591531 14:23869394-23869416 ATGCTTACATTTCAAAGAGATGG + Intergenic
1116297751 14:43135229-43135251 CAGCTTACAGTTCTTAAAGATGG + Intergenic
1117762580 14:59046609-59046631 ATGCTTTACTTACATAAAGAAGG + Intergenic
1119906447 14:78307434-78307456 TTGCTTAACTTTCATTAAGAAGG + Intronic
1120394783 14:83955253-83955275 ATGCTTGCCTTTTATTAAGAGGG - Intergenic
1121105537 14:91277175-91277197 CTGCTTATCTTTTGTAGAGACGG + Intronic
1123433339 15:20236814-20236836 CTGGTTATTTTTCATAATGATGG - Intergenic
1125073191 15:35580807-35580829 CTGCTTACATTTCTTAGAGCAGG + Intergenic
1125353763 15:38794713-38794735 CTCCTTAACTTCCAAAAAGAAGG - Intergenic
1126395857 15:48216522-48216544 TTGCTTGCCTTTTTTAAAGATGG - Intronic
1126683629 15:51227771-51227793 CTGCTTACCTTTCATAAAGAAGG + Exonic
1126711341 15:51460302-51460324 CTGCCTTCCTTTCATCACGAAGG + Intronic
1128341028 15:66822649-66822671 CTGCTTCCATTTCATACAGGAGG - Intergenic
1128786903 15:70404257-70404279 CTCCTTACCCCACATAAAGAAGG + Intergenic
1129136960 15:73562502-73562524 ATGATTACCTTTTATCAAGAAGG - Intronic
1132193462 15:99890588-99890610 CTGCTTTACCTTCACAAAGATGG - Intergenic
1132315420 15:100886715-100886737 CTTCTTTCCTTTTAGAAAGAAGG + Intronic
1136545243 16:30950724-30950746 CAGCTTACCTTTCATGATGGGGG + Intronic
1136851285 16:33614307-33614329 CTGGTTATTTTTCATAATGATGG + Intergenic
1140624475 16:76774619-76774641 CTGTTTACATTTCAGAAAGATGG - Intergenic
1141973383 16:87497217-87497239 CTGCTTTCCTGTCATTGAGAAGG + Intergenic
1203112887 16_KI270728v1_random:1462768-1462790 CTGGTTATTTTTCATAATGATGG + Intergenic
1146394628 17:32454202-32454224 CTGTTTATCTTTCATTAAGATGG + Intronic
1149676922 17:58473021-58473043 CTGCCTGCCTCTCATGAAGAGGG - Intronic
1151039660 17:70843921-70843943 CTGCCTACCACTCAAAAAGATGG - Intergenic
1155271061 18:24141573-24141595 CTCCTTCACTTTGATAAAGATGG - Intronic
1156044917 18:32867304-32867326 ATCCTTTCCTTTCATAAGGAAGG - Intergenic
1156370714 18:36469260-36469282 CTCCTTAAGTTTCATAAAGAAGG - Intronic
1157196037 18:45621082-45621104 CTGCTTACTTTTCATATGGTTGG + Intronic
1157209155 18:45726786-45726808 CTTCTCACATTTCATAAACAAGG + Exonic
1158232999 18:55279543-55279565 CATCTTACCTTGCATGAAGAAGG + Exonic
1159502581 18:69293224-69293246 CTGTTTACATTTCAAAAAGATGG + Intergenic
1159966561 18:74600837-74600859 CTGCCTACATTTCTTCAAGAGGG - Intronic
1159978436 18:74745502-74745524 ATGATTACATTTTATAAAGAAGG - Intronic
1160345528 18:78128979-78129001 CTGCTGTCCTTTTAAAAAGAGGG + Intergenic
1162246755 19:9407432-9407454 CTGTTTTCCATCCATAAAGAGGG - Intergenic
1163794789 19:19331148-19331170 CTGCTTTGCTATCATAAGGAAGG + Intronic
1165029542 19:32987877-32987899 CTGGTTATTTTTCATAATGATGG - Intronic
1165818204 19:38656470-38656492 CTGCTTTCCTTTCAAAATGTAGG - Intronic
927714625 2:25343410-25343432 GAGCTGACCTTTCATACAGACGG + Intergenic
928935383 2:36670977-36670999 CTGCTTACCTTCACTACAGAAGG - Intergenic
930978629 2:57494881-57494903 CTGCCTTCCTCTCATAAGGAAGG - Intergenic
936664058 2:114574398-114574420 CTCTTTTCCTTTCATAATGACGG - Intronic
937763746 2:125635280-125635302 CAGCTTGCATTTCATTAAGATGG + Intergenic
938550943 2:132381963-132381985 CCTCCTGCCTTTCATAAAGAAGG + Intergenic
938601716 2:132849243-132849265 GTGGTTAACTTTCAAAAAGAGGG - Intronic
941663944 2:168225071-168225093 CTGCTTCACTTTCAAAACGATGG - Intronic
942414660 2:175746199-175746221 CTCCATACCTTTCAGAAAGTTGG + Intergenic
943718449 2:191177817-191177839 CAGATTACCTTTCATAATGTGGG + Intergenic
943974366 2:194452556-194452578 CTGTTTACCTTTTATAAAGAAGG + Intergenic
945177160 2:207054240-207054262 CGGCTTTCCATTAATAAAGAGGG + Intergenic
945628534 2:212240789-212240811 ATGCTTAGGTTTGATAAAGAAGG - Intronic
947514751 2:230792795-230792817 GTGCTTTCCTTTCATAGTGATGG - Intronic
948093508 2:235315228-235315250 TTGCTTATTTTTCATAGAGACGG - Intergenic
948615929 2:239198877-239198899 CTGCTTCCCTGTCATCTAGAAGG - Intronic
1168746927 20:251482-251504 ATGCTTACATTTCAAAGAGATGG - Intergenic
1169042864 20:2509991-2510013 CTGTTTACATTTCAAAGAGATGG - Intronic
1169562307 20:6814875-6814897 CTGCTTACATTTTTTAAAAATGG - Intergenic
1169917622 20:10699179-10699201 AGGATTACCTTGCATAAAGATGG - Intergenic
1170818271 20:19733723-19733745 CTTCTTGACTTTCATAAATAAGG + Intergenic
1172664786 20:36591486-36591508 TTGGTTCCCTTTCATACAGAGGG + Exonic
1172946293 20:38692287-38692309 CTTCTGACCTTAGATAAAGAAGG - Intergenic
1177465742 21:21477457-21477479 TTGCTTACCTTTAATAATGTTGG - Exonic
1177639077 21:23822981-23823003 CTGTTTACCATTCAGACAGATGG + Intergenic
949279280 3:2327506-2327528 CTGGTTTTCTTTCCTAAAGAGGG - Intronic
950339449 3:12229754-12229776 CTGCTGACCTTCTATCAAGATGG + Intergenic
951131202 3:19047073-19047095 CTGCTAACCTAACATCAAGAAGG - Intergenic
952711757 3:36438894-36438916 ATGCTTTCCTTTGATAAACAGGG + Intronic
954077523 3:48192071-48192093 CTAGTTACCTTTCAGAAAGATGG + Intergenic
955522384 3:59787543-59787565 CATTTTACTTTTCATAAAGAGGG - Intronic
956078390 3:65531085-65531107 CTGCTTACCATTAATTAAGTAGG + Intronic
957712912 3:83887111-83887133 CTCCTTTACTTTCTTAAAGATGG - Intergenic
958614897 3:96480979-96481001 CTGCGTACTTTTCGTAGAGAGGG + Intergenic
958633569 3:96712625-96712647 CTGATGAGCTTTCATAAACAAGG - Intergenic
959681286 3:109099580-109099602 CTGCTGACCCGTCATCAAGAGGG + Intronic
961840032 3:129702117-129702139 ATGTTTACCTTTAATAAAGTTGG + Intronic
962411993 3:135149172-135149194 CTGCTTACGTTTTCTGAAGAAGG + Intronic
962928839 3:140019295-140019317 CAGATTACCTTTCATAATGTGGG + Intronic
963193726 3:142502921-142502943 CAGCCTTCCTTTCCTAAAGAAGG - Intronic
965153062 3:165007438-165007460 CTGTTTACCTTTGACATAGAAGG - Intronic
965187095 3:165478676-165478698 GTGGTTACCTTTCATGAGGAAGG + Intergenic
965367084 3:167814209-167814231 CTGCTTTCCTCTCATTAGGAAGG + Intronic
969634563 4:8359361-8359383 GTCCTTACCTTTCCTTAAGAGGG - Intergenic
971294996 4:25380124-25380146 AGACTTACCTTTTATAAAGAAGG - Intronic
971569376 4:28191161-28191183 CTGCTTCTTTTTCTTAAAGATGG - Intergenic
974689858 4:65283661-65283683 CTGATTACCTTCCATAATGTGGG - Intergenic
975268228 4:72396640-72396662 CTCTTTTCCTTCCATAAAGATGG + Intronic
975609784 4:76192567-76192589 CTGCTTCCCTTTTAAAAATAAGG - Intronic
977618489 4:99110189-99110211 CTGCTTTTTTTTAATAAAGAGGG + Intergenic
977715176 4:100174203-100174225 CAGATTACCTTTCATAATGTGGG + Intergenic
978565164 4:110073648-110073670 ATGCTTACATTTCATAGTGAAGG - Intronic
979878579 4:125925998-125926020 GTTCTTACCTTTCAGACAGATGG + Intergenic
981028218 4:140097498-140097520 CTGGTTATTTTTCAAAAAGATGG + Intronic
981677254 4:147356645-147356667 CTGTTTACATTCCAGAAAGACGG - Intergenic
983250501 4:165340025-165340047 GTGATTACCCTTCATAATGAGGG - Intronic
984240067 4:177207595-177207617 CTGCTTACATTTAAGAATGAGGG + Intergenic
985951567 5:3225449-3225471 CTTCTTGCCTTTCATAGAGAAGG + Intergenic
990558162 5:56956163-56956185 GTACTTACCTTTCGTAATGATGG + Intronic
991079773 5:62585719-62585741 CTGCCTACCTTTCCAAAACAAGG - Intronic
992305327 5:75431362-75431384 CTGCATCCATTTCATGAAGAAGG + Intronic
992739758 5:79761943-79761965 CTCCTTACCTGTCCTAAAGATGG - Exonic
992764134 5:79979543-79979565 ATGCTCACCTTTAATGAAGAAGG - Intronic
995967553 5:117927302-117927324 CTGCTTTCATTGCATAAAAAAGG - Intergenic
996196136 5:120609963-120609985 CTGCCTACATTTCATAAATAAGG + Intronic
1000066310 5:157695617-157695639 GTCCTTGCCTTTTATAAAGAGGG - Intergenic
1002741494 5:181438076-181438098 AGGCTTTCCTTTCATAAAGTGGG + Intergenic
1004040866 6:11973740-11973762 CAGCTAACCTTACAGAAAGATGG + Intergenic
1005588192 6:27297574-27297596 CTGCTTAGCCTTCAGTAAGAAGG + Intronic
1005610656 6:27521025-27521047 ATGCTTACCTTTAATTTAGATGG + Intergenic
1006810489 6:36817429-36817451 CTGCTCACCTCTCATAAATGAGG + Intronic
1007492570 6:42235173-42235195 CTGCTTACCTGTCACTTAGATGG - Intronic
1007904528 6:45445796-45445818 CTGTTTCCCTTTCTTCAAGAAGG + Intronic
1009564237 6:65291573-65291595 CTGTTAACCTTTCATAAGGGAGG + Intronic
1009701473 6:67188079-67188101 ATGTTTACCTTTCAAAGAGATGG + Intergenic
1009878928 6:69540739-69540761 ATGCTTACATTTCAGAGAGATGG + Intergenic
1010120393 6:72369150-72369172 CAGCTTAATTTTCATAGAGATGG - Intronic
1010363785 6:75026289-75026311 CTTCTTACCTTTTGTACAGATGG + Intergenic
1010735402 6:79438044-79438066 TTGCTTACCTTTTATAAAAGGGG - Intergenic
1010947555 6:81995827-81995849 CTGCTTTCATTTCATTAGGAGGG + Intergenic
1011310636 6:85975976-85975998 CTTCTTACCTTTCAGAATGAGGG - Intergenic
1014528270 6:122527227-122527249 CTGTTTTCCTTTCAGTAAGAAGG + Intronic
1016210665 6:141530152-141530174 CTGCTTATCAGTGATAAAGATGG + Intergenic
1016295783 6:142572551-142572573 GTTCTTGCCTTTTATAAAGAGGG - Intergenic
1017903400 6:158737795-158737817 CTGCTCTCCTTTCATTATGAGGG + Intronic
1019246629 6:170713841-170713863 AGGCTTTCCTTTCATAAAGTGGG + Intergenic
1021006543 7:15401638-15401660 CCACTTACTTTTCAGAAAGAAGG + Intronic
1026133080 7:67636448-67636470 GTGATTTCCTTTCAGAAAGACGG + Intergenic
1028282063 7:88943129-88943151 CTGCTTAGCTTTCGTGAATACGG + Intronic
1028414600 7:90566524-90566546 CTGCTTGCATTTGATAAATATGG - Intronic
1032187241 7:129737139-129737161 CTGCTTTCCTGTCTTTAAGACGG + Intronic
1032544646 7:132731485-132731507 CTGAAAACTTTTCATAAAGAGGG - Intergenic
1035086034 7:156258713-156258735 CTGGTGTCCTTTTATAAAGAGGG - Intergenic
1035501511 8:94120-94142 AGGCTTTCCTTTCATAAAGTGGG - Intergenic
1035523183 8:291499-291521 CTGTTTATCTTTTAAAAAGATGG - Intergenic
1036037484 8:5035067-5035089 CTACTAACCTTTTATAAAGTTGG + Intergenic
1037268897 8:17103236-17103258 TTCCTAATCTTTCATAAAGATGG - Intronic
1040883632 8:52235419-52235441 CTGCTTCTCTTTCATAAGCAAGG + Intronic
1041354403 8:56985059-56985081 CTGACTACCATTGATAAAGAAGG + Intronic
1041635431 8:60137705-60137727 CCACTTACCTTTCTTATAGATGG + Intergenic
1042823033 8:72952565-72952587 CTCCTGATCTTTCAAAAAGAAGG - Intergenic
1043162737 8:76866615-76866637 CTGCTTAACATTCATGAAAAAGG - Exonic
1043383565 8:79727679-79727701 TTACTTACATTTCCTAAAGAAGG - Intergenic
1044527055 8:93264137-93264159 CTGATTACCCTCCATAAAGTGGG + Intergenic
1044881955 8:96732220-96732242 CTGTTTATCTTTCACAAAGCTGG + Intronic
1046076872 8:109323117-109323139 CTCCTGCCCTTTCATGAAGATGG + Intronic
1050183016 9:2940880-2940902 GTGCTTACATTTTATCAAGAGGG + Intergenic
1050998600 9:12251966-12251988 CTGAATACCTTTCCTAAAGAAGG - Intergenic
1051014604 9:12459937-12459959 CTGATTACATTTCATACAGATGG + Intergenic
1054796436 9:69306728-69306750 ATCCTTACCTTTTATTAAGAGGG + Intergenic
1055261403 9:74438280-74438302 TTTCTTAAATTTCATAAAGAGGG - Intergenic
1057036555 9:91816004-91816026 CTGCTTACCGTTTATGGAGAAGG - Intronic
1058278977 9:103086985-103087007 CTATTTAGCTTTCAAAAAGAAGG + Intergenic
1060308746 9:122440155-122440177 GTGCTTACCTTCCAAAGAGATGG - Intergenic
1203607405 Un_KI270748v1:69292-69314 AGGCTTTCCTTTCATAAAGTGGG + Intergenic
1185843128 X:3411730-3411752 CAGCTTACATTTCCAAAAGAAGG - Intergenic
1186741922 X:12527512-12527534 TTGCTTATGTTTCACAAAGAAGG - Intronic
1187995097 X:24917652-24917674 CTGCTTATCTCTCATTATGATGG + Intronic
1188856379 X:35201096-35201118 ATGTTTACATTTCAAAAAGATGG - Intergenic
1188920957 X:35976377-35976399 CAGATTACCTTTCATAATGCGGG - Intronic
1193236701 X:79115078-79115100 CTGCTTTCCTTTTAAAAATAAGG + Intergenic
1193276452 X:79594017-79594039 ATGCTTACCTTCCATAACTATGG - Intergenic
1193648803 X:84103999-84104021 TTCCTGTCCTTTCATAAAGAAGG - Intronic
1199824603 X:151486344-151486366 TTACTTACCTTTCATCCAGATGG + Intergenic
1200385188 X:155883225-155883247 CTGATGGCCTTACATAAAGAAGG - Intronic
1200435028 Y:3141189-3141211 ATTCTTACCTTAAATAAAGATGG + Intergenic
1200691741 Y:6312246-6312268 CAGTTTAATTTTCATAAAGAGGG + Intergenic
1201043531 Y:9862477-9862499 CAGTTTAATTTTCATAAAGAGGG - Intergenic
1201232066 Y:11874844-11874866 CAGCTTACATTTCCAAAAGAAGG + Intergenic
1201281084 Y:12342728-12342750 CTTTTTACTTTTCATAGAGATGG + Intergenic
1201903440 Y:19066202-19066224 CTCCTTACCTATCCTAAAAATGG - Intergenic