ID: 1126687747

View in Genome Browser
Species Human (GRCh38)
Location 15:51263257-51263279
Sequence CTGTATAAAGGGCTGCTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126687747 Original CRISPR CTGTATAAAGGGCTGCTGAG TGG Intronic
900674020 1:3872749-3872771 CAGCATAGGGGGCTGCTGAGTGG + Intronic
901705350 1:11069043-11069065 CTGTATAAAGGGCCATTGTGTGG + Intronic
905246634 1:36619398-36619420 CTATCTTAAGGGCTGCTGAGGGG + Intergenic
905644046 1:39612131-39612153 CTCCCCAAAGGGCTGCTGAGAGG - Intergenic
909882610 1:80899016-80899038 CTGCATTAATGGCTGCTCAGAGG - Intergenic
910844807 1:91594672-91594694 CTTTACAAAGGCATGCTGAGGGG + Intergenic
911285657 1:95988779-95988801 CAGTAAGAAGGGCTGCTGTGAGG + Intergenic
912964078 1:114221953-114221975 CTGCATCAAAGGCTGCTGAGAGG - Intergenic
916763538 1:167838443-167838465 TTGTATTAAATGCTGCTGAGAGG - Intronic
917136078 1:171789252-171789274 CAGTAAAAAGTGCTGATGAGTGG - Intronic
917742594 1:177975478-177975500 GTGGATAAAGGGCTGCTGTGTGG + Intronic
920023775 1:202976638-202976660 CTGGATCAAAGGCTGCTGATCGG - Intergenic
921053899 1:211529850-211529872 CTGCATGAAGGGCTCCAGAGTGG - Intergenic
921918635 1:220641998-220642020 CTGTCCAAACGGCTGCTGACAGG - Intronic
923329073 1:232906002-232906024 CTGGATCAAGGGCCGCAGAGAGG + Intergenic
924563256 1:245174670-245174692 CTGTAAAAATAGTTGCTGAGGGG - Intronic
1068892591 10:62163084-62163106 CTTTATAAATGCCTGCTGTGTGG + Intergenic
1070791923 10:79194770-79194792 ATGTATAGAGGGCTGCTTGGAGG - Intronic
1071374421 10:84988228-84988250 CTGTATTCAGGACTGCTGAGAGG - Intergenic
1072535659 10:96360695-96360717 TTGTATCAACTGCTGCTGAGAGG + Intergenic
1073185148 10:101611367-101611389 CAGTACACAGGGCTGCTGAGGGG + Exonic
1077340635 11:2024842-2024864 CTCTGGAAAGGGCTGCAGAGGGG + Intergenic
1078498619 11:11845433-11845455 CTATATAAAGGTCTTCTAAGAGG - Intronic
1079785603 11:24667557-24667579 CTGTGTAATGGGGAGCTGAGTGG + Intronic
1080647900 11:34200072-34200094 CTGTACAACTGGCTGCTGTGAGG - Intronic
1080985381 11:37457601-37457623 CTGTATCAAGTGCTACTGAAAGG - Intergenic
1082198125 11:49327823-49327845 CTGTATTAAGAGCTGCTCACTGG - Intergenic
1083741644 11:64714373-64714395 CAGTATCAAGAGCTGATGAGAGG - Intronic
1085522453 11:77146504-77146526 CCCTCTAAAAGGCTGCTGAGTGG - Intronic
1086657687 11:89380322-89380344 CTGTATTAAGAGCTGCTTATTGG + Intronic
1089442584 11:118529684-118529706 CTGGATAAGGGGCTCCTGGGAGG - Intronic
1090548800 11:127795780-127795802 CTGTAAATAAAGCTGCTGAGAGG + Intergenic
1090942912 11:131404305-131404327 CTATGTCAAGCGCTGCTGAGAGG - Intronic
1202823620 11_KI270721v1_random:80031-80053 CTCTGGAAAGGGCTGCAGAGGGG + Intergenic
1092775549 12:11942229-11942251 CTGTATAAAGGAATGTGGAGAGG + Intergenic
1096228767 12:49885892-49885914 CTCTATAAAGACCTGCGGAGAGG + Intronic
1096751266 12:53760374-53760396 TTGTTGAAAGGGCTCCTGAGTGG + Intergenic
1097781248 12:63707551-63707573 CTGTGCCAAGGGCTGCTGACAGG + Intergenic
1100533156 12:95479120-95479142 CTGTATACAGGGTTGTTTAGAGG + Intronic
1101434800 12:104655420-104655442 CAGGATAAAGGGATGCTGGGGGG - Intronic
1102147277 12:110663752-110663774 CTGTATTCAGTGCTGCCGAGTGG - Intronic
1102415683 12:112760636-112760658 AAGTATAAATGGCTCCTGAGAGG + Intronic
1103917347 12:124382748-124382770 CTGAATATGGGGCTGCTGAATGG + Intronic
1104395410 12:128428123-128428145 CTGTAGAACGGGTTGTTGAGAGG - Intronic
1106407217 13:29484485-29484507 CTGTGTGGAGGGCTGCAGAGGGG + Intronic
1106444239 13:29810523-29810545 CTGTTTTAAGTGCTGCTGAGAGG + Intronic
1107104198 13:36626009-36626031 CTGTCTAATGGGCTGATGTGAGG + Intergenic
1107643292 13:42467105-42467127 CTGTATAAAGGAGTACTAAGAGG + Intergenic
1110534436 13:76634927-76634949 CTGATTAAAGGGCTACTGATTGG - Intergenic
1110560588 13:76907440-76907462 CTGTAGAAAGGGCTGGTAAATGG - Intergenic
1111588530 13:90312637-90312659 CTGTTTAGATGGCTCCTGAGAGG + Intergenic
1113919031 13:113895700-113895722 CTTTATACAGTGCTGCTGATGGG - Intergenic
1114928710 14:27439232-27439254 CTATATCAAGAGCTGCTGATAGG + Intergenic
1116429472 14:44829260-44829282 CTGGATTAAGGTCTGCTGAAGGG - Intergenic
1118063413 14:62165202-62165224 CTGTGTGGAGGGCTGCTGTGAGG + Intergenic
1118769098 14:68929705-68929727 GTGCAGACAGGGCTGCTGAGAGG - Intronic
1119137211 14:72232013-72232035 CTGTATGAAGGGATACTGGGAGG + Intronic
1119683987 14:76615665-76615687 CTGTCTTAGGGGCTGCTGTGAGG + Intergenic
1121884418 14:97530140-97530162 CTGTAGTTACGGCTGCTGAGAGG - Intergenic
1123968078 15:25478863-25478885 GTGTGTACAGGGATGCTGAGAGG - Intergenic
1124706679 15:31972306-31972328 CTGCCTCCAGGGCTGCTGAGTGG - Intergenic
1125169726 15:36752524-36752546 CTGTTTTATGGGCTGCTGAGAGG + Intronic
1125458053 15:39880678-39880700 CTCTATATTGGGCTTCTGAGGGG - Intronic
1126069909 15:44857031-44857053 GTTTGTTAAGGGCTGCTGAGGGG - Intergenic
1126088620 15:45032131-45032153 GTTTGTTAAGGGCTGCTGAGGGG + Intronic
1126687747 15:51263257-51263279 CTGTATAAAGGGCTGCTGAGTGG + Intronic
1126992993 15:54405148-54405170 CTGTTTCTAGGGCTGCTGTGAGG - Intronic
1127569197 15:60224432-60224454 ATGACTACAGGGCTGCTGAGGGG - Intergenic
1128092842 15:64930796-64930818 CAGGAAAAAGGGCTCCTGAGAGG - Intronic
1128160778 15:65421903-65421925 CTGGAGAAAGGGCTGGGGAGGGG - Intronic
1130311890 15:82763542-82763564 CTGTTTAAAGGGCAACAGAGAGG - Intronic
1131875459 15:96801567-96801589 CTGTTTCCGGGGCTGCTGAGGGG + Intergenic
1133731096 16:8579173-8579195 CTGTTCAAAGAGCTGCTCAGTGG + Intronic
1134529353 16:14970884-14970906 CTGGTTCTAGGGCTGCTGAGAGG + Intergenic
1136169159 16:28477777-28477799 CTGTATGAGGGGCTCCTGGGAGG - Exonic
1136405257 16:30042018-30042040 GTGTAAAAAGGGCTCCTTAGGGG - Intronic
1139866998 16:70070070-70070092 CTGGTTCTAGGGCTGCTGAGAGG - Intergenic
1143588934 17:7868289-7868311 CAGTATAAAGTGCTGCACAGAGG + Intronic
1144334498 17:14256627-14256649 CTGGGTGAAGTGCTGCTGAGAGG - Intergenic
1144440228 17:15274599-15274621 CTGTAGAAAGAGCTGAGGAGGGG + Intergenic
1144769373 17:17751109-17751131 CTGCATGGAGGGCTGCTAAGGGG - Intronic
1148336666 17:46846684-46846706 CTGGATAAAGGGCTGGAGAATGG + Intronic
1149175859 17:53868998-53869020 TTGTATAAATGGATGGTGAGTGG + Intergenic
1151298466 17:73203502-73203524 CTGTAAGAAGCGTTGCTGAGAGG + Intronic
1153918162 18:9764533-9764555 CTTGACAAAGGGCTGCTGTGAGG + Intronic
1156185602 18:34659728-34659750 CTTCAGAAAGGGCTGGTGAGAGG - Intronic
1165342297 19:35221662-35221684 TTGTATAAAGGCCTGGTGAGTGG - Intergenic
1166990611 19:46690430-46690452 CTGTACAAAGACCTGGTGAGAGG - Intronic
1167109117 19:47448410-47448432 CTGGAGGAAGGGCTGCAGAGCGG + Intronic
1168416867 19:56174861-56174883 CTGTTTTAGGGGCTGCTGTGAGG + Intergenic
927445715 2:23159676-23159698 ATGTAGAAAGGCATGCTGAGTGG + Intergenic
928448657 2:31357082-31357104 CTGTCTAAAGTAGTGCTGAGGGG + Intronic
931462410 2:62460611-62460633 ATGTATAAAAGGTTGCTCAGAGG + Intergenic
931654912 2:64502194-64502216 AAGTAGAAAGGGCAGCTGAGGGG - Intergenic
931678664 2:64724058-64724080 CTTTATAAAGGGCTGAGGAGAGG + Intronic
932376025 2:71236672-71236694 CTGTAAAATGAGCTGCTGGGAGG - Intergenic
932612379 2:73209485-73209507 CAGTACTAAGAGCTGCTGAGTGG - Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933222160 2:79702928-79702950 GTGTTTGAAGGGCTGCAGAGAGG - Intronic
934078491 2:88448259-88448281 TTGTGGAAAGGGCTGCTGAAGGG + Exonic
936963368 2:118100290-118100312 CTGCATTAAGGGCAGCTGACAGG - Intronic
937185519 2:120037228-120037250 CAGTATAAAACACTGCTGAGAGG + Intronic
937989334 2:127653690-127653712 CTGTGGTGAGGGCTGCTGAGGGG + Intronic
943601037 2:189921348-189921370 CTGTGTACAGTGCTGCTGAGAGG + Intronic
946702525 2:222426885-222426907 CTGTACAAAGGCCTGCAGAGAGG - Intronic
946770871 2:223086932-223086954 CTGTACAAATGTCTTCTGAGCGG + Intronic
947334790 2:229070369-229070391 CTGTATCAAAGGCTCTTGAGGGG + Intronic
948649674 2:239433087-239433109 CTGTATAAATGGCAGCTGTGAGG + Intergenic
948723936 2:239920313-239920335 CTGTACAAACTGCTGCTGATGGG - Intronic
1169849967 20:10037400-10037422 CTGGATGATGGGCTGCTGATTGG + Intronic
1170134730 20:13060170-13060192 CTGTCTAAAGGGCTACTCTGAGG - Intronic
1170816659 20:19720108-19720130 CTGCAGAAAGGTCTGCTGGGTGG - Intronic
1172049183 20:32103295-32103317 CTGGAGATATGGCTGCTGAGAGG + Intergenic
1172963568 20:38816739-38816761 CTCTATATATCGCTGCTGAGGGG - Intronic
1174850302 20:53987676-53987698 CTGTAATAAGTGCTACTGAGTGG + Intronic
1175120707 20:56714146-56714168 CTGTAGAAAGGGCAGATGAGGGG - Intergenic
1175374240 20:58514003-58514025 CTGTACAAAGGCCAGCTGACTGG - Intronic
1175538474 20:59732592-59732614 TTGAGTTAAGGGCTGCTGAGGGG + Intronic
1177136072 21:17306454-17306476 CTGTTTAGAGGGCTATTGAGAGG + Intergenic
1179604011 21:42500426-42500448 CTGTAAAATGGGCTGTTGTGAGG + Intronic
1181746288 22:24956998-24957020 CTGTAAAAAGGGCTCATGATAGG + Intronic
1183130810 22:35833799-35833821 AAGTATATAAGGCTGCTGAGTGG + Intronic
1184172482 22:42768200-42768222 CCGTACAGAGGGCAGCTGAGGGG + Intergenic
1184217714 22:43078730-43078752 CTGTATAAAGGACTGCTGTTAGG + Intronic
950481092 3:13244496-13244518 CTAAATAAATGTCTGCTGAGTGG + Intergenic
951292904 3:20895824-20895846 CTGTACAAAAGTGTGCTGAGAGG + Intergenic
951590751 3:24261760-24261782 CTGTATCAAGTGTTGCTGATAGG - Intronic
951667537 3:25143820-25143842 TTGTACAATGGGCTGTTGAGAGG + Intergenic
951744312 3:25960514-25960536 CTGTATCAAATGCTGCTGATGGG + Intergenic
951805197 3:26636156-26636178 CCCTATAAAGAGATGCTGAGTGG + Intronic
953228307 3:41041290-41041312 CTGTATATAGGGCTGTCCAGTGG - Intergenic
953290046 3:41651174-41651196 CAATATCCAGGGCTGCTGAGAGG - Intronic
953754176 3:45632411-45632433 CTGTGTTTAGGTCTGCTGAGGGG + Intronic
953908267 3:46879216-46879238 CTGTGGAGAGGGCTGCAGAGAGG - Intronic
953981514 3:47415520-47415542 CTGAAGGGAGGGCTGCTGAGGGG + Intronic
954196967 3:49002697-49002719 CACTATAAAGGGGTGCAGAGAGG - Intronic
954264788 3:49463660-49463682 CTGACTAAAGGGCCACTGAGGGG - Intergenic
959023625 3:101215634-101215656 AGGTTTAAATGGCTGCTGAGAGG - Intergenic
961012663 3:123446971-123446993 CTGGATAGAGGGTTGGTGAGGGG - Intronic
962499334 3:135974056-135974078 CTGTGTAAAATGCTGCTGAAAGG - Intronic
963180583 3:142351372-142351394 CTGTATGAAATGCTGCTGATGGG + Intronic
964223789 3:154373746-154373768 CTGAATAAAGGAGTCCTGAGAGG - Intronic
964589602 3:158345525-158345547 TTGTTTAAAGGCCTGCTGGGAGG - Intronic
964930338 3:162012988-162013010 CTGTATAAAGCTGTGCTTAGCGG + Intergenic
965020637 3:163225752-163225774 CTGTATAAAGTTCTTCTCAGAGG - Intergenic
966361737 3:179137358-179137380 CTATATATAGGGCTGAGGAGTGG + Intergenic
969842844 4:9895577-9895599 CTGGGTGAATGGCTGCTGAGTGG - Intronic
972306361 4:37833946-37833968 TTGTATCCAGGGCTGGTGAGAGG - Intronic
972574618 4:40340210-40340232 CTGTGTAAAGGGGTGGAGAGTGG - Intronic
978153938 4:105468453-105468475 CTGTAAAAAGTACTGCTGATAGG + Intronic
979802740 4:124931221-124931243 CTGTAGAAAGGGTCACTGAGAGG - Intergenic
984591062 4:181618308-181618330 CTGAATGAAGTGCTGCAGAGCGG - Intergenic
984856624 4:184201041-184201063 CTGTCGAAAGGGCTGATGATGGG + Intronic
987242460 5:16014679-16014701 CTCTATAAAGGGATGTTGAAGGG - Intergenic
987982463 5:25104118-25104140 CTGTATAAAGTGTTTCTGTGAGG - Intergenic
988715270 5:33820414-33820436 CTGTATAAAGTTCTTCTAAGAGG - Intronic
989637838 5:43556292-43556314 CGCTTTAGAGGGCTGCTGAGGGG + Intronic
991112527 5:62917134-62917156 CTCTATCAAATGCTGCTGAGAGG + Intergenic
992178676 5:74175564-74175586 CTGTAGAAAGCTCTGCTGATGGG - Intergenic
995804546 5:116036985-116037007 CTGAGAAAAGGGCTGCTCAGAGG - Intronic
996543530 5:124654113-124654135 CTGGATGAAAGGCTGTTGAGTGG - Intronic
997750667 5:136342329-136342351 CTGTATTCAGTTCTGCTGAGGGG + Intronic
998163347 5:139826056-139826078 CTGTATAAAAGGCTGCCATGAGG + Intronic
998405842 5:141874346-141874368 ATGTATCAAAGGCTGCTGTGTGG - Intronic
999745478 5:154588619-154588641 CTGTATGGAGGGCTGAGGAGAGG - Intergenic
1001686140 5:173596396-173596418 CTGTAAAATGGGCTGCTTTGAGG - Intergenic
1002426153 5:179177140-179177162 CTGTTTGAAGGGCTTCTGTGTGG - Intronic
1005649485 6:27873543-27873565 CTATATAAAGTACTGCTGCGAGG - Intergenic
1011412408 6:87079551-87079573 GTGTATAAAGGGTTGCTGGCAGG - Intergenic
1011748926 6:90435644-90435666 GAGTATAAAGAGCTGGTGAGAGG + Intergenic
1015322506 6:131892357-131892379 CAGTATAAAGGGAGGCTGACTGG - Exonic
1015507551 6:134005198-134005220 CTTTAGATAGGGCTGCTGAATGG + Intronic
1016017698 6:139203472-139203494 CTTTATCAGGTGCTGCTGAGAGG - Intergenic
1016024424 6:139271780-139271802 CTGGACAAAGGGCTGCTGCTTGG - Intronic
1017282249 6:152637250-152637272 CGGTATAAAGGCTCGCTGAGCGG - Exonic
1017815303 6:158011985-158012007 CTGCAGACAGGGCTGCAGAGAGG - Intronic
1017898121 6:158699058-158699080 CTGCACACAGGGCTGCTGTGGGG + Intronic
1019156764 6:170044519-170044541 CTGCACAAAGGGCTGGTTAGTGG - Intergenic
1019506549 7:1394290-1394312 CTGTAAAATGGGCTGCTTGGAGG - Intergenic
1022939836 7:35223616-35223638 CTGTGCCAAGGGCTGCTGACAGG + Intronic
1024081421 7:45859255-45859277 CTGTTTTAAGGGCTCATGAGAGG - Intergenic
1024550332 7:50557600-50557622 ACTTATTAAGGGCTGCTGAGTGG + Intronic
1026977184 7:74505916-74505938 CTGTATTAAGGGATGCGGAGGGG - Intronic
1027750969 7:82146628-82146650 CTGTATGAAGTGCTACTGAAAGG + Intronic
1028487941 7:91380465-91380487 CTCTGTAAAGGGCTGTTGATTGG - Intergenic
1031074618 7:117200442-117200464 CTGTAGACAGAGCTGCTGAGGGG + Intronic
1032331321 7:130983201-130983223 CTGAATAAAGGGATGCTGAGGGG + Intergenic
1032398016 7:131604629-131604651 CTCTAAGAGGGGCTGCTGAGAGG + Intergenic
1034435419 7:151060734-151060756 CTGGCTGAAGGCCTGCTGAGGGG + Intronic
1034934701 7:155191301-155191323 CTGCAGTTAGGGCTGCTGAGAGG + Intergenic
1036930361 8:12950917-12950939 CTATACAAAGGGCGGCAGAGCGG + Intronic
1037659081 8:20911852-20911874 CCAGATACAGGGCTGCTGAGAGG - Intergenic
1037873349 8:22521176-22521198 CTGGTAAAAGGGCTGCTGATTGG - Intronic
1041035917 8:53790419-53790441 CTGTATAAAGGGCTGGTCGTGGG - Intronic
1042420236 8:68580023-68580045 CTTTATAAAAGGCTGCTCATAGG + Intronic
1043026513 8:75076871-75076893 CTTCATATAGGGCTGCTGAAAGG + Intergenic
1049432420 8:142571511-142571533 CTGGACCAAGGGCTGCTGGGAGG - Intergenic
1050646193 9:7722038-7722060 CTTTACAAAGGTCTTCTGAGTGG + Intergenic
1051468257 9:17405112-17405134 CTGTGTCAAATGCTGCTGAGAGG - Intronic
1052175582 9:25458746-25458768 CTGTAGAATGGACTGCTGAAGGG - Intergenic
1056347722 9:85716205-85716227 CTGTATCAAATGCTGCTGATAGG - Intronic
1059302732 9:113328148-113328170 CTAAATAAAGGGCTGTTGGGAGG + Intronic
1059556403 9:115284996-115285018 CTGTCTAAAATGATGCTGAGTGG + Intronic
1060431006 9:123551564-123551586 GTGTGTAAAGGGCTAGTGAGGGG + Intronic
1189490607 X:41468910-41468932 CTGTAAACAGGGCTGCTGCTGGG - Intronic
1191978854 X:66903517-66903539 GTGTAAAAGGGGCTGCTGAAGGG - Intergenic
1192830315 X:74744332-74744354 CTGCATACAGGGCTTCTTAGAGG + Exonic
1194695519 X:97044959-97044981 ATATATAAAATGCTGCTGAGAGG - Intronic
1197863997 X:130998870-130998892 GTGGATAATGGGCTGCAGAGGGG - Intergenic
1200111802 X:153744345-153744367 CTGTAGAAAGAGGTGGTGAGGGG - Exonic