ID: 1126689291

View in Genome Browser
Species Human (GRCh38)
Location 15:51275372-51275394
Sequence AAAGCTCTGAGTAGGGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 274}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126689291_1126689296 -2 Left 1126689291 15:51275372-51275394 CCTCCAGCCCTACTCAGAGCTTT 0: 1
1: 0
2: 2
3: 24
4: 274
Right 1126689296 15:51275393-51275415 TTTGCTTTACTAAGACCAGAGGG 0: 1
1: 0
2: 0
3: 11
4: 176
1126689291_1126689295 -3 Left 1126689291 15:51275372-51275394 CCTCCAGCCCTACTCAGAGCTTT 0: 1
1: 0
2: 2
3: 24
4: 274
Right 1126689295 15:51275392-51275414 TTTTGCTTTACTAAGACCAGAGG 0: 1
1: 0
2: 0
3: 14
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126689291 Original CRISPR AAAGCTCTGAGTAGGGCTGG AGG (reversed) Intronic
900537892 1:3187819-3187841 ACAGCTCTGTAAAGGGCTGGGGG - Intronic
901003640 1:6161215-6161237 AAAGGGCAGAGTTGGGCTGGGGG - Intronic
901732525 1:11290516-11290538 AATGCTTTGAGTAGGGGAGGTGG - Intronic
901815729 1:11792364-11792386 AAAACTCTAAGTAGGCCTGTGGG + Exonic
901881953 1:12199260-12199282 CAGGCTCAGAGCAGGGCTGGGGG + Intronic
901938775 1:12645972-12645994 CAGGCTCTGAGCAGGGCTTGGGG + Intronic
902117887 1:14136892-14136914 CAAGCTTTCAGTGGGGCTGGGGG + Intergenic
904255114 1:29249784-29249806 TAAGCCATGAGTAGGGCAGGTGG - Intronic
906643598 1:47457249-47457271 AAACCTCTGAGTGGGGATTGGGG - Intergenic
908271963 1:62430920-62430942 ATAGCTCTGAGTAGGGAGGAGGG + Intergenic
908897390 1:68915607-68915629 AAAGCTTTAGTTAGGGCTGGTGG - Intergenic
909585472 1:77282928-77282950 AAAGCGCAGAGCAAGGCTGGGGG - Intronic
910552075 1:88486520-88486542 AAGTCTCTGAGTAGGGGTAGGGG - Intergenic
911236607 1:95418976-95418998 GAAGCTCTTAGTGGGACTGGTGG + Intergenic
911912398 1:103652909-103652931 ACGGCTCTGAGTAGAGATGGAGG - Intergenic
911916056 1:103699039-103699061 ACGGCTCTGAGTAGAGATGGAGG + Intronic
911919812 1:103747047-103747069 ACGGCTCTGAGTAGAGATGGAGG - Intronic
912775229 1:112502536-112502558 AAACCTCAGAGAAGGGCTGGAGG + Intronic
913323723 1:117607842-117607864 AAACCTCTGAGCTGGGCTGCAGG + Intronic
915032574 1:152896117-152896139 GAGGCTATGAATAGGGCTGGAGG + Intergenic
916211923 1:162366767-162366789 AAGGCTCTGAATAGGGTTAGTGG - Intronic
917048821 1:170894303-170894325 AAAGCTATGAGAAAGACTGGTGG + Intergenic
918967465 1:191370230-191370252 AAAGCTCTGAAAAGGGCAGAAGG + Intergenic
919746249 1:201010793-201010815 ACAGCTCTGAGTGGGCCTTGGGG - Intronic
920082295 1:203383642-203383664 AAAGCTCTGAGTGGGACTGCAGG - Intergenic
920111864 1:203592580-203592602 AAATCCCTAAGTAAGGCTGGGGG + Intergenic
920179822 1:204125772-204125794 CATGCTCTGAGGAGGCCTGGAGG + Intronic
920252576 1:204631457-204631479 AAAGTTATGAGGAGGGCAGGTGG + Intronic
920518205 1:206602307-206602329 AAAGCACTGATGTGGGCTGGAGG - Intronic
1065069105 10:22003676-22003698 ACAGCTGTGTGTAGGCCTGGGGG - Exonic
1067508951 10:46879155-46879177 AAAGGACTGAGGAAGGCTGGGGG - Intergenic
1067653301 10:48172695-48172717 AAAGGACTGAGGAAGGCTGGGGG + Intronic
1068091700 10:52440343-52440365 ACAGTTCTGAGAGGGGCTGGGGG - Intergenic
1068836369 10:61558882-61558904 AAAGGTCAGAGTAGGTATGGAGG + Intergenic
1068875739 10:61994623-61994645 AATCCTCAGAGTTGGGCTGGGGG - Intronic
1069573595 10:69509006-69509028 CAAGCTCTGTGTCTGGCTGGAGG + Intergenic
1069801084 10:71082007-71082029 AAGGCTCTGAGAAGGTCTGCAGG + Intergenic
1070889388 10:79930746-79930768 GGAGCTCTGGGCAGGGCTGGAGG - Intergenic
1074199625 10:111223293-111223315 GAATCACTGAGTAGGGCTAGTGG + Intergenic
1074456638 10:113601256-113601278 AAAGCTCTGGGTAGGGCCAGAGG - Intronic
1075730473 10:124632541-124632563 AAGGCTCTCAGAGGGGCTGGTGG + Intronic
1076091503 10:127690175-127690197 AAAGCTCTACTGAGGGCTGGTGG + Intergenic
1076284404 10:129278820-129278842 AAGGCTCTGGGGAGGGCAGGAGG + Intergenic
1077174952 11:1184855-1184877 GGTGCTCTGAGTTGGGCTGGTGG - Intronic
1077175519 11:1188173-1188195 AGTGCTCTGAGTTGGGCTGGTGG - Intronic
1077175677 11:1189067-1189089 GGTGCTCTGAGTTGGGCTGGTGG - Intronic
1077175910 11:1190366-1190388 AGTGCTCTGAGTTGGGCTGGTGG - Intronic
1078615789 11:12864474-12864496 AAAGCTTAGAGCAGCGCTGGGGG + Intronic
1080696809 11:34609820-34609842 AAGGCTTTGAGGAGGTCTGGAGG - Intergenic
1081613424 11:44577009-44577031 AGAGCTCTTAGCTGGGCTGGTGG + Intronic
1081827397 11:46070084-46070106 AAAGGACTGGGTAGGGATGGGGG - Intronic
1082259433 11:50066697-50066719 AAGGCTCTGAGGCTGGCTGGAGG - Intergenic
1082870609 11:57941351-57941373 AATGCTGTGAGCAAGGCTGGGGG - Intergenic
1084659548 11:70538788-70538810 AAAGCACTGGGTGGGGCGGGAGG + Intronic
1084774658 11:71367554-71367576 AAGACTCTGAGCAGGGCAGGAGG + Intergenic
1084961813 11:72720881-72720903 AAAGCTGAGTGTAGGTCTGGTGG - Intronic
1085012218 11:73149082-73149104 AATCCTCAGAGTGGGGCTGGAGG - Intergenic
1088727640 11:112653696-112653718 AAAGGTCTGAATAGGGCTTTGGG - Intergenic
1088840810 11:113626200-113626222 AAAACTCTGTGTAGAGATGGGGG - Intergenic
1088997951 11:115019800-115019822 AAAGCTCTGGGGAGGGGTGAGGG - Intergenic
1089682491 11:120126711-120126733 GAAGCTCAGAGAAGGGCAGGTGG - Intronic
1090289393 11:125528611-125528633 AAACCTCTGGGAAGGGGTGGGGG + Intergenic
1090731383 11:129575711-129575733 AAAGCTGTGAGATGGGGTGGGGG - Intergenic
1096020263 12:48318384-48318406 AAAGCTATGACTGGGACTGGTGG + Intergenic
1096196358 12:49651347-49651369 AGGGCTCTGGGCAGGGCTGGTGG - Intronic
1096387491 12:51204426-51204448 AAAGCTCTGGGTATGGTTTGGGG + Intronic
1096602552 12:52740316-52740338 AGAGCACTGAGGATGGCTGGGGG + Intergenic
1097156466 12:57015741-57015763 AAAGCTCTGAGCTAGGCTGAAGG + Exonic
1098463511 12:70760399-70760421 AAAGCTCTGGGTGGGCATGGTGG - Intronic
1098817172 12:75182230-75182252 AAAGCACTGACTATGGCCGGGGG + Intronic
1101568552 12:105932507-105932529 ACAGCTCTGAGTAGGCGGGGTGG + Intergenic
1101912151 12:108868069-108868091 AAAGGCCTGACTGGGGCTGGAGG - Intronic
1102034572 12:109763484-109763506 AAAGGCCTGACTGGGGCTGGAGG + Intronic
1102077830 12:110073977-110073999 CAATCTCTGAGTGGGGCTTGAGG - Intergenic
1103051111 12:117780597-117780619 AAAGCTCTGAAGATGGATGGTGG + Intronic
1104884751 12:132100258-132100280 GAGGCTCTGACTAGGGCTGTGGG + Intronic
1105617058 13:22028590-22028612 TGAACCCTGAGTAGGGCTGGTGG + Intergenic
1110413965 13:75232332-75232354 AAATCTCAGAGTTGGGCAGGGGG - Intergenic
1114539096 14:23441749-23441771 AAAGATTAAAGTAGGGCTGGAGG + Intergenic
1117508148 14:56423034-56423056 AGAGATCTGAAGAGGGCTGGAGG - Intergenic
1118609351 14:67528068-67528090 TCAGCTCTGAGATGGGCTGGTGG + Intronic
1118993029 14:70812735-70812757 AAGGTTTTGAGTAGGGCTGTGGG + Intergenic
1120540599 14:85745732-85745754 AAAGCTCTGCAGAGGGATGGTGG + Intergenic
1121233993 14:92379349-92379371 AAAGCTCTGAAGAGGGATGTTGG + Intronic
1122378514 14:101285490-101285512 CAAGCTCTGAGCTGGGCTGCAGG + Intergenic
1202845578 14_GL000009v2_random:170408-170430 AAAGCTCTGAGTCTGGCTACTGG - Intergenic
1202914977 14_GL000194v1_random:160678-160700 AAAGCTCTGAGTCTGGCTACTGG - Intergenic
1125276994 15:38003887-38003909 ACACCGCTGAGTAGAGCTGGTGG + Intergenic
1125546702 15:40511555-40511577 CAAGCTCCGAGGCGGGCTGGGGG + Intergenic
1126689291 15:51275372-51275394 AAAGCTCTGAGTAGGGCTGGAGG - Intronic
1128545120 15:68561403-68561425 CTTGCTCTGAGTGGGGCTGGGGG - Intergenic
1128891808 15:71338271-71338293 GAAGCTCAGAGTGGGGCGGGGGG - Intronic
1128943163 15:71805008-71805030 AAAGGTCTAAGCAGGGCTGGCGG - Intronic
1129569670 15:76667377-76667399 AAAGCTCTGAGTATAGCTCTGGG - Intronic
1130131601 15:81147956-81147978 AATGCTGTGATTGGGGCTGGGGG + Intronic
1130136393 15:81185068-81185090 GAGGCTCTGCATAGGGCTGGAGG + Intronic
1132261944 15:100433568-100433590 AGAGCTCTCTGTAGGGTTGGTGG + Intronic
1132939837 16:2501190-2501212 CCAGCTCTGGGTGGGGCTGGGGG - Exonic
1133239274 16:4404882-4404904 AAAGGCCAGAGTAGGGCAGGTGG - Intronic
1133957974 16:10463586-10463608 AAAGGTCTGACCAGGGCTGGGGG - Intronic
1134602643 16:15545546-15545568 AAGGCTATGAGTGGGGATGGGGG + Intronic
1135313355 16:21422456-21422478 AGTGCTCAGATTAGGGCTGGAGG - Intronic
1135366279 16:21854734-21854756 AGTGCTCAGATTAGGGCTGGAGG - Intronic
1135445536 16:22516430-22516452 AGTGCTCAGATTAGGGCTGGAGG + Intronic
1136152502 16:28360176-28360198 AGTGCTCAGATTAGGGCTGGAGG - Intronic
1136194244 16:28641005-28641027 AGTGCTCAGATTAGGGCTGGAGG + Intronic
1136210579 16:28755105-28755127 AGTGCTCAGATTAGGGCTGGAGG + Intronic
1136310022 16:29401157-29401179 AGTGCTCAGATTAGGGCTGGAGG - Intronic
1136323466 16:29502961-29502983 AGTGCTCAGATTAGGGCTGGAGG - Intronic
1136438151 16:30242930-30242952 AGTGCTCAGATTAGGGCTGGAGG - Intronic
1139243232 16:65415851-65415873 ATATTTCTGAGTAGGGATGGTGG + Intergenic
1139857708 16:69993561-69993583 AGTGCTCAGATTAGGGCTGGAGG - Intergenic
1140924599 16:79570301-79570323 AAAGAGCTGAGGAGGGATGGGGG - Intergenic
1141134400 16:81456263-81456285 AAAGGTCTGAGAATGACTGGAGG - Intronic
1141922342 16:87144412-87144434 AATGCTCTGAGAAGGCCTGCGGG - Intronic
1142896212 17:2980745-2980767 AAAGGGCTGAGTTGGGCTGAAGG + Intronic
1143112937 17:4562922-4562944 AGGGCTCAGAGTAGGGGTGGGGG + Intergenic
1144658228 17:17051670-17051692 AGAGCTCTGGGTAGGGCATGGGG - Intronic
1145239787 17:21233920-21233942 AAAGCTCTCATTAGGGAAGGGGG + Intergenic
1145957020 17:28861645-28861667 AAAGCACTGTGAGGGGCTGGGGG + Intergenic
1146765779 17:35520235-35520257 AAAGCTGTAGTTAGGGCTGGTGG - Intronic
1148809436 17:50280601-50280623 AAAGCTCTCAGGAGGATTGGAGG + Exonic
1149636019 17:58170069-58170091 TCAGCTCTGGGTGGGGCTGGTGG + Exonic
1151404051 17:73875422-73875444 ACAACTCTGAGTTGGACTGGAGG + Intergenic
1151920796 17:77153758-77153780 AGAGCTCTGGATAGGGCTGTTGG + Intronic
1152375306 17:79915763-79915785 AAGGCTCTGGGTATAGCTGGGGG + Intergenic
1152792657 17:82290297-82290319 AAAGCTCTAGTTACGGCTGGTGG + Intergenic
1153551266 18:6263796-6263818 AAAGCTCTGATTAGGTTTGTGGG + Intronic
1153792681 18:8594452-8594474 AATGCTTTGAGTTGGTCTGGTGG + Intergenic
1154119150 18:11636814-11636836 AGTGCTCAGATTAGGGCTGGAGG - Intergenic
1154268586 18:12899956-12899978 AAAGCTCTGAGTGTAACTGGAGG - Intronic
1155168675 18:23250822-23250844 AAAACTCTGAACAGGTCTGGTGG + Intronic
1157989824 18:52481469-52481491 AAATCTGCGAGTAGGGCCGGGGG - Intronic
1158162352 18:54499532-54499554 AGAGCTGGGAGTAGGGATGGGGG + Intergenic
1158426495 18:57344745-57344767 AAAGCTCTGAGTCCTGTTGGAGG - Intergenic
1159629339 18:70731339-70731361 AAAGCTCTTTGTATGGCTGTGGG + Intergenic
1161457444 19:4376637-4376659 AAAGCTCTGAGGGGAGATGGGGG - Intronic
1161703506 19:5807010-5807032 GAAGCTCAGAGTGGGGATGGAGG + Intergenic
1163698068 19:18774027-18774049 ATAGCTCTGAGAATGGCTGTGGG + Intronic
1164778573 19:30873727-30873749 AAGGATCTGAGCAGGGCTGGTGG + Intergenic
1166020871 19:40027901-40027923 CAAACTCTGGGTGGGGCTGGGGG + Intergenic
1166701613 19:44885603-44885625 AAAGATCTGTGTTGGGCTGGGGG - Intronic
1166777771 19:45323111-45323133 CAAGTGCTGAGTTGGGCTGGCGG + Intergenic
1166782899 19:45351616-45351638 GCAGCTCTGAGTGGGGCGGGTGG - Exonic
1166958089 19:46479334-46479356 GAAGAGCTGAGAAGGGCTGGTGG + Intergenic
1168181314 19:54664547-54664569 AGAGCTCTGGGCAGGGATGGAGG + Intronic
925125739 2:1454546-1454568 GAAGCCCTGGGTAGAGCTGGAGG + Intronic
926114612 2:10204530-10204552 ACAGCGCTGAGCAGGGCTGGCGG - Intronic
927199567 2:20569973-20569995 AAAGCCCTGGGCAGGGCTGGGGG - Intronic
927668651 2:25050426-25050448 AAAGCTCTGTGTGGGGGTGCAGG + Intronic
928206479 2:29288175-29288197 ACAGGTCTGAGTAGGGCAGGGGG + Intronic
929133365 2:38600794-38600816 ATGGCACTGAGTAGGGCTTGGGG - Intronic
929961165 2:46497473-46497495 ACATCTCAGAGCAGGGCTGGGGG + Intronic
931860223 2:66346683-66346705 TAAGCCCTGAGTAGGGCTTGGGG + Intergenic
931906073 2:66845438-66845460 ATAGCTCTGAGTAATGCAGGGGG + Intergenic
932179161 2:69630317-69630339 AATACTCTGAGTGGGGCGGGGGG + Intronic
932398822 2:71466051-71466073 AAGGCTCCGAGGAGGGTTGGTGG + Intronic
932463940 2:71901406-71901428 AAAGGTTTGACTAGGGCTGGAGG + Intergenic
933262216 2:80143196-80143218 AAAGTTCTGAGGAAGGCTGTTGG - Intronic
934949628 2:98567437-98567459 AAAGGTGTGAGCAGAGCTGGAGG + Intronic
936012510 2:108933950-108933972 GAGGCTCTCAGCAGGGCTGGAGG + Intronic
937070824 2:119061785-119061807 AAAGGTATGAGTTGCGCTGGGGG + Intergenic
937237336 2:120438674-120438696 AAGGCTCTGAGCAGGGCAGAGGG - Intergenic
937354434 2:121189199-121189221 ACTGCTCTGTGGAGGGCTGGTGG - Intergenic
938316070 2:130328976-130328998 AAGGCTGAGAGAAGGGCTGGTGG - Intergenic
938973890 2:136457461-136457483 AACCCTCTGGGTTGGGCTGGTGG + Intergenic
939729335 2:145762839-145762861 TAAGCTCTGAATAGGCCTGAAGG + Intergenic
941932458 2:170955720-170955742 AAAGCCCTGATTAGGGCCAGTGG - Intronic
942116468 2:172734550-172734572 AAAGCCCTGAGCAGGGAGGGAGG + Intergenic
946540222 2:220676113-220676135 AATGGGCTGAGTAAGGCTGGAGG + Intergenic
948268630 2:236656980-236657002 CAGGCTCTGAGTAGGGCTTGGGG + Intergenic
948717091 2:239872000-239872022 CAGGCTCTGAGTAGGGCTGGGGG - Intergenic
948890331 2:240904330-240904352 ACGGCTCTCAGGAGGGCTGGTGG - Intergenic
1168986538 20:2053836-2053858 GAAGGTGTGAGTGGGGCTGGAGG + Intergenic
1169068637 20:2708301-2708323 AAAGCTCAGGGGAGGGCTGCTGG + Intronic
1170390252 20:15865618-15865640 AAAGCTTTGAAAAGGGTTGGGGG + Intronic
1172794247 20:37526285-37526307 AAATCTCTGAGGGGGGGTGGGGG - Intronic
1172880060 20:38193985-38194007 AGAGCTCAGGGCAGGGCTGGGGG - Intergenic
1175513095 20:59547895-59547917 AAAGCAGTGGGTAGGGCTGCAGG - Intergenic
1175921508 20:62452523-62452545 GAAGGACTGAGGAGGGCTGGGGG - Intergenic
1176634326 21:9175323-9175345 AAAGCTCTGAGTCTGGCTACTGG - Intergenic
1179785586 21:43728069-43728091 TGTGCTCTGAGCAGGGCTGGGGG + Intronic
1180199950 21:46218142-46218164 AGAGCTATCAGCAGGGCTGGGGG - Intronic
1181044813 22:20209525-20209547 GAAGCTCTGGGTCTGGCTGGTGG + Intergenic
1181582401 22:23835462-23835484 AGAGCTCTGATTAGGGATTGGGG + Intronic
1182395226 22:30030769-30030791 AAAGCTTTGAATGGGCCTGGAGG - Intronic
1183694652 22:39414890-39414912 AACCCTCTGTGTAGGGCTGCGGG + Intronic
1184382481 22:44154096-44154118 ACACCTCTGAGAAGGGCTGTGGG - Intronic
1184536054 22:45087746-45087768 AAAGCTGGAATTAGGGCTGGTGG - Intergenic
950626898 3:14253843-14253865 AATGCTGTGAGTGTGGCTGGAGG + Intergenic
951375206 3:21906441-21906463 AAAGCTCAGAGTAGTTCTGAAGG - Intronic
951899422 3:27642213-27642235 AAAGCCCTGAGCAGGGCTGGAGG + Intergenic
952927851 3:38334889-38334911 TAAGCCCTGGGTAGGGCTGGAGG + Intergenic
953067029 3:39482874-39482896 AAGGCTCTGAGTTGGGGTTGGGG - Intronic
954673311 3:52302306-52302328 GATGCTCTGAGGAGGTCTGGAGG - Intergenic
955168799 3:56542400-56542422 AAAGCAGTGCGTAGGGCTGTAGG + Intergenic
955250700 3:57279405-57279427 AAAGGTATGTTTAGGGCTGGGGG + Intronic
955476315 3:59340084-59340106 AATGCTTTGAGTAGGGGTGGAGG + Intergenic
956090938 3:65666548-65666570 AAAGCTCTGAGAAGCCCTGAAGG + Intronic
956107013 3:65830102-65830124 AAAGATCTGGGCAGTGCTGGTGG - Intronic
956486585 3:69729353-69729375 GAAGGCCTGACTAGGGCTGGAGG + Intergenic
957037054 3:75303122-75303144 AAATCTTTGAGTAGGGGTGGAGG + Intergenic
957953346 3:87151760-87151782 AAAGGTCTGAATAGGGAAGGTGG - Intergenic
959591719 3:108089991-108090013 AAAGCTCGGGGTGGGGGTGGGGG + Intronic
961204912 3:125074350-125074372 AAAGCTCTGGGAAGGGAGGGAGG + Intergenic
961410318 3:126715696-126715718 AAGGCCCTGAGTATGGCTCGTGG - Intronic
964501619 3:157354387-157354409 AAAGCTGTCAGCAGTGCTGGTGG - Intronic
967855249 3:194112511-194112533 AAGGCTCTGATTAAGCCTGGGGG - Intergenic
968628165 4:1637370-1637392 GAGGCTCTGGGCAGGGCTGGAGG + Intronic
968751462 4:2391577-2391599 AAAGTTCTGGGGAGGGATGGTGG - Intronic
968970178 4:3789675-3789697 ACAGTTCTGAGCAGGACTGGTGG - Intergenic
969317685 4:6391751-6391773 GAAGCCCTGGGTGGGGCTGGAGG + Intronic
969389927 4:6885063-6885085 AAACCTCTGATTTTGGCTGGGGG + Intergenic
970772639 4:19633938-19633960 AAAGCACTGAGTAGGGAAAGAGG - Intergenic
974762039 4:66289638-66289660 AAAGCCCTTAGTAGTGCTGATGG - Intergenic
977243059 4:94597340-94597362 AAAGCTCTTAGCAGGGATGTTGG + Intronic
977418380 4:96764249-96764271 AAAGCTGTGAATGGGGTTGGAGG + Intergenic
978343496 4:107741392-107741414 AACACTCTGAGTTGGTCTGGTGG + Intergenic
979632844 4:122922729-122922751 AAATTGCTGAGAAGGGCTGGTGG - Intronic
980839688 4:138242458-138242480 AAAGAGCTGAGTAATGCTGGAGG - Intergenic
982073728 4:151718273-151718295 TAAGCTCTGGGTAGGGTTGTTGG + Intronic
986212781 5:5689911-5689933 AGTGATCTGAGTAGGGCAGGAGG + Intergenic
990168069 5:53017519-53017541 AAAGCTCTTTGTTGGGGTGGTGG + Intronic
992367703 5:76110207-76110229 AAAACAATGAGAAGGGCTGGTGG + Intronic
993443127 5:87980132-87980154 AAAGAAGTGAGTAGGGCTGTAGG - Intergenic
994451114 5:99945505-99945527 AAGGCCCTGAGTGGGGCGGGCGG - Intergenic
996415553 5:123206655-123206677 AAACCTCAGAGAAGGACTGGGGG - Intergenic
997095569 5:130906811-130906833 AAAGCTGAGAGTGGTGCTGGGGG + Intergenic
997162807 5:131626600-131626622 AAAGGTATGAGTAGGGCTTTGGG - Intronic
997566959 5:134895391-134895413 AGAGCACTGAGTATGCCTGGGGG - Intronic
998381898 5:141731719-141731741 AAAGCACTGAGTTGAGCTGCGGG - Intergenic
999305031 5:150513992-150514014 AAAGCTGGGACTAGGGCTAGGGG + Intronic
999884030 5:155900379-155900401 AAAACTGTGTGTAGGGTTGGGGG - Intronic
1001008258 5:168074089-168074111 ACAGCTCTGAGAAGGGCTGCTGG + Intronic
1002085911 5:176775221-176775243 AAAGCTCTGTGTGGTGTTGGTGG - Intergenic
1002534336 5:179867915-179867937 AAGGCTCTGCCCAGGGCTGGAGG - Intronic
1002858862 6:1062029-1062051 GAAGCTCAGAGAAGGCCTGGTGG - Intergenic
1003183408 6:3810801-3810823 AAAGCTATGACTTGGGATGGAGG - Intergenic
1003446779 6:6192133-6192155 AAAAATCTCAGTATGGCTGGAGG + Intronic
1004035185 6:11916835-11916857 AAAGCTGTGAGTGGGAATGGGGG - Intergenic
1004351990 6:14898192-14898214 AAAGCTGGAAGTAGGGCTGTAGG - Intergenic
1007078138 6:39080741-39080763 TAAGCTCTGAGGAGGGACGGTGG + Intronic
1007182739 6:39942116-39942138 GAAGCTGTGACTAGGTCTGGAGG - Intergenic
1007568945 6:42875237-42875259 AAAGCTCTGAGCCAGGTTGGTGG - Intergenic
1013198539 6:107867546-107867568 ATAGAGCTGAGTAGGTCTGGAGG - Intergenic
1013298619 6:108781954-108781976 TAGGCTCTGTGAAGGGCTGGGGG + Intergenic
1014804754 6:125816771-125816793 AATGCTCTGAATAAGGCTGGTGG - Intronic
1015953613 6:138578200-138578222 AAAGGTGGGAGTTGGGCTGGTGG - Intronic
1017975524 6:159353512-159353534 AAATCTCAGACAAGGGCTGGAGG + Intergenic
1019430991 7:999642-999664 AGGGCTGTGAGTGGGGCTGGTGG + Intronic
1019492350 7:1321376-1321398 ACAGCTTTGCCTAGGGCTGGTGG + Intergenic
1021462277 7:20901883-20901905 AATGCTCTGTGTTTGGCTGGTGG + Intergenic
1021896160 7:25237979-25238001 AACCCTCTGAGAAGTGCTGGGGG + Intergenic
1022971330 7:35520074-35520096 AAAGCTCTGAGAAGTTCTGTAGG - Intergenic
1025175213 7:56796668-56796690 GAAGCTCTGAGGCTGGCTGGAGG - Intergenic
1025696588 7:63779746-63779768 GAAGCTCTGAGGCTGGCTGGAGG + Intergenic
1026804842 7:73423479-73423501 AAAACTTAGTGTAGGGCTGGGGG + Intergenic
1026890194 7:73977339-73977361 GCAGCTCTGAGCAGGGCTGGGGG - Intergenic
1031763758 7:125748107-125748129 AAGACTCTGAGTAGTACTGGGGG - Intergenic
1034492087 7:151398914-151398936 AAAGAAGAGAGTAGGGCTGGGGG - Intronic
1037583476 8:20260796-20260818 AATGCTCTCAGGAGGACTGGAGG - Intronic
1038421748 8:27438170-27438192 CAAGCTCTGAGCAAGGTTGGGGG - Intronic
1038446256 8:27606306-27606328 AAGGCTCTGAGTGGGGAAGGAGG - Intronic
1039071028 8:33649492-33649514 AAAGCTTTGGTTATGGCTGGTGG + Intergenic
1039422321 8:37453575-37453597 AACGCGCTGAGAAGAGCTGGAGG + Intergenic
1039533218 8:38283431-38283453 AGAGCTATGAGAAGGGCTAGTGG - Intronic
1039838264 8:41275197-41275219 AAAGCTCTGGGTAGGGAAGCAGG - Intronic
1045097996 8:98818069-98818091 AAAGCTATGAGAAGGCCTGGAGG - Intronic
1046900212 8:119515800-119515822 ACAGCACTGACTAGGGCTGTTGG - Intergenic
1046954455 8:120048252-120048274 AAAGCTCTGGGTTGGGAAGGAGG + Intronic
1048627618 8:136203033-136203055 TAAGCTCTGAGCTGGGCTGAAGG - Intergenic
1048974010 8:139661299-139661321 AAAGCGCTGAGTTGGGGTGGGGG - Intronic
1049236692 8:141515673-141515695 AAAGATGTGAGGAGGGGTGGAGG - Intronic
1052798600 9:32946722-32946744 AAAGCTCCAAGGAGGTCTGGTGG - Intergenic
1054869026 9:70032166-70032188 AAAGTTCTGAGTAAAGATGGTGG - Intergenic
1055004021 9:71484870-71484892 GTAGATCTGAGTAGGGCTTGAGG + Intergenic
1056778040 9:89528292-89528314 AAAGGTATGAATGGGGCTGGAGG + Intergenic
1056817636 9:89813015-89813037 AATGCCCTGGGCAGGGCTGGGGG - Intergenic
1058374014 9:104302936-104302958 AAAGCTTAAAGTAGGACTGGGGG - Intergenic
1058726611 9:107810654-107810676 AAAGGTCTGAGTAGGGGAGAAGG + Intergenic
1059590274 9:115651536-115651558 AGAGCTCTGGGTATAGCTGGAGG + Intergenic
1059623203 9:116032102-116032124 GAGGGTCTGAGGAGGGCTGGGGG - Intergenic
1059765183 9:117377254-117377276 AGGGCTCTGAATAGGGCAGGAGG + Intronic
1059997842 9:119930506-119930528 AAAGCTCTGTGTATTGATGGAGG - Intergenic
1060127232 9:121059860-121059882 AAAGGCATGACTAGGGCTGGAGG - Intergenic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1061234749 9:129335886-129335908 AAAGCCCAGAGCAGGGATGGGGG - Intergenic
1061772341 9:132935634-132935656 AAAGCACTGAGTGGGCCTGCAGG + Intronic
1061874002 9:133534972-133534994 ACTGCTCAGAGTGGGGCTGGGGG + Intronic
1203757166 Un_GL000218v1:142962-142984 AAAGCTCTGAGTCTGGCTACTGG - Intergenic
1203650780 Un_KI270751v1:119191-119213 AAAGCTCTGAGTCTGGCTACTGG - Intergenic
1186555165 X:10550434-10550456 ACTGCTCAGAGTTGGGCTGGGGG + Intronic
1189225186 X:39406886-39406908 AATTATCTGAGTAGAGCTGGGGG - Intergenic
1190234735 X:48606605-48606627 AAAGCTTTGAGTATTGATGGGGG + Exonic
1192502874 X:71664976-71664998 AAATTTCTGAGTCGGGCTGGCGG + Intergenic
1192529216 X:71871484-71871506 AAATTTCTGAGTCAGGCTGGTGG + Intergenic
1194634481 X:96327619-96327641 ATGGCTCTGGGTAGGGATGGAGG - Intergenic
1196855962 X:119984563-119984585 AACGCTTTGAGTTGGTCTGGTGG - Intergenic
1198666493 X:139029660-139029682 AGAGCTAAAAGTAGGGCTGGAGG + Intronic
1198963399 X:142205011-142205033 AAGACACTGAGGAGGGCTGGGGG - Intronic
1201343474 Y:12958073-12958095 AATGGTTTGAGTAGAGCTGGGGG - Intergenic