ID: 1126686711

View in Genome Browser
Species Human (GRCh38)
Location 15:51254843-51254865
Sequence TAAACTCTGTTTACAACTTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126686711 Original CRISPR TAAACTCTGTTTACAACTTG CGG Intronic
901942087 1:12670488-12670510 AAAGCACTGTTTACAATTTGGGG - Intergenic
909065959 1:70936127-70936149 TAAACTGTGTTTTCAAAGTGTGG + Intronic
910361198 1:86414922-86414944 TAAACTCTGTCTGCAAGCTGAGG - Intergenic
910950466 1:92641761-92641783 TAAATCCTGTTTACAGCATGTGG - Intronic
911216042 1:95196104-95196126 TAATAACTGTTTACAACATGAGG + Exonic
913135979 1:115889566-115889588 TAAACCCTATTTCCAACCTGTGG - Intergenic
916144078 1:161724564-161724586 TAAATTCTGAATACAAATTGTGG - Intronic
917002791 1:170378400-170378422 GAGACTCTGTTTTCAATTTGGGG + Intergenic
918647913 1:186923196-186923218 TAGACTCTTGTTAGAACTTGTGG + Intronic
918954985 1:191195982-191196004 TAAGATCTGTTTACTACTTATGG + Intergenic
920185179 1:204155057-204155079 CAAACTCTGTGTAGAACTTTCGG + Exonic
924006364 1:239616112-239616134 TTAATAGTGTTTACAACTTGCGG - Intronic
1064729377 10:18314372-18314394 TTGACTCTGTTCACAACATGGGG + Intronic
1066314955 10:34236033-34236055 TAAACTCTGATTCCAACATTTGG - Intronic
1066585474 10:36929752-36929774 TAAAATTTGTTTATAGCTTGTGG - Intergenic
1066788555 10:39035249-39035271 AAAACTCTGTTTCCAAACTGTGG + Intergenic
1067331457 10:45325038-45325060 GAAAAGCTATTTACAACTTGTGG - Intergenic
1067460911 10:46457841-46457863 TAATCACTGTTTACATTTTGGGG - Intergenic
1067626280 10:47926759-47926781 TAATCACTGTTTACATTTTGGGG + Intergenic
1068275779 10:54793740-54793762 AAAACTGTGCTTAGAACTTGGGG + Intronic
1071561093 10:86647325-86647347 TACACTGTTTTTACAGCTTGGGG + Intergenic
1073778505 10:106811942-106811964 TAAACTCCATTTTCAAGTTGAGG - Intronic
1074497727 10:113994550-113994572 TAAACACTGTTTGAAGCTTGGGG - Intergenic
1076619341 10:131777046-131777068 TAGTCTCTGCTTCCAACTTGGGG - Intergenic
1078034981 11:7794246-7794268 AAAACTTTGTTTAAAACTTTGGG - Intergenic
1078675260 11:13406186-13406208 TTAATTCTGTTTATAACTTTTGG - Intronic
1084074106 11:66759381-66759403 TATACTCTGTATACAACTTTAGG + Intronic
1086701152 11:89901350-89901372 TAGACTCTGTGGACTACTTGAGG - Intergenic
1086705015 11:89943177-89943199 TAGACTCTGTGGACTACTTGAGG + Intergenic
1088069957 11:105770214-105770236 TAAAGTCTGTTTTCAAACTGGGG - Intronic
1088382430 11:109209121-109209143 TAAAGTTTGTTTTCAATTTGGGG + Intergenic
1089310150 11:117552555-117552577 TAATCTCTGTTTTCAAGGTGAGG - Intronic
1089722348 11:120438584-120438606 TTCACTCAGTTTAAAACTTGCGG + Intronic
1090995392 11:131861259-131861281 TAAAGTCTTTTTAGCACTTGGGG - Intronic
1091047282 11:132335927-132335949 TTAACTAGGTTTACAACTGGTGG + Intronic
1091955896 12:4642429-4642451 TGAACTCCCTTTATAACTTGAGG - Intronic
1094827642 12:34284249-34284271 AAAAGACTGTTTCCAACTTGTGG + Intergenic
1094867179 12:34549506-34549528 AAAACTGTGTTTCCAAGTTGTGG + Intergenic
1097258054 12:57695558-57695580 TAAAGTCTGTTTTCCACTTGTGG - Intronic
1097387567 12:58967444-58967466 TAAACTCTATTTTCAAATTTAGG + Intergenic
1098057072 12:66518871-66518893 TAATCTCTGTTTTCAACTTTCGG - Intronic
1098563846 12:71908567-71908589 TAATCTCTGTTTTGATCTTGAGG + Intronic
1099857881 12:88191242-88191264 TAAAATCTGTTTGTAAGTTGGGG + Intronic
1101185769 12:102277124-102277146 TAAACTAAATTTACAGCTTGAGG + Intergenic
1106205472 13:27589740-27589762 TAAATTCTGTTTCCAAATTAAGG - Intronic
1106346777 13:28887024-28887046 TAAATTGTGTTGACAACGTGAGG + Intronic
1107087772 13:36444530-36444552 TAAAATCTTTTAAGAACTTGTGG - Intergenic
1107406494 13:40118991-40119013 TAAATTCTGTTTAGATTTTGAGG - Intergenic
1107702192 13:43059639-43059661 AAAAATCTGTATACAATTTGAGG - Intronic
1109019812 13:57074756-57074778 GAAACTCTCTTTACTACTTTTGG - Intergenic
1109784963 13:67161496-67161518 TAAACTGTGTTTAGAACAAGAGG - Intronic
1110202570 13:72869726-72869748 TAAACAGTGTCTAAAACTTGTGG - Intronic
1110819752 13:79900865-79900887 TAAAATCTGTTAACAAACTGGGG - Intergenic
1111617311 13:90676574-90676596 TACACTCTCTTTACAACTCTAGG + Intergenic
1112155574 13:96813261-96813283 TAAACTCTGTATTCAATTTTAGG + Intronic
1112501291 13:99945336-99945358 TAAAAACTGTTTACAAATTGTGG - Intergenic
1112554910 13:100458172-100458194 TGAACTTTGTTTAAAAATTGTGG + Intronic
1114046813 14:18882437-18882459 TAAAGTCTCTGTACAAGTTGTGG - Intergenic
1114117400 14:19637009-19637031 TAAAGTCTCTGTACAAGTTGTGG + Intergenic
1114726564 14:24943987-24944009 TAATTTCTGTTTAAAACTTTTGG - Intronic
1114896838 14:27001293-27001315 AAAACTGTGTCTACAAATTGTGG + Intergenic
1118506303 14:66415816-66415838 TGAACTCTGTTTACAAGTTTTGG - Intergenic
1118738867 14:68723611-68723633 TAAAAACTGTTTACATCTTTGGG - Intronic
1120907893 14:89636210-89636232 CATACTCTGTTGAAAACTTGAGG + Intronic
1125066634 15:35494835-35494857 TAAACCCTTTTTCCAAATTGAGG - Intronic
1126686711 15:51254843-51254865 TAAACTCTGTTTACAACTTGCGG + Intronic
1126858684 15:52863003-52863025 AACACTCTGTTTTCAAGTTGTGG + Intergenic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1130191408 15:81739674-81739696 TGAATTCTGCTAACAACTTGAGG - Intergenic
1131543602 15:93297184-93297206 TAAAATCTTTTTAAAACTTTGGG + Intergenic
1133081263 16:3322169-3322191 AAAACTTTGTTTCCCACTTGAGG - Intergenic
1134646724 16:15874434-15874456 TAAACTTTGTTTACTATCTGGGG - Intronic
1135935125 16:26773397-26773419 TAATCACTGTGGACAACTTGGGG - Intergenic
1136680396 16:31958143-31958165 TAAACTGTGTTTGCAGTTTGAGG - Intergenic
1136780740 16:32899689-32899711 TAAACTGTGTTTGCAGTTTGAGG - Intergenic
1136889671 16:33959980-33960002 TAAACTGTGTTTGCAGTTTGAGG + Intergenic
1137009272 16:35307430-35307452 GAAACTCTCTTTACCACCTGAGG + Intergenic
1137034767 16:35560470-35560492 GAAACTCTCTTTACCACTTGAGG + Intergenic
1139204389 16:65013168-65013190 GATGCTCTGTATACAACTTGAGG + Intronic
1140788881 16:78370212-78370234 TAAACTCTCTTTACAATCTGGGG + Intronic
1203083395 16_KI270728v1_random:1163718-1163740 TAAACTGTGTTTGCAGTTTGAGG - Intergenic
1143935247 17:10477070-10477092 TACACTCTGTTTCCAAGTTGTGG + Intergenic
1144117250 17:12109620-12109642 TAAACTCTGTTCACCACTGTGGG - Intronic
1145115119 17:20202750-20202772 AAAACTCTGTGTATAACTTTTGG - Intronic
1147694166 17:42338635-42338657 TTAACTCTGTTTAGATCTTAAGG - Intronic
1149164328 17:53732706-53732728 TAATCTGTGTTTACCACTTAGGG - Intergenic
1149353631 17:55817092-55817114 TTAACTCTGTCTACAAAATGTGG - Intronic
1149472980 17:56934166-56934188 TAAACTCTAGTTACATCTTTGGG - Intergenic
1151080261 17:71321601-71321623 GAAACTCTGTTTGCAATTTAAGG + Intergenic
1155497275 18:26454972-26454994 TAAACTCTGTTTAAAAAATAAGG - Exonic
1157889843 18:51405181-51405203 TCACCTCTGTATACAATTTGGGG - Intergenic
1158442022 18:57484549-57484571 TAAATTCTGATTACAAATTGAGG + Exonic
1161487125 19:4542589-4542611 AAAACTCTGTTTACAACCACCGG - Exonic
1164312341 19:24057131-24057153 GACACTCTGTATACCACTTGAGG - Intronic
1168092943 19:54097382-54097404 GAAACTGTGTTTACAAACTGTGG - Intronic
924977218 2:189224-189246 TAAAGTCTTTTTACAAATTAAGG - Intergenic
924982097 2:232992-233014 TATATTCTTTTTACAACATGTGG - Intronic
925069097 2:951763-951785 TAAACTGTTTTCACAACTCGAGG - Intronic
928304753 2:30159073-30159095 TACCCTATGTTTACATCTTGAGG + Exonic
931132878 2:59358377-59358399 TAAACTCTACTAATAACTTGGGG - Intergenic
932351488 2:71035824-71035846 TGAGCTCTGTTGAAAACTTGTGG + Intergenic
932795756 2:74694402-74694424 TGAACTCTTTTTACAAAATGAGG + Intergenic
934499613 2:94846761-94846783 TAAAATATATTTAAAACTTGAGG + Intergenic
936374035 2:111925761-111925783 TAACCTCTGATTACAATTTGGGG - Intronic
937595694 2:123669575-123669597 TAGACTCTGTTTACATATTTTGG + Intergenic
938266545 2:129932464-129932486 TAAAGTCTCTGTACAAGTTGTGG + Intergenic
940925829 2:159362749-159362771 GAAACCCTCTTTACCACTTGAGG - Intronic
941024728 2:160446112-160446134 TAAACTCTGATTTCAATGTGAGG - Intronic
943659304 2:190540770-190540792 CAAACTCTTTTTAAAAATTGAGG - Intergenic
946843374 2:223838533-223838555 AAAACTCTGTTTACAGCTTGGGG - Intergenic
1169175722 20:3511588-3511610 TTAACTCTGTTTATCATTTGAGG + Intronic
1169977694 20:11348874-11348896 TAAAATCTTTTTACAAACTGAGG + Intergenic
1171318364 20:24216150-24216172 AAAAGTCTGTTTTCAGCTTGAGG + Intergenic
1177005577 21:15668498-15668520 TACAGTCTGTTCATAACTTGGGG - Intergenic
1179007188 21:37525982-37526004 TAAACACTGTTTTTATCTTGTGG - Intergenic
1180465349 22:15605076-15605098 TAAAGTCTCTGTACAAGTTGTGG - Intergenic
1182375396 22:29843567-29843589 TAAACTATTTTTAAAAATTGAGG - Intergenic
1183487833 22:38098911-38098933 TAAATTCTGTATACAACTGGAGG - Intronic
1183807933 22:40228089-40228111 AAAACTATGTTTACACCTTAAGG - Intronic
950164300 3:10781996-10782018 TAAACTCTGCTTCCAAATAGTGG - Intergenic
950899485 3:16484394-16484416 TAAACTCTGTATATAAATTTTGG - Intronic
951702661 3:25511787-25511809 TGAACTCTGTGCACAACTTGAGG + Intronic
952022033 3:29034572-29034594 TAAAAACTGTTTACAACCAGAGG + Intergenic
952298965 3:32087097-32087119 TAAACTCAGTTTACCACTGGAGG - Intergenic
955192052 3:56770646-56770668 CTAACTCTGCATACAACTTGAGG + Intronic
956999184 3:74864692-74864714 TAAATTCTCTTTTCAACTTAAGG + Intergenic
958766141 3:98370228-98370250 TCAACTCTGTTTACTTCTTGAGG + Intergenic
959429082 3:106229878-106229900 TGAATTCTGTCAACAACTTGAGG + Intergenic
960499948 3:118425405-118425427 TTAACTCTGTTTACATTTTGAGG - Intergenic
961273751 3:125710253-125710275 TAAGCTCTGTTGAAAACTTTTGG + Intergenic
963745514 3:149120510-149120532 TTTAGTCTGTTTAGAACTTGAGG + Intergenic
964330654 3:155598642-155598664 TACAGTCTGTTTCCAGCTTGGGG + Intronic
964657083 3:159079222-159079244 TGAACTCTGTTTTAAACTGGGGG - Intronic
964782425 3:160355140-160355162 CAAATTCTGTTTAGAACCTGGGG - Intronic
965133588 3:164733227-164733249 TACACTCTTTTTACAATGTGAGG - Intergenic
967909991 3:194534664-194534686 TAATCGCTGTGTACAACATGTGG + Intergenic
973104431 4:46316423-46316445 AAAACTCTGTTTACAAATATAGG + Intronic
975651058 4:76593622-76593644 TAAACTCTTTTTAAAAATTTGGG + Intronic
975736325 4:77384837-77384859 TTAACTCTGCATACAAATTGGGG - Intronic
980963876 4:139502005-139502027 TAAACTGTGATGACAACTGGGGG - Intronic
985484736 5:141579-141601 TAGACTCAGTTTCCAACTGGAGG + Intronic
985517631 5:355015-355037 TAAGCTCTGTTAACATTTTGTGG - Intronic
985921040 5:2974178-2974200 TCAACCCTGTTAACAGCTTGTGG + Intergenic
988942531 5:36160716-36160738 TCAACTTTGTTTTCAATTTGGGG + Intronic
989129585 5:38093469-38093491 TGAACTCAATTTATAACTTGAGG + Intergenic
989291253 5:39768959-39768981 TAAACTGTGTATACAATTTCTGG - Intergenic
989769280 5:45123596-45123618 TAAAATGTGTTTTTAACTTGGGG - Intergenic
989987877 5:50723617-50723639 TAACCTCTTTTTACAATTAGAGG + Intronic
990780583 5:59357430-59357452 TAAATCCTGTTTACATCCTGTGG - Intronic
992500866 5:77341818-77341840 TAAATTGTGTTTACAAGTGGTGG + Intronic
995687136 5:114783262-114783284 TCATCTCTGTTGACAACATGAGG + Intergenic
995717867 5:115097840-115097862 TAAATTCTGTATACAACGTCAGG - Intergenic
995973252 5:117999169-117999191 TAAATTCTTTTTAAAAATTGTGG - Intergenic
996821763 5:127637247-127637269 TAAGCAATGTTTACACCTTGTGG + Intergenic
1000873795 5:166610180-166610202 TAAACTCTGGAGACAACTAGAGG + Intergenic
1001060523 5:168484615-168484637 AAAACTCTTTTCACAACTTCTGG - Intergenic
1003478368 6:6506309-6506331 TAAAACCTGTTGACAACTTTGGG - Intergenic
1004515732 6:16320971-16320993 TAAACTCTTTTTAGAACACGAGG + Intronic
1010848072 6:80736296-80736318 TGAACTCTGTTTATATCTTTTGG + Intergenic
1012537517 6:100316906-100316928 GAAATTCTGATCACAACTTGAGG - Intergenic
1012684215 6:102223764-102223786 TAAAATCTGTGTATAATTTGTGG - Intergenic
1015048352 6:128807342-128807364 TAAAATCTGTTTACAGCTCTTGG - Intergenic
1015498499 6:133906365-133906387 TGAGCTCTGTTTACAACTAGAGG + Intergenic
1016753363 6:147656500-147656522 TAAAAGATGTTTACAACTTAGGG - Intronic
1017024974 6:150173633-150173655 TTAACTCTGTTTAATACCTGAGG + Intronic
1017180593 6:151548127-151548149 TAAACTCTGTTTTAGACCTGGGG - Intronic
1017626392 6:156353134-156353156 TAAAATGTGTTTCCAACTTAAGG + Intergenic
1018054297 6:160038605-160038627 TAAACTGTGTGTAAACCTTGTGG + Intronic
1021666845 7:22990852-22990874 TAAACTCTTTGAACCACTTGGGG + Intronic
1025090239 7:56056749-56056771 TAAACTGTGTTTAGAAATTTAGG + Intronic
1027459275 7:78432642-78432664 TTAACTCTGTTTATCATTTGAGG - Intronic
1027687936 7:81301199-81301221 TAAATTCTGTTTACTAGTTTAGG + Intergenic
1027743928 7:82049569-82049591 TTAACTGTGTGTACAACTGGCGG - Intronic
1028263248 7:88689231-88689253 TAAAATTTGTTGACAAATTGAGG - Intergenic
1028606162 7:92658143-92658165 TAAACTCTGTTTTTAGCTTGAGG - Intronic
1029382651 7:100223647-100223669 TGAACTCTGATGACAACGTGTGG + Exonic
1029860238 7:103563509-103563531 TAAACTTTTTTTAAAACTTTTGG - Intronic
1031216876 7:118905212-118905234 TAAAATATGTTTAAAAGTTGAGG - Intergenic
1032982886 7:137305242-137305264 TAAAGAATGTTTACATCTTGTGG - Intronic
1034321114 7:150183384-150183406 TCAACATTGTTTCCAACTTGGGG + Intergenic
1034771631 7:153783848-153783870 TCAACATTGTTTCCAACTTGGGG - Intergenic
1036177029 8:6548928-6548950 TAACCTCTGGTTATAACCTGGGG + Intronic
1039143755 8:34422085-34422107 TCAACTCTGTATACCACTGGAGG - Intergenic
1040686901 8:49884558-49884580 TAAACTCTCTTTCAAATTTGTGG - Intergenic
1041398584 8:57417997-57418019 TTGACTCTGGTTACAATTTGTGG + Intergenic
1043327832 8:79074144-79074166 TAAATTCTGCCAACAACTTGAGG - Intergenic
1044194949 8:89364683-89364705 TATACTCTGTTTACAAAATTTGG - Intergenic
1044421614 8:92002543-92002565 TATATTTTGTTTACAACTTTGGG - Intronic
1045690313 8:104753529-104753551 TAAACTCTGTGTACATCCTTTGG + Intronic
1049754468 8:144303566-144303588 TGAACTGTATTTAAAACTTGTGG + Intronic
1050767198 9:9149761-9149783 TCAAGTCTGTTTCCACCTTGGGG + Intronic
1050807487 9:9699355-9699377 TAAAATATTTTTAAAACTTGTGG + Intronic
1051584005 9:18707473-18707495 TAATATCTGTTTACATCTCGAGG + Intronic
1058392681 9:104513812-104513834 TAAAATCTGTGTATAACTTTTGG - Intergenic
1059346874 9:113634955-113634977 TTAAACCTGTTTACAACTTCAGG - Intergenic
1188033747 X:25293965-25293987 TAACCTCTTTTTATAATTTGGGG + Intergenic
1188605107 X:32018533-32018555 TAAACTCTGCTTACAACCTAAGG + Intronic
1193806029 X:85995856-85995878 TAAAATCTGTCTTCAACATGGGG + Intronic
1194332940 X:92607117-92607139 CCAACTCTGTTTACCATTTGAGG - Intronic
1195716599 X:107825044-107825066 GAGACTCTGTTTCTAACTTGGGG - Intergenic
1196499905 X:116367820-116367842 TAAAACCTGTTTACCACATGTGG + Intergenic
1196521687 X:116681349-116681371 GTAACTCTGTTTAAAATTTGAGG + Intergenic
1196521691 X:116681503-116681525 GTAACTTTGTTTAAAACTTGAGG - Intergenic
1199482933 X:148317698-148317720 TAATCACTGTTTGGAACTTGGGG - Intergenic
1200641636 Y:5726143-5726165 CCAACTCTGTTTACCATTTGAGG - Intronic