ID: 1126691580

View in Genome Browser
Species Human (GRCh38)
Location 15:51292905-51292927
Sequence ATTCTCTGCTTGGCATTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126691574_1126691580 -3 Left 1126691574 15:51292885-51292907 CCCAAACACCAGGTGCTCTGATT 0: 1
1: 0
2: 1
3: 14
4: 208
Right 1126691580 15:51292905-51292927 ATTCTCTGCTTGGCATTGAGGGG 0: 1
1: 0
2: 1
3: 10
4: 186
1126691573_1126691580 -2 Left 1126691573 15:51292884-51292906 CCCCAAACACCAGGTGCTCTGAT 0: 1
1: 0
2: 0
3: 21
4: 177
Right 1126691580 15:51292905-51292927 ATTCTCTGCTTGGCATTGAGGGG 0: 1
1: 0
2: 1
3: 10
4: 186
1126691575_1126691580 -4 Left 1126691575 15:51292886-51292908 CCAAACACCAGGTGCTCTGATTC 0: 1
1: 0
2: 2
3: 38
4: 813
Right 1126691580 15:51292905-51292927 ATTCTCTGCTTGGCATTGAGGGG 0: 1
1: 0
2: 1
3: 10
4: 186
1126691571_1126691580 21 Left 1126691571 15:51292861-51292883 CCTTTAGTGGACACAGGTCTGGT 0: 1
1: 0
2: 1
3: 8
4: 229
Right 1126691580 15:51292905-51292927 ATTCTCTGCTTGGCATTGAGGGG 0: 1
1: 0
2: 1
3: 10
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126691580 Original CRISPR ATTCTCTGCTTGGCATTGAG GGG Intronic
900357876 1:2273433-2273455 CTTCTCAGCTTGGCATGGGGAGG + Intronic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
904306741 1:29594813-29594835 AGTCTGTGCTTTCCATTGAGAGG + Intergenic
907514452 1:54984608-54984630 ATTATATGCTAGGCACTGAGGGG + Intronic
908026399 1:59956762-59956784 ATTATCTGTTTTTCATTGAGTGG + Intergenic
908498260 1:64717069-64717091 TTTATGTGCTGGGCATTGAGGGG - Intergenic
909976219 1:82048599-82048621 ATTATCAGCTAGGTATTGAGGGG - Intergenic
917188173 1:172385351-172385373 TTTATTTGCTTGGCAATGAGGGG - Intronic
920384650 1:205562235-205562257 GTTATGTGCTTGGCATGGAGTGG + Intergenic
923568754 1:235095856-235095878 ATTCTCTGCATTGCCTTGTGGGG - Intergenic
923592512 1:235331465-235331487 TTTGTCTGCTTGGCATTAAAGGG + Intronic
924384971 1:243491939-243491961 ATTCTCTTCTGGGTATTAAGTGG - Intronic
1063241119 10:4170215-4170237 ATTCTCACCTGGGCATAGAGAGG + Intergenic
1064815635 10:19258813-19258835 ATTCACTTTTAGGCATTGAGAGG - Intronic
1066411954 10:35180493-35180515 ATTCTCTGTTGGTAATTGAGGGG + Intronic
1068425382 10:56854763-56854785 ATTATCTGCTTATCTTTGAGAGG + Intergenic
1068865002 10:61885642-61885664 ATTCTGTGCTTGGGATTAATTGG - Intergenic
1070408490 10:76117571-76117593 ATTCTCTTCTTGGCCTGGAAAGG - Intronic
1072554895 10:96507176-96507198 AGGCTCTGCTTGGCATTGGATGG + Intronic
1073023230 10:100464956-100464978 TTTCTCTGCATGGCATAAAGGGG - Intronic
1074245495 10:111687145-111687167 TTTTTCTGCTTGGCATAGAGGGG + Intergenic
1075464554 10:122641921-122641943 ATTCTCTGTTTGGCCTGGTGGGG + Intronic
1075533565 10:123251171-123251193 ATGCTCTGCTTGTCTTAGAGTGG + Intergenic
1075686016 10:124365672-124365694 ATGGTCAGCTTGGCATGGAGAGG + Intergenic
1080764716 11:35284946-35284968 ATTCTCTGGTAGGCCTTTAGTGG - Intronic
1083580464 11:63821569-63821591 AAACTATGCTTGGCATGGAGAGG - Intronic
1083739045 11:64698088-64698110 ATTCTCTGTGTGACCTTGAGTGG - Intronic
1085549885 11:77359241-77359263 ATTCACAGCTAGGCTTTGAGTGG - Intronic
1085986300 11:81792369-81792391 ATTCTCTGCTTAGATTTCAGAGG - Intergenic
1090165137 11:124538493-124538515 ATTTTCTTCTTGACTTTGAGTGG - Intergenic
1090923985 11:131233627-131233649 GTTCTGTGCTAGGCACTGAGTGG + Intergenic
1099106534 12:78503653-78503675 ATTTCCTTCTTGGCATTGAATGG - Intergenic
1099834598 12:87893460-87893482 ATTCTTTGAATGGAATTGAGAGG - Intergenic
1100101312 12:91108939-91108961 ACTCTCTTCCTGGCATTGATTGG - Exonic
1101845383 12:108359198-108359220 AATTTCTGCTTGGCAAGGAGGGG - Intergenic
1102686558 12:114729331-114729353 ATTCTCTGATTGGAATGGAAAGG + Intergenic
1103909672 12:124345329-124345351 TTTTTCTGCTTGGCATTGGGTGG - Intronic
1104406564 12:128522445-128522467 AGTCTCTTCTTGGCATTGCTTGG + Intronic
1105738087 13:23293009-23293031 ATTTCCTGCTTGGCATAGAGAGG - Intronic
1110265840 13:73536579-73536601 ATTCTCTGCCTGGCATTTGTTGG - Intergenic
1110832742 13:80050314-80050336 ATTCTCTCCTTGGGATAGATGGG + Intergenic
1112095857 13:96130996-96131018 ATACTCTGCTTGGTAGTGGGAGG - Intronic
1112802430 13:103127171-103127193 AATCTCTGCTTGGCAAACAGAGG - Intergenic
1113130297 13:107029113-107029135 GTTCTCTGCCTGGAACTGAGCGG - Intergenic
1113262887 13:108585353-108585375 ATTTTCTGGTTGACATTGATTGG + Intergenic
1113947122 13:114050614-114050636 GCTCTCTGCCTGGCATTGAGAGG - Intronic
1114010650 14:18363617-18363639 ATGCTCTTCTTGGCACTGTGTGG + Intergenic
1114936815 14:27548989-27549011 TTTCACAGGTTGGCATTGAGTGG - Intergenic
1115701021 14:35953124-35953146 ATTCTCTATTTGGCAATGATGGG + Intergenic
1115939647 14:38594119-38594141 ATGCTCTGCATTCCATTGAGAGG + Intergenic
1116677352 14:47922742-47922764 ATTCTCTGCTTATCTTTGAGAGG + Intergenic
1117441049 14:55759625-55759647 AATCTCAGCTTAGCTTTGAGGGG + Intergenic
1118629982 14:67694040-67694062 ATTCTCTTCTTGGCAATGTTGGG + Intronic
1125369401 15:38954806-38954828 ATTCTATGCTAGGCATTGCTTGG - Intergenic
1125506046 15:40268219-40268241 GGTCTCAGCTTGCCATTGAGAGG - Intronic
1126691580 15:51292905-51292927 ATTCTCTGCTTGGCATTGAGGGG + Intronic
1126883200 15:53121435-53121457 ATTTTTTGATTGGCATTGACTGG + Intergenic
1126960144 15:53983668-53983690 ATTCTCCATTTGGCCTTGAGTGG + Intergenic
1128660056 15:69493534-69493556 TTTCTCTGCTTGGCATTTCAGGG + Intergenic
1130092764 15:80835138-80835160 TTTCTTAGCTTGGCATTCAGTGG + Intronic
1130300367 15:82676017-82676039 AGTCTCTGCTTGGGCTTGGGTGG - Intronic
1130301868 15:82686243-82686265 ATTATCTGCTTGCCAGTCAGAGG + Intronic
1130929482 15:88412808-88412830 CTTCTCTGCCTGTCATTGGGAGG - Intergenic
1132163378 15:99563912-99563934 GTTCTCTGCTTGACATTTTGAGG + Intergenic
1133908913 16:10047070-10047092 GTTCTCTGTTTGGCAATGTGTGG - Intronic
1134022667 16:10932041-10932063 ATTCTCTGCTATGGACTGAGTGG - Exonic
1134031203 16:10993868-10993890 ACATGCTGCTTGGCATTGAGAGG + Intronic
1134303904 16:13014954-13014976 ACCCTCTGCTGGACATTGAGTGG - Intronic
1137552002 16:49443875-49443897 GTGCTCTGCTTGGCATTGTAAGG - Intergenic
1138528355 16:57621466-57621488 ATTCTGTGCTGGGCACTGATGGG + Intronic
1139024878 16:62804375-62804397 ATTCAGTGCTTGCCAATGAGAGG + Intergenic
1139152956 16:64406641-64406663 GTTCTCTGCTAGGCATTTGGAGG + Intergenic
1140746268 16:77983067-77983089 ATTCCCAGCTTGGCATTCAGCGG - Intergenic
1141847907 16:86623416-86623438 ATTCCCAGATTCGCATTGAGTGG - Intergenic
1142416641 16:89946865-89946887 ATCCTCAGCCTGGCAGTGAGAGG - Intergenic
1144364087 17:14525382-14525404 ATGCTCTACTTGGCATTTATAGG + Intergenic
1144702296 17:17347579-17347601 ACTCTCTGCTGGGCCCTGAGCGG - Exonic
1145224962 17:21120599-21120621 ATTCTCAGCCAGGCACTGAGTGG - Intergenic
1148836753 17:50469559-50469581 CTTCTCTGCTTAGCCTTCAGCGG - Intronic
1150734530 17:67725189-67725211 TGTCTATGCTTGGCATTGAATGG + Intronic
1155980246 18:32172017-32172039 TTTCTCTGCTGGGCATTGATTGG + Intronic
1157558301 18:48627923-48627945 ATTCTCTACATAGCATTCAGAGG - Intronic
1157727680 18:49977531-49977553 ATTCTGTGCCTGGCACTGTGAGG + Intronic
1161010672 19:1958154-1958176 CTGCTCTGCCTGGAATTGAGGGG + Intronic
1161210786 19:3064270-3064292 GTTCTCTGCGTGGCAGAGAGAGG - Intergenic
1162249805 19:9432459-9432481 TTTCTCTGTTTGGCACTTAGGGG - Intronic
1164952007 19:32345158-32345180 ATTCGCAGCTTGGCGTTAAGGGG - Intergenic
925190668 2:1880781-1880803 ATGCTCTGCTTTTCATGGAGAGG - Intronic
925463856 2:4088899-4088921 ATTCTCTGCTTGGCAGGGTCAGG + Intergenic
928277227 2:29913844-29913866 ATTCTCCACTTGGCAATGAAGGG + Intronic
929648812 2:43657116-43657138 TTACTCTGTTTGGCATTGAATGG + Intronic
930524496 2:52510618-52510640 ATGCTCTGCTGGGCCCTGAGTGG + Intergenic
931233711 2:60395716-60395738 TTTGTCTGCATGGCATTGTGGGG - Intergenic
933950739 2:87327020-87327042 ATTCCCTGCTTTACACTGAGAGG - Intergenic
934206938 2:89938843-89938865 ATGCTCTGCTTGGCTGTGTGGGG - Intergenic
936329039 2:111531558-111531580 ATTCCCTGCTTTACACTGAGAGG + Intergenic
938814343 2:134884589-134884611 ATTGTCTGCTTGGTATTCACTGG - Intronic
939857223 2:147373885-147373907 AATCCCTGTTTGGCATAGAGTGG + Intergenic
943044998 2:182849983-182850005 TTTCAATACTTGGCATTGAGTGG - Intronic
943893632 2:193323894-193323916 CTTCTCTGCTTGGCATGAACTGG - Intergenic
945320241 2:208413022-208413044 ATTATCTGAGTGGGATTGAGAGG - Intronic
948357295 2:237389144-237389166 ATTCTCTGTTTGCCATTATGGGG - Intronic
1172906332 20:38372680-38372702 GCTCTCTGCTTGGCATATAGTGG + Intronic
1173728746 20:45314176-45314198 ATTCTCTGCATGGATCTGAGGGG - Intronic
1175935832 20:62513632-62513654 CTGCCCTGCTTGGCATTGTGTGG + Intergenic
1178673295 21:34611060-34611082 ATTCACTGCTTGGAAATGAACGG + Intronic
1180435143 22:15294420-15294442 ATGCTCTTCTTGGCACTGTGTGG + Intergenic
1182482839 22:30620817-30620839 TTTCTCTGCTGTGCATTCAGGGG - Intronic
1182677358 22:32050076-32050098 ATTTTCTTCTTGGCTTTGGGTGG + Intronic
1182932636 22:34189685-34189707 CTTTTCTGCTTGGAATGGAGGGG + Intergenic
1183784624 22:40022215-40022237 ATTCCAGGCTTGGCATGGAGGGG + Intronic
954412455 3:50376738-50376760 AGCCTCTGCTTGGCCCTGAGTGG - Intronic
954865138 3:53722673-53722695 ATTAGATGCTTGGCATTAAGTGG - Intronic
955767539 3:62360514-62360536 GTCCTATGCTTGGCATTTAGTGG - Intergenic
956150581 3:66238085-66238107 AAACTATGCTTGGCATGGAGTGG - Intronic
956624624 3:71255006-71255028 ACTCACTGCTTGGCGTTAAGTGG - Intronic
958465828 3:94456777-94456799 ATTGTCTGCTTTACTTTGAGAGG - Intergenic
961266886 3:125650379-125650401 AGTCTCTGCTTGGCTCAGAGAGG + Intergenic
961973580 3:130996735-130996757 AAAATCTGCATGGCATTGAGAGG - Exonic
962095581 3:132289339-132289361 ATTCTTGGCTTGGCATTGATGGG - Intergenic
965510052 3:169558155-169558177 ATTCTCTGATTTGCTGTGAGTGG - Intronic
967264369 3:187677386-187677408 ATTCTCTGGGTGGCATAGTGGGG - Intergenic
971150957 4:24031080-24031102 AGTCTCTGCTTGTCAATGTGAGG - Intergenic
972338844 4:38133168-38133190 ATTCTTTGGTTGTCACTGAGAGG - Exonic
972689273 4:41381101-41381123 ATTCAGTGCCTGGCATTCAGTGG - Intronic
972826193 4:42761898-42761920 GTTCTCTGCCTGGAATTAAGAGG - Intergenic
974990962 4:69089684-69089706 ATTTTCTGCTTTGCATTAACAGG + Intronic
978132859 4:105220658-105220680 TTTTTCTGCCTGGCATTGACTGG + Intronic
978370323 4:108023452-108023474 ATTCTCTGCTTTGCATTTCCAGG + Exonic
978543695 4:109847048-109847070 ATTCTCTGCTGAGCATTGAGGGG - Intergenic
980030396 4:127822540-127822562 ATTCTGTGCTTAGCATTTTGAGG + Intronic
985216212 4:187657175-187657197 TTTCTTTGCTTGGCCTTTAGAGG + Intergenic
985430063 4:189870673-189870695 GTGCTCTGCTTGGCATTTATAGG + Intergenic
986135591 5:4974791-4974813 CTTTTTTACTTGGCATTGAGTGG + Intergenic
988184253 5:27839256-27839278 ATGCTTTGTTAGGCATTGAGGGG + Intergenic
990732267 5:58822433-58822455 TTTCTCTGCCTGGCATTGCTGGG + Intronic
990982762 5:61616627-61616649 ATTCTCTGTTTGGCATACTGGGG - Intergenic
992357412 5:76000278-76000300 TCTCTCTGCTTGCCATGGAGAGG - Intergenic
997466775 5:134093508-134093530 ATTCTCTGCTTTGCATCATGAGG - Intergenic
997803401 5:136889253-136889275 ATTTTCTACTTGGTATTGACTGG + Intergenic
999370909 5:151054725-151054747 GCTCTCTGCTAGGCATTGAATGG - Intronic
1000122744 5:158212798-158212820 ATTCTCTCCTTGGCAATGAAGGG + Intergenic
1001421273 5:171589132-171589154 ATTCTCACCTTGACACTGAGAGG - Intergenic
1008517984 6:52336149-52336171 ATTCTATGCTTGGTACTGTGAGG + Intergenic
1010743356 6:79533395-79533417 ATTCTTTGATTAGCATCGAGAGG - Intronic
1011287022 6:85735835-85735857 ATTCTCTGCCTGGCATTTGCTGG - Intergenic
1013163997 6:107573424-107573446 ATTCTGTGCCAGGCATTGTGTGG + Intronic
1013664409 6:112332361-112332383 ATGCTATGCTGGGCATTGTGCGG + Intergenic
1013702832 6:112794929-112794951 ACACTGTGGTTGGCATTGAGTGG + Intergenic
1017359080 6:153544682-153544704 ATTCTATGTTTGGCATTTTGAGG - Intergenic
1017608385 6:156157658-156157680 ATTATCTACTTGGCAGAGAGGGG - Intergenic
1018837053 6:167492974-167492996 AGCCTCTGATAGGCATTGAGTGG + Intergenic
1022013943 7:26332403-26332425 ATACTTTGCTTGTTATTGAGTGG + Intronic
1023359033 7:39396992-39397014 ATTCTTTGCCTGGAATTGGGTGG - Intronic
1023660413 7:42466021-42466043 CTTCTCTGCCTGGCATTCAGTGG - Intergenic
1024883266 7:54113591-54113613 ATTCTCTTCTTAGCATTTTGAGG + Intergenic
1033184202 7:139210983-139211005 ATCCCCTGCTTGGCACTGTGTGG - Intergenic
1033611270 7:142965178-142965200 TTTCACTGCTTGGCCTTGTGAGG + Intergenic
1034842503 7:154412357-154412379 CTTCTCTGCTTGGCTTGCAGAGG + Intronic
1036626282 8:10474906-10474928 ATTATCTGCTTTGGATCGAGAGG - Intergenic
1037837107 8:22220888-22220910 ATTCTGTGGTTGGCCCTGAGTGG + Exonic
1038420628 8:27431871-27431893 ATTTTCTCCTTGGCATAGGGAGG + Intronic
1039107065 8:34001370-34001392 ATTGTCTGCTTGGCCTTTATTGG + Intergenic
1040436537 8:47397173-47397195 AGTCTTTGCTTGGCATTGTTTGG - Intronic
1040783517 8:51139270-51139292 CTTCTCTGCTTGCCCTTCAGTGG + Intergenic
1040969918 8:53124794-53124816 ATTTTATGCTTGGCATAGAAGGG + Intergenic
1041211403 8:55554944-55554966 ATTCTCTGCTTGCAATGGGGTGG - Intergenic
1045764703 8:105653345-105653367 ATTCTCTACCTGGCATATAGTGG - Intronic
1045919965 8:107518180-107518202 ATTCTCTGGTTGGCAGCAAGGGG - Intergenic
1048221527 8:132546677-132546699 AATCTGTGGTTGGCATTGACTGG - Intergenic
1048744314 8:137596547-137596569 AGTCTCTGCTTGGCACCCAGTGG + Intergenic
1050152705 9:2632771-2632793 ATTCTCTGCTTCCCACAGAGAGG - Intronic
1050741612 9:8826715-8826737 ATACTATGCTTGCCATTAAGGGG - Intronic
1051671918 9:19519174-19519196 AATCTATGCCTGGCATAGAGAGG - Intronic
1052960446 9:34291693-34291715 ATTCTCTACTTAGCACTGTGTGG - Intronic
1055590454 9:77807523-77807545 ATTCTTTGTGTGGCATTTAGTGG + Intronic
1056068181 9:82958554-82958576 ATTTTCTGTTTGGCTTTTAGTGG + Intergenic
1057409411 9:94804080-94804102 AGTCTCTGCTGGGGATTGACTGG + Intronic
1059789094 9:117620358-117620380 TTTCTCTGGCTGACATTGAGTGG + Intergenic
1059946023 9:119409167-119409189 CTTCTATGCTTGGCATTCAAAGG - Intergenic
1061697968 9:132392146-132392168 ATTCTCTCCTTGGGAATGACTGG - Exonic
1187390763 X:18885229-18885251 ATTCTCAGCTTAGCATACAGGGG - Intergenic
1187989629 X:24855489-24855511 TTTCTTTGCTTGGCAAGGAGTGG + Intronic
1188858998 X:35234106-35234128 ATTCTCTGGTGGACATTGACAGG + Intergenic
1189954867 X:46267446-46267468 ATTCTCTGTATGGATTTGAGTGG + Intergenic
1189992133 X:46605471-46605493 CTTCTCTGCATGGCACTCAGTGG + Exonic
1191717418 X:64203423-64203445 CTGCACTGCTTGGCTTTGAGAGG + Intronic
1192233579 X:69282343-69282365 ATTTACTGCTTGGCACAGAGTGG - Intergenic
1193474181 X:81943237-81943259 TTTCTCTGGTGGGCATTTAGTGG - Intergenic
1193550199 X:82883066-82883088 ATTCTATGCCTAGTATTGAGGGG - Intergenic
1196145628 X:112313892-112313914 ATTCTCAGCATGGAATTTAGAGG + Intergenic
1196844971 X:119890403-119890425 AGTCTGTGCTGGTCATTGAGAGG + Intergenic
1197700880 X:129598440-129598462 ACTCTCTGCAAGGCATTGTGGGG - Intergenic
1198542443 X:137654184-137654206 ATTCTGTGCTTTATATTGAGGGG - Intergenic
1199769604 X:150966205-150966227 GATCTCTGCTTGGTAGTGAGAGG + Intergenic
1200968420 Y:9123815-9123837 ATTCTCTTATTGGTACTGAGAGG + Intergenic
1202142347 Y:21738450-21738472 ATTCTCTTATTGGTACTGAGAGG - Intergenic
1202144518 Y:21765352-21765374 ATTCTCTTATTGGTACTGAGAGG + Intergenic