ID: 1126697908

View in Genome Browser
Species Human (GRCh38)
Location 15:51341452-51341474
Sequence CCTGCGGAGGAGGGGCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 717
Summary {0: 1, 1: 0, 2: 5, 3: 83, 4: 628}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126697908_1126697922 25 Left 1126697908 15:51341452-51341474 CCTGCCAGCCCCTCCTCCGCAGG 0: 1
1: 0
2: 5
3: 83
4: 628
Right 1126697922 15:51341500-51341522 TTCTGCCCGCCTGTCCCTCTGGG 0: 1
1: 1
2: 1
3: 14
4: 195
1126697908_1126697921 24 Left 1126697908 15:51341452-51341474 CCTGCCAGCCCCTCCTCCGCAGG 0: 1
1: 0
2: 5
3: 83
4: 628
Right 1126697921 15:51341499-51341521 CTTCTGCCCGCCTGTCCCTCTGG 0: 1
1: 0
2: 6
3: 17
4: 258
1126697908_1126697915 -10 Left 1126697908 15:51341452-51341474 CCTGCCAGCCCCTCCTCCGCAGG 0: 1
1: 0
2: 5
3: 83
4: 628
Right 1126697915 15:51341465-51341487 CCTCCGCAGGCTGCCTCCACTGG 0: 1
1: 0
2: 1
3: 25
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126697908 Original CRISPR CCTGCGGAGGAGGGGCTGGC AGG (reversed) Intergenic
900409129 1:2504929-2504951 CCGGCTGGGGAGGGGGTGGCAGG + Exonic
900500795 1:3003575-3003597 CCTGCGGAAGAGGAACTGCCGGG + Intergenic
900513389 1:3070512-3070534 CCTGCAGAGGAGGGGGCGGCGGG - Intronic
900524480 1:3121793-3121815 CCTGGGGAGGGGGTGCTGGCAGG - Intronic
900637151 1:3671555-3671577 CCTCCAGAGGACGGGCTGCCTGG + Intronic
901062230 1:6477039-6477061 CCTATGGAGGAGTGGCTCGCAGG - Intronic
901082019 1:6588908-6588930 CCTCCGCAGGTGGGCCTGGCGGG - Exonic
901130964 1:6962474-6962496 TCTGAGGGGGCGGGGCTGGCAGG - Intronic
901159232 1:7162461-7162483 CCTGGGCTGGAGGGGCTGGGGGG - Intronic
901510392 1:9715503-9715525 CCTTGGGTGGAGGGGCTGACCGG + Intronic
901872659 1:12147090-12147112 CCTGGGGAGGAGGGCCTGGTGGG + Intergenic
902275550 1:15337044-15337066 CCTCTGCAGGAGGGGCTGCCAGG + Intronic
903006107 1:20299945-20299967 CCTGCGTAAGAGCAGCTGGCTGG + Intronic
903015362 1:20358116-20358138 CCCGCAGAGAAGGGACTGGCTGG - Intergenic
903166012 1:21520966-21520988 GCTGCAGGGGAGGGGATGGCAGG - Intronic
903233866 1:21937341-21937363 GCTGCGGGGGCGGGGCGGGCGGG - Intergenic
903283516 1:22263477-22263499 CCAGGGGACGAGGGGCTGCCAGG + Intergenic
903378300 1:22880065-22880087 GCTGCAGAGGAAGGACTGGCAGG + Intronic
903597112 1:24503096-24503118 CCTGCGGCGGCGGGGCGTGCAGG + Exonic
903666442 1:25010533-25010555 CTGGTGGTGGAGGGGCTGGCTGG - Intergenic
903687607 1:25143382-25143404 TCTGAGGAGGAGGCACTGGCAGG - Intergenic
903777016 1:25799989-25800011 CCTGGGGAGGCTGGGGTGGCCGG + Intergenic
904496873 1:30892075-30892097 TGTGTGGAGAAGGGGCTGGCAGG - Intronic
905266388 1:36756897-36756919 CTTGCAGGGGTGGGGCTGGCTGG - Intergenic
906168952 1:43707755-43707777 CCGGCGGGGGAGGGGCGGGGCGG - Intronic
906551294 1:46668330-46668352 CCTGAGGAGGAGGAGGAGGCGGG - Exonic
906660458 1:47578070-47578092 CAGGCAGAGGAGGGGTTGGCAGG - Intergenic
906673595 1:47677530-47677552 CCTGCGGGGGAAGGTCAGGCTGG - Intergenic
906686276 1:47765451-47765473 CCTCAGCAGGAGGGGCAGGCAGG - Exonic
907096791 1:51789319-51789341 CCAGCAGAGGAGAGGTTGGCAGG + Exonic
907313352 1:53552384-53552406 CCTGAGAAGGAAGGCCTGGCGGG - Intronic
907750784 1:57261178-57261200 CTTGCGGAGGTTGGGGTGGCAGG - Intronic
909068472 1:70963709-70963731 CCTGCGATGGAGGGGCTACCAGG + Intronic
911290975 1:96056794-96056816 CCTGCAGTGGAGGGCCTGTCTGG - Intergenic
911862468 1:102970244-102970266 CCTGGGAAGGATGGGCTGCCAGG - Exonic
914689191 1:150010537-150010559 CCGTCGGGGGAGGGGCCGGCCGG - Exonic
915476124 1:156153876-156153898 CCTGGGCAGGGGTGGCTGGCCGG - Intronic
915940511 1:160115687-160115709 CTTTCGGAGGAGGGGAAGGCGGG + Intergenic
916213500 1:162376825-162376847 CCTGCTCTGGAGAGGCTGGCTGG + Exonic
916861940 1:168815385-168815407 CCTGTCGAGGAGGGGCGTGCAGG + Intergenic
917817643 1:178725984-178726006 CCTCCGGGGCCGGGGCTGGCGGG - Intronic
919663798 1:200273145-200273167 CCTGAAGAGGAGAGGCTGGTTGG - Intergenic
920117276 1:203629636-203629658 CCAGCGGCGGAGAGGCTGGCGGG - Intronic
920717038 1:208349835-208349857 CAGGCAGAGGAGGGGCTGGGTGG + Intergenic
921060397 1:211579491-211579513 CGGGAGGGGGAGGGGCTGGCCGG + Intergenic
921301925 1:213759690-213759712 GCTGCGGAGGCTGGGCTGACAGG - Intergenic
922182552 1:223246621-223246643 CAGGCGTAGGAGGGGCTGGAGGG + Intronic
924415297 1:243850720-243850742 CCTGAGGACGAGGGCCGGGCAGG - Intronic
924920929 1:248628323-248628345 GCCGGGGAGGAGGTGCTGGCGGG - Intergenic
1063236346 10:4120583-4120605 GTTGCTGAGGAGGTGCTGGCTGG + Intergenic
1063664711 10:8054452-8054474 CCGGCGGAGGGGCGGCGGGCAGG - Intronic
1063948308 10:11199050-11199072 CCTTAGGAGGAGGGGTTGGTAGG + Intronic
1064534392 10:16343841-16343863 CCTGGGGAGGATGGGATGGGAGG - Intergenic
1065557521 10:26931480-26931502 CCAGAGGAGGCGGGGCAGGCTGG + Intergenic
1065787415 10:29229537-29229559 CCTGGGGAGGAGGCTCTGGCAGG + Intergenic
1066357148 10:34695759-34695781 CCTGCACAGGAGAGGCTGCCCGG + Intronic
1066434491 10:35384614-35384636 CCTGCAGTGGAGGGGCGGGGTGG + Intronic
1067065506 10:43101990-43102012 CCTCCTGAGGAGGGTGTGGCAGG + Intronic
1067415362 10:46098087-46098109 CCCGGGGTGCAGGGGCTGGCAGG - Intergenic
1067435404 10:46273164-46273186 CCTGGGGTGCAGGGGCTGGCAGG - Intergenic
1067582201 10:47452854-47452876 CCTTGGGTGCAGGGGCTGGCGGG - Intergenic
1067945292 10:50685112-50685134 CCTGGGGAGGAGAGGTTGGCCGG - Intergenic
1068882878 10:62068468-62068490 TCTGAGGAGGAGGAGGTGGCTGG - Intronic
1069403630 10:68075322-68075344 GAGGCGGGGGAGGGGCTGGCCGG + Intronic
1069936608 10:71921860-71921882 CTTGGGCAGGAGGGGCTGGTTGG - Intergenic
1070333097 10:75431762-75431784 CGGGCGGAGGCGGGGCTGGCCGG - Intronic
1070880592 10:79850105-79850127 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1070885489 10:79893144-79893166 ACTGAGGAGGAGAGGCTAGCAGG - Intergenic
1071086967 10:81875749-81875771 CCCCCGGCGGAGGGGGTGGCGGG - Exonic
1071494095 10:86155870-86155892 CCTGAGGAGGATGGGAAGGCAGG + Intronic
1071633714 10:87234207-87234229 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1071647162 10:87366423-87366445 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1072418339 10:95268491-95268513 CCTGCGTGGGAAGGGTTGGCAGG - Intronic
1073117134 10:101097523-101097545 CCTGGGGAGCAGGGGCTCGTGGG + Intronic
1073185434 10:101612743-101612765 CCTGAGGAGGAGTGGCTGGGTGG - Intronic
1073440472 10:103549685-103549707 CCTGCTGTGGAGGAGCTGGGAGG - Intronic
1075103463 10:119521914-119521936 CCTGAGAAGGGGGGTCTGGCAGG - Intronic
1076587520 10:131559679-131559701 GCTGCGGTGGAGGGGCCGGGAGG + Intergenic
1076598187 10:131638679-131638701 CCTCCGGAGCAGGTGGTGGCAGG + Intergenic
1076625553 10:131819511-131819533 CGTGCGGAGGTGGGGCTGCCTGG - Intergenic
1076670822 10:132120308-132120330 CCTGCGGGGGAGGGATTGGCTGG + Intronic
1076698310 10:132257536-132257558 GCTGCGAAGGAGTGGGTGGCAGG + Intronic
1076736310 10:132460744-132460766 CCTGGGGAAGAGGGTCTGTCTGG + Intergenic
1076783543 10:132737609-132737631 CCTGTGGCTGAGGAGCTGGCAGG - Intronic
1076799063 10:132812333-132812355 CCAGCCGTGGAGGGGCTGCCAGG - Intronic
1076875370 10:133213239-133213261 GCTCCGGTGGAGGGGCTGGGGGG - Intronic
1077077911 11:709531-709553 ACTGCAGGGGAGGGGCTGTCAGG - Exonic
1077102996 11:830423-830445 CCCGCGGAGGTGGGGCCGTCGGG - Intronic
1077155903 11:1090676-1090698 CCTGCAGAGAAGGGCCTGCCAGG + Intergenic
1077182909 11:1224465-1224487 CCTGGGGGGGAGGGGTTGCCTGG + Intronic
1078020854 11:7654959-7654981 CCTGAGAAGGAGGGGCAGGAGGG + Intronic
1078256624 11:9664140-9664162 GCTGGGCAGGAGGGGTTGGCGGG + Exonic
1078665817 11:13324302-13324324 GATGAGCAGGAGGGGCTGGCAGG - Intronic
1079279258 11:19073068-19073090 CCTGCGGAGCATGGGCTTGGAGG - Intergenic
1080386947 11:31816058-31816080 CCTGAGGAGCGGGGTCTGGCCGG - Intronic
1081636747 11:44726926-44726948 GCGGCGGAGGTGGGGCCGGCGGG + Intronic
1081776473 11:45679067-45679089 CCTGAAGAGAAGGGGCTGGCGGG - Intergenic
1081804959 11:45885555-45885577 TCTCCGGGGGCGGGGCTGGCGGG + Intergenic
1081938191 11:46918705-46918727 CCCGCGCAGGAGGCGCCGGCGGG - Intergenic
1082848533 11:57745206-57745228 TCTGCAGAGGAGGGGCAGGTTGG - Exonic
1082997207 11:59263706-59263728 CCTGCAGAGGAGGAGAAGGCAGG + Intergenic
1083261138 11:61523791-61523813 CCAGCAGAGGATGGGCGGGCCGG - Intronic
1083749288 11:64752621-64752643 CTGGAGGAGGAGGGGCTGGGAGG - Intronic
1083782552 11:64925765-64925787 CCGGGGGAGGAGGGGCTAGTGGG - Exonic
1084000817 11:66294514-66294536 CCATCGGAGCAGGGGCTGGCCGG - Exonic
1084014822 11:66371963-66371985 CCTGCGGCGGAGGGGAAGGCGGG + Intronic
1084040376 11:66539320-66539342 AGTGCAGAGGAGGGTCTGGCAGG - Exonic
1084044921 11:66562963-66562985 CAGGCGGTGGAGGGGCTGGTGGG + Intronic
1084083950 11:66846157-66846179 ACTGCAGGGGAAGGGCTGGCTGG + Exonic
1084161711 11:67353709-67353731 CCGCGGGAGGAGGGGCAGGCTGG + Intronic
1084265613 11:68003870-68003892 CCGGCGGGGGCGGGGCGGGCCGG - Intronic
1084272056 11:68034247-68034269 CCGCTGGGGGAGGGGCTGGCTGG - Intronic
1084284505 11:68122242-68122264 CCTGCGGGGGATGGGGAGGCAGG - Intergenic
1084692134 11:70733752-70733774 CCCGGGAAGGAGGGCCTGGCAGG + Intronic
1084699736 11:70778673-70778695 GCTGCAGATCAGGGGCTGGCAGG - Intronic
1084889906 11:72231611-72231633 CCTGGGTAAGTGGGGCTGGCAGG + Exonic
1085423180 11:76380953-76380975 CGCGCGGGGGAGGGGCGGGCGGG + Intronic
1085507878 11:77070378-77070400 CTGGCTGAGCAGGGGCTGGCTGG - Intronic
1085689102 11:78651233-78651255 CCTGAGGACCTGGGGCTGGCGGG + Intergenic
1085729443 11:78983781-78983803 CCTGTGGGGGTGGGGCTGGGTGG + Intronic
1086903276 11:92391328-92391350 CTTGGGGAGGTGGGGCTGTCAGG - Intronic
1088796160 11:113268443-113268465 CCTGAGGAGGAAGGGCTGGGAGG + Intronic
1089496048 11:118909206-118909228 CCTGAGGAGGGGGGCTTGGCAGG + Intronic
1089663839 11:120004047-120004069 CCAGCAGAGGAGGGGTTGGGAGG - Intergenic
1090410812 11:126508449-126508471 TCTGAGGAGGAGGGGCTGCCAGG + Intronic
1091273062 11:134331767-134331789 CTGGCGGGGGCGGGGCTGGCGGG - Intergenic
1091273112 11:134331868-134331890 CAAGCGGGGGCGGGGCTGGCCGG - Exonic
1091567792 12:1661555-1661577 CTGGCGGATGAGGGGCTGGGAGG - Intergenic
1091704582 12:2685288-2685310 CTTGCTGATGAGGGGGTGGCAGG + Intronic
1091711152 12:2741625-2741647 CTTGCTGATGAGGGGGTGGCAGG + Intergenic
1091750347 12:3018332-3018354 CCTGTGGAGGAGGGGCTCCATGG - Intronic
1093958868 12:25251146-25251168 CCGGCGGAGGAAGGGGTGGCTGG + Intergenic
1095561559 12:43572066-43572088 CCTGAGGAGGCGGGCATGGCAGG - Intergenic
1096531547 12:52245716-52245738 CCTGCAGAGGAGGGGCATACAGG - Intronic
1100476683 12:94941531-94941553 ACTGCTGAGCAGGGGCTGGCTGG + Intronic
1101427450 12:104599687-104599709 CCTGGGGAGGAGGGAATCGCAGG - Intronic
1101679946 12:106955587-106955609 CCCCCGGAGGAGGGGCGCGCAGG + Intergenic
1102046596 12:109833427-109833449 CCGGCGGAGGAGGGACCCGCGGG - Intergenic
1102081394 12:110101117-110101139 CCTGAAGAGGAGGGGCTTGGTGG - Intergenic
1102190516 12:110984412-110984434 CCTGGAGAGGAAAGGCTGGCTGG + Intergenic
1103188532 12:118981408-118981430 CCTGAGGAGGAGGGGGTTGGTGG + Intergenic
1103321776 12:120096439-120096461 CGTGCAGAGATGGGGCTGGCAGG - Exonic
1103458576 12:121086307-121086329 CCTTCAGTGGAGGAGCTGGCAGG + Intergenic
1103506102 12:121443120-121443142 TCTCCAGAGGAGGGGCTGGAGGG + Intronic
1103597928 12:122035442-122035464 GCTGGGCAGGAGAGGCTGGCAGG - Intronic
1103918591 12:124388270-124388292 GCTGCGGGGTAGGGGCAGGCTGG + Intronic
1104482067 12:129116086-129116108 CCTCTGGAGGAGGCCCTGGCTGG - Intronic
1104674711 12:130704712-130704734 CCTGTGGAGGCGGTGGTGGCAGG - Intronic
1104768697 12:131346616-131346638 GCTGCAGGGGAGGGGCTGGCGGG - Intergenic
1104784596 12:131441274-131441296 CCTGAGGAGGTGGGGCTGTGGGG - Intergenic
1104811327 12:131621975-131621997 GCTGCAGGGTAGGGGCTGGCGGG + Intergenic
1104923431 12:132303171-132303193 CCGGCGGTGGAGGGTCTGACGGG - Intronic
1104940374 12:132392183-132392205 CCTGGGGAGAACGGGGTGGCCGG - Intergenic
1104975210 12:132549080-132549102 CCGGGGGAGGAGGGTCTGGGCGG + Intronic
1104995132 12:132649441-132649463 CCTGCGGGCGAGGCGCTGCCGGG + Exonic
1105557353 13:21459402-21459424 CCCGCGGCGGGCGGGCTGGCGGG - Intergenic
1105725689 13:23160251-23160273 CCTGGGGCGGAGGGGCGCGCCGG + Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1105830502 13:24160203-24160225 CCTGGGGGGTGGGGGCTGGCTGG + Intronic
1105965626 13:25381818-25381840 CCTGCGTAGAAGAGCCTGGCGGG - Intronic
1106112341 13:26787807-26787829 CCTGGGGAGTCGGGGCTGACAGG - Intergenic
1108279559 13:48847978-48848000 ACTGCAGAGAAGGGACTGGCTGG + Intergenic
1108372554 13:49785069-49785091 ACTGGCGAGGAGGGGCAGGCGGG + Intronic
1108618265 13:52157218-52157240 CCAGTGGAGGAGGGGCAGGAAGG + Intronic
1112562340 13:100525801-100525823 CCTGCAGAGGAAGGGCTGGGTGG + Intronic
1113444708 13:110356436-110356458 TGTGAGGAGGAGGGACTGGCAGG - Intronic
1113494191 13:110714564-110714586 GCTGCGGGGGAGGGGGCGGCGGG + Intronic
1113627836 13:111859450-111859472 CCTGAGCAGGAGAGGCTGGGGGG - Intergenic
1113887648 13:113669369-113669391 GCTGGGCAGGCGGGGCTGGCAGG + Intronic
1113940426 13:114015944-114015966 CCAGGGGAGGAAGAGCTGGCCGG + Intronic
1113962300 13:114132694-114132716 CCTGCAGGGGCGGGGTTGGCAGG + Intergenic
1114553288 14:23546612-23546634 CCTGGGGAGGAGGGATGGGCAGG + Intronic
1114665391 14:24374474-24374496 CCTGCTGGGGAGGGGAGGGCAGG + Intronic
1115731278 14:36272295-36272317 TTTGGGGAGCAGGGGCTGGCAGG - Intergenic
1119527458 14:75333843-75333865 CCTGGGGAGGAGGGGAGGGGGGG + Intergenic
1119743596 14:77028859-77028881 GGCGCGGAGGAGGGGCCGGCTGG - Intergenic
1119757227 14:77127723-77127745 GATGTGGAGGAGGGGCTGGGAGG + Intronic
1119845453 14:77826185-77826207 CCTGGGAAGGGGGAGCTGGCTGG + Intronic
1121357400 14:93227401-93227423 CCTGCGGAGGAGGTTCTGGAAGG - Exonic
1121410544 14:93745729-93745751 CCCAGGAAGGAGGGGCTGGCAGG - Intronic
1122116948 14:99532454-99532476 CCTGGGGATGCAGGGCTGGCAGG - Intronic
1122208504 14:100160041-100160063 CCCAAGGAGGAGCGGCTGGCAGG + Exonic
1122410157 14:101521658-101521680 CCTGCCGTGGGAGGGCTGGCGGG - Intergenic
1122415681 14:101548514-101548536 CCTGGGGAGCACGGGCTGGTGGG + Intergenic
1122484028 14:102066152-102066174 CCTGCGGGGGAGGTCCTGGGCGG - Intergenic
1122558023 14:102592032-102592054 CCAGGGGACGCGGGGCTGGCGGG - Intergenic
1122910532 14:104825821-104825843 GCTGGGGCGGAGGGACTGGCAGG + Intergenic
1122976159 14:105171650-105171672 GCTGCCGGGGAGGGGCTGTCAGG - Intergenic
1123034483 14:105466365-105466387 CCAGCAGGGGAGGGGCAGGCAGG - Intronic
1123071176 14:105643171-105643193 CCTGGGGAGCGGGGGCTTGCCGG + Intergenic
1123090836 14:105741441-105741463 CCTGGGGAGCGGGGGCTTGCCGG + Intergenic
1202906019 14_GL000194v1_random:72915-72937 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1123643015 15:22417442-22417464 CCTGCAGAGGAGGAGCGGGGCGG + Intergenic
1123944088 15:25230612-25230634 CATGTGGAGAAGGGGGTGGCGGG - Intergenic
1123946528 15:25241501-25241523 CACGCGGAGAAGGGGGTGGCTGG - Intergenic
1123994088 15:25706286-25706308 CCTGCAGAGGAGAGGCCAGCTGG + Intronic
1124955718 15:34359095-34359117 CCTGAGGAGGAGGGGGTGAGAGG + Exonic
1126660807 15:51031308-51031330 CCTGTGGTGGGGGGGCTAGCTGG + Intergenic
1126697908 15:51341452-51341474 CCTGCGGAGGAGGGGCTGGCAGG - Intergenic
1127681382 15:61301935-61301957 GCTGAGGATGAGGGGCAGGCGGG + Intergenic
1127867094 15:63042191-63042213 GCTGCCGGGGAGGCGCTGGCGGG + Intergenic
1128585336 15:68844258-68844280 ATTGCGGAGGAGGGGCGGGAAGG + Intronic
1128637029 15:69309191-69309213 CATGGAGAGGAGGGCCTGGCAGG + Intronic
1128868826 15:71136804-71136826 CCTGAGGAGAAGGGGCAGGAAGG + Intronic
1129182273 15:73884964-73884986 GTTGGGGAGGAGGGGCTGGGTGG - Intronic
1129463065 15:75709668-75709690 GCTGCCCAGGAGGGGCGGGCAGG - Intronic
1129844113 15:78760391-78760413 CCTGGGGAGGAGGAGCAGGAAGG + Intronic
1130945304 15:88546483-88546505 CCTGCCGGGGAGGGTCTGACGGG + Intronic
1132080980 15:98865426-98865448 GCCGCCAAGGAGGGGCTGGCTGG + Intronic
1132148438 15:99442773-99442795 CCTGGGGTGTTGGGGCTGGCAGG - Intergenic
1132385438 15:101397032-101397054 CCTTCGGAGGAGGTGCAGGCAGG + Intronic
1132544924 16:528482-528504 CCTGGCGTGGAGGGGCTGGCGGG + Intronic
1132584645 16:700891-700913 CCTGCTGAGCGGGGGCTGCCGGG - Intronic
1132675173 16:1118414-1118436 CCTGGGAAGGCGTGGCTGGCTGG + Intergenic
1132693563 16:1192344-1192366 CCCACGGCAGAGGGGCTGGCAGG - Intronic
1132698961 16:1214147-1214169 CCACCCAAGGAGGGGCTGGCGGG + Intronic
1132698972 16:1214181-1214203 CCACCCAAGGAGGGGCTGGCAGG + Intronic
1132832119 16:1933507-1933529 CGGGCTGCGGAGGGGCTGGCAGG + Intergenic
1132871257 16:2116733-2116755 GCTGAGGAGGAGGGGCTGGTGGG - Intronic
1133018543 16:2955828-2955850 CCCGTGGAGGAGGGGGTGGGCGG + Intergenic
1133041057 16:3059870-3059892 CCTGGGGAGGAGGAGGTGGGTGG - Exonic
1134291901 16:12908300-12908322 TCTGAGTGGGAGGGGCTGGCAGG + Intronic
1134320885 16:13161573-13161595 CCAACGTAGGAGGGGATGGCTGG - Intronic
1134521269 16:14920161-14920183 GCTGAGGAGGAGGGGCTGGTGGG + Intronic
1134708944 16:16318812-16318834 GCTGAGGAGGAGGGGCTGGTGGG + Intergenic
1134716154 16:16358846-16358868 GCTGAGGAGGAGGGGCTGGTGGG + Intergenic
1134950661 16:18349833-18349855 GCTGAGGAGGAGGGGCTGGTGGG - Intergenic
1134958599 16:18393313-18393335 GCTGAGGAGGAGGGGCTGGTGGG - Intergenic
1135128343 16:19830393-19830415 CCTGCAGCAGAGGGGCTGGAGGG + Intronic
1135609656 16:23855144-23855166 CCGGCGGGGGAGGGGGTGGCAGG + Intronic
1136381237 16:29896911-29896933 CCTGGGGAGGCAGGGCTGGGTGG + Exonic
1136543508 16:30942353-30942375 CCTGCGGAGAGGGGGCAGTCAGG - Exonic
1136550294 16:30979329-30979351 CCTGCGGCGGTGTGGCTGGAGGG - Exonic
1137569658 16:49557331-49557353 CCCGGGGAGGAGGAGCGGGCAGG - Intronic
1137686504 16:50390553-50390575 CCTGAGCAGGAGGGGATGGCAGG - Intergenic
1137698289 16:50477548-50477570 CATGCTGAGGAGGGTCTGCCAGG - Intergenic
1138098786 16:54234987-54235009 CCTGGGGTGTGGGGGCTGGCTGG + Intergenic
1138389727 16:56661648-56661670 CCTGCAGTGGGGTGGCTGGCAGG - Intronic
1138693615 16:58791031-58791053 CCCGCGGCGGCAGGGCTGGCAGG + Intergenic
1139475239 16:67199615-67199637 CCTGCGGAGGGCGGGAGGGCAGG + Intronic
1141068394 16:80932276-80932298 CGCGCGGAGGAAGGGGTGGCGGG - Intergenic
1141518796 16:84563932-84563954 CCCGGGCAGGAGGGGCTGGAAGG - Intergenic
1141576383 16:84966589-84966611 CCAGGGAAGGAGGGGCTGGAGGG + Intergenic
1141610189 16:85176895-85176917 CCTGGGGAGGAGGGGCAGCCAGG - Intronic
1141627194 16:85267416-85267438 CCTGGCATGGAGGGGCTGGCAGG + Intergenic
1141627431 16:85268696-85268718 CCTGCTGAGGCTGTGCTGGCAGG - Intergenic
1141731324 16:85824972-85824994 GCTCCGGGGGAGGGGCTGCCTGG + Intergenic
1142006445 16:87691596-87691618 CCTCTGGGGGTGGGGCTGGCAGG - Intronic
1142143545 16:88483224-88483246 CCTGGACAGGAGGGGCAGGCTGG - Intronic
1142510553 17:389977-389999 CCTGCAGTGCAGGTGCTGGCAGG - Intergenic
1142611258 17:1110060-1110082 CCTGCGGTGGGGTGGCTGGGGGG - Intronic
1142698429 17:1645825-1645847 CCTGAGAGGGAGGGGGTGGCTGG + Intergenic
1142894358 17:2964365-2964387 CCTGGGGGAGAGGAGCTGGCGGG + Intronic
1142958099 17:3534989-3535011 CCAGAGAAGGAGGGGCTGGGAGG - Intronic
1143030006 17:3962668-3962690 CCAGCGGAGGAGGAACTGACTGG - Intronic
1143130084 17:4672452-4672474 GCGGCGGAGGTGGGGGTGGCGGG + Exonic
1143178197 17:4968470-4968492 GCTGGGGAGCAGGGGCAGGCAGG + Exonic
1143410199 17:6704056-6704078 CCTGCAGAGGAGGGGCAGGGAGG + Exonic
1144516314 17:15919606-15919628 CCTGCTGAGGAGGTGGTGCCAGG - Intergenic
1144774646 17:17779206-17779228 CCTCTGGAGCAGTGGCTGGCTGG + Intronic
1144780457 17:17805699-17805721 CCAGCGGGGAAGGGGCTTGCTGG + Intronic
1145057592 17:19713787-19713809 GCTGGGGAGGTGGGGCTTGCTGG - Intronic
1145058425 17:19717617-19717639 GCAGCGGAGGAGTGGCCGGCAGG + Intronic
1145269307 17:21396154-21396176 CATGGGGGTGAGGGGCTGGCTGG + Intronic
1145886917 17:28388273-28388295 CCAGGTGAGGAGGGGCGGGCGGG + Exonic
1146790980 17:35750377-35750399 CCTCCGGGGCAGGGGCTAGCGGG + Intronic
1147200760 17:38799735-38799757 CCCGGGGAGGAGGGGCGGGCGGG - Exonic
1148074442 17:44927412-44927434 CCTGTGGGGCAGAGGCTGGCAGG - Intronic
1148128074 17:45247056-45247078 ACAGCGGAGGAGGGGCTGCCCGG - Exonic
1148239146 17:45988506-45988528 CCTATGGAGGCGGGGCTGGGGGG - Intronic
1148327201 17:46790159-46790181 CCTGCGGAGGAATGGGTGGCAGG - Intronic
1148335966 17:46841632-46841654 CTTGAGGAGAAGGGGCTGGTGGG + Intronic
1148559724 17:48598926-48598948 CCAGAAGAGGAGGAGCTGGCAGG + Intronic
1148617848 17:49013927-49013949 CCTGTAGCGGAGGGGCTGGGGGG + Intronic
1148621130 17:49035626-49035648 CCTGCAGCGGTGGGGGTGGCTGG + Intronic
1149304707 17:55336271-55336293 CCTGGGGAGCAGGGGGTGGCTGG - Intergenic
1151214661 17:72569367-72569389 GCCCAGGAGGAGGGGCTGGCGGG + Intergenic
1151226976 17:72655060-72655082 CCTGCTGAGAAAGGCCTGGCAGG - Intronic
1151803063 17:76388990-76389012 CCTGTGGAGGAGTGCCAGGCAGG + Intergenic
1151835761 17:76581683-76581705 CCTGAGAGGGAGGGGCTGGAAGG - Intronic
1151961357 17:77407659-77407681 CCTGGGGCGGAGGAGCAGGCAGG - Intronic
1152024551 17:77800281-77800303 GCTGCGGAGGTGGGGCGGGGCGG + Intergenic
1152066947 17:78117347-78117369 CCTGCGGGAGAGGGGCTGTCGGG + Exonic
1152241916 17:79165419-79165441 CCTGGGAAGGAGGGGGTGCCTGG + Intronic
1152323486 17:79622392-79622414 CCAGAGGAGGTGGGGCTGGGAGG + Intergenic
1152630751 17:81409774-81409796 CCTGCTGGGGAGGTGCTTGCAGG - Intronic
1152731931 17:81976909-81976931 CATGCTGAGGAGGGGCTTGGTGG - Intronic
1152819326 17:82428474-82428496 CCTGATGAGGAAGGGCTGGGGGG + Intronic
1152822733 17:82445482-82445504 CCTGCGGACAAGTGGCTGCCAGG + Intronic
1153259178 18:3206421-3206443 CCTGCGGAGGAGCAGCTAACTGG - Intronic
1153518599 18:5930009-5930031 GCTGGGGAGGAGGGAGTGGCAGG + Intergenic
1153675396 18:7452331-7452353 CCTGTGGTGGAGGGCCTGGTGGG - Intergenic
1153805740 18:8706777-8706799 CCCGGGAAGGAGGGGTTGGCGGG - Intronic
1154132770 18:11750984-11751006 CCTGGGGAGCCGGGGCGGGCTGG + Intronic
1154218211 18:12431335-12431357 ACGGCGGCGGTGGGGCTGGCTGG - Exonic
1154377348 18:13821266-13821288 CCTGCGGAGGGAGGGATGGGAGG - Intergenic
1155075247 18:22348715-22348737 GCGGCGGGGGAGGGGCGGGCCGG + Intergenic
1155661103 18:28249109-28249131 GCTGTGGAAGAGGGGCTGGGGGG + Intergenic
1157188778 18:45562792-45562814 CCTGGGGGGAAGGGGCTGGGTGG + Intronic
1157276214 18:46312759-46312781 CCTGCCCAGGGGAGGCTGGCAGG + Intergenic
1157604643 18:48918260-48918282 GCGGCGGAGGAGGGGCAGGGAGG - Intergenic
1157685748 18:49640997-49641019 CCTGGGGAGGTGGGTGTGGCTGG + Intergenic
1157831368 18:50859779-50859801 CCTGCAGAGGAGGAGATGGAAGG - Intergenic
1158220544 18:55146262-55146284 CCTGGGGAGGAGGTGGGGGCTGG - Intergenic
1158227394 18:55215273-55215295 CCTGCGGAGGAAGGGCTGGGTGG - Intergenic
1158673759 18:59500370-59500392 TCTTCGGAGGAAGGGCAGGCAGG + Intronic
1159481317 18:68994511-68994533 ACGGGGGAGGAGGGGGTGGCAGG - Intronic
1160033331 18:75280977-75280999 CCTGCAGGGGAAGGGCTGCCTGG + Intronic
1160152538 18:76406109-76406131 CCTCCGGAGGAGGGGCTGCAGGG - Intronic
1160356680 18:78232963-78232985 TCGGGGGAGGAGGGGGTGGCAGG + Intergenic
1160394019 18:78559016-78559038 GCTGGGGAGGAGGGGGTGGGAGG - Intergenic
1160442232 18:78901719-78901741 ACTGGGGAGGAGGGGCAGGCTGG - Intergenic
1160514819 18:79472422-79472444 CCTGGGAAGGAGAGGCTGCCGGG - Intronic
1160563542 18:79773132-79773154 CCTGGGCAGGAGGACCTGGCTGG - Intergenic
1160735315 19:659613-659635 CCTGCTGAGGAGGCACTGACTGG - Intronic
1160739837 19:680654-680676 CCTGCGGGGGCGGGGCCTGCTGG + Intronic
1160768878 19:821655-821677 CCGGCGGGGGAGGGGCGGTCGGG + Intronic
1160793650 19:934133-934155 CCTGGGCTGGAGGGGCGGGCAGG + Intronic
1160898051 19:1412055-1412077 CCTGGGAGGGCGGGGCTGGCAGG + Intronic
1160953961 19:1681145-1681167 ACTGCTGTGGAGGGGCCGGCAGG - Intergenic
1161038199 19:2096816-2096838 CCTGCGCTGGTGGGGCGGGCGGG + Intronic
1161222198 19:3122919-3122941 CATGGGGAGACGGGGCTGGCGGG + Exonic
1161341527 19:3745787-3745809 CCTCCTGAGGAGTGGGTGGCTGG - Intronic
1161578054 19:5065761-5065783 CGTGCAGAGGAGGGGATGGATGG - Intronic
1161699165 19:5785511-5785533 CCTGCGGCGGGTGGGCGGGCAGG + Exonic
1161767765 19:6216513-6216535 CCTGGGGAGGCGGGGCAGGGAGG + Exonic
1161950358 19:7464403-7464425 CCTGCTGGAGAGGGGCAGGCTGG - Intronic
1162531782 19:11240242-11240264 CCAGCTGAGGAGCGCCTGGCTGG + Exonic
1162672118 19:12266225-12266247 ACGCGGGAGGAGGGGCTGGCTGG - Intronic
1162740878 19:12772912-12772934 CCTGGGGAGAAGGGGGTGTCAGG + Exonic
1163029849 19:14537085-14537107 CCTGAGGAGGAGGAGGGGGCAGG + Intronic
1163124830 19:15239191-15239213 GCTGTGGAGGAGGGGGTGGTCGG + Exonic
1163155672 19:15438856-15438878 CCCGAGGAGCTGGGGCTGGCAGG - Intronic
1163575646 19:18109659-18109681 TTGGCGGAGGAGGGGCTGGTGGG + Intronic
1163647084 19:18495600-18495622 CCTGCGGAGACAGGGCTGGTAGG + Intronic
1163795909 19:19337900-19337922 GCTGCAGTGGAGGGGCCGGCAGG + Intronic
1164403368 19:27919071-27919093 TCTCCTGAGGAGGGTCTGGCAGG - Intergenic
1164436415 19:28233871-28233893 CTTGGGGTGGTGGGGCTGGCAGG + Intergenic
1164592970 19:29516265-29516287 CCTGGGGAGCTGGGGCTGCCTGG - Intergenic
1164633018 19:29774051-29774073 CCTGTGGGGCAGGGGCTGGCTGG - Intergenic
1165392151 19:35545076-35545098 CCTGTGGAGGAGGGGTCGGGAGG - Exonic
1165460266 19:35940102-35940124 CCTGGCGAGCAGGGGCAGGCGGG - Exonic
1165862888 19:38918421-38918443 ACAGCGGAGGTGGGGCTTGCAGG - Exonic
1166047858 19:40240121-40240143 ACTGCGGGTGAGGGGCTGGTGGG + Intronic
1166146852 19:40843977-40843999 CCTGAGGAGGAGAGGCGGGAGGG + Exonic
1166151013 19:40875874-40875896 CCTGAGGAGGAGAGGCGGGAGGG + Exonic
1166155508 19:40908653-40908675 CCTGAGGAGGAGAGGCGGGAGGG + Intergenic
1166179308 19:41095738-41095760 CCTGAGGAGGAGAGGCAGGAGGG - Exonic
1166340095 19:42132294-42132316 GCTGAGGAGGAGGGGCAGGCAGG + Intronic
1166343098 19:42150390-42150412 CCTGCGGTGGGGGGAATGGCAGG + Intronic
1166353044 19:42209714-42209736 CCTTCAGAGGAAGGTCTGGCGGG + Exonic
1166514864 19:43438776-43438798 CCTGAGTAGAATGGGCTGGCTGG - Intergenic
1166713467 19:44951659-44951681 CCTGAGGAGAAGGGACTGGGGGG - Intronic
1166726979 19:45034396-45034418 GCTGGGGAGGAAGGGCTGTCGGG + Intronic
1166782601 19:45350319-45350341 CCTGCGGAGAAGGGAGTGTCTGG - Exonic
1167071837 19:47226503-47226525 CCGCCGGAGGAGGGGGCGGCAGG - Intronic
1167116773 19:47493085-47493107 CCTGCGGGGCTGGGGCAGGCAGG + Intronic
1167248914 19:48390711-48390733 CCTGCTCAGGCGGGGCGGGCTGG - Intronic
1167272131 19:48511613-48511635 GCTGGGGAGGAGGGGGGGGCGGG + Exonic
1167290056 19:48619543-48619565 GGTGAGGAGGCGGGGCTGGCAGG + Exonic
1167437805 19:49490045-49490067 CCTGGGGAAGAGTGGCTGGCAGG - Intronic
1167631618 19:50629548-50629570 CCTGTGGAGGAGGGGCTTATGGG - Intronic
1167689208 19:50975132-50975154 CTGAGGGAGGAGGGGCTGGCGGG + Intergenic
1167689272 19:50975300-50975322 CTGAGGGAGGAGGGGCTGGCAGG + Intergenic
1168063982 19:53909258-53909280 ACTGCGGAGGAGGGGAGGGGCGG - Intergenic
1168325507 19:55536789-55536811 CTGGCGGAGGAGGGGCTGGGGGG - Intronic
1168332205 19:55577489-55577511 TCTGTGGAGGTGGGGCAGGCTGG - Intergenic
926295416 2:11565309-11565331 CCTGTGGGGGAGACGCTGGCAGG - Intronic
926709276 2:15864202-15864224 CCTGGGGAGAAAGTGCTGGCTGG + Intergenic
927520485 2:23695397-23695419 GGTGCGGAGGGGAGGCTGGCAGG - Intronic
927652479 2:24920593-24920615 GCGGCGGAGGAGGGGGCGGCGGG - Intergenic
927809730 2:26174203-26174225 GCCACGGAGGAGGGGCTGCCGGG - Intronic
927885297 2:26714543-26714565 CCTGGGGAGGACAGGCAGGCGGG - Intronic
928115597 2:28543337-28543359 CGTGCTGAGGAGGGGCTGCAGGG + Intronic
928490540 2:31778449-31778471 CTGGTGGAGGTGGGGCTGGCGGG - Intergenic
929933654 2:46277584-46277606 CCTGTGGGTGAGGGACTGGCGGG + Intergenic
930468231 2:51780548-51780570 CCTGGGGCGGAAGGGCCGGCTGG + Intergenic
930762256 2:55049856-55049878 CCGGGGGAGGAGGGGGAGGCCGG + Exonic
932479660 2:72031610-72031632 CCTGGGGAAGAGGAGCCGGCCGG + Intergenic
932567691 2:72919986-72920008 GCCGCGGCCGAGGGGCTGGCGGG + Intronic
934500582 2:94857602-94857624 CCTGAGGAGGAGGGCCTGTCTGG + Intergenic
934692037 2:96369052-96369074 CCTGCAGAGGAGGTGCGGGCTGG + Exonic
934993176 2:98935843-98935865 CGGGCGGAGGTGGGGCGGGCCGG - Intronic
935781503 2:106513085-106513107 CCAGCAGAGGAGGTGCTGGGAGG - Intergenic
937098725 2:119252377-119252399 TCAGAGGAGGAGGGGGTGGCAGG - Intronic
937114765 2:119397283-119397305 CCTGAGGAGGAGGAACAGGCTGG + Intergenic
937203849 2:120223434-120223456 CCTGCGGGGGCGGGGCCGGGTGG + Intergenic
937223779 2:120356753-120356775 CCTCTGGGGGAGGGGCTGCCAGG + Intergenic
937779428 2:125820293-125820315 GCAGCAGAGGAGGGGCTGGCAGG + Intergenic
937979651 2:127607444-127607466 CTTGGGCAGGTGGGGCTGGCTGG + Intronic
938213004 2:129484386-129484408 CCTGAGGAGCAGGGGCTGGATGG - Intergenic
939003124 2:136758558-136758580 CCTGGGGAGGCGGGGCCGGCTGG - Intergenic
944236424 2:197445387-197445409 TCTGCGGAGGAAGCACTGGCTGG - Intergenic
946137269 2:217657531-217657553 CTTGCGGAGGATGGGCTGTCTGG - Intronic
946351856 2:219160569-219160591 CCTCCGGGGGAGGGGTGGGCGGG - Intronic
946558771 2:220889527-220889549 AGTGAGGAGGAGGGGCTGGAGGG - Intergenic
946837155 2:223783939-223783961 CCACCGGAGGAGGGCCTGTCGGG - Intronic
947097343 2:226581138-226581160 CCTGGGAAGGAGGGGCTTGGAGG + Intergenic
947592954 2:231395649-231395671 CCGCGGGAGGAGGGGCCGGCAGG - Exonic
947610010 2:231518929-231518951 CCTGGGGAGAAGGGTCTGACTGG - Intergenic
947722427 2:232378198-232378220 CCTGGACAGGTGGGGCTGGCAGG - Intergenic
947726767 2:232406309-232406331 CCTGGACAGGTGGGGCTGGCAGG - Intergenic
947926936 2:233929608-233929630 CCTGGGGAGGTGGGGCTGCTAGG - Intronic
948005501 2:234604702-234604724 CGAGCGGAGGAGGAGGTGGCTGG - Intergenic
948037724 2:234872840-234872862 CCTGAGGAGGTGTGGCTGGAAGG + Intergenic
948580811 2:238986286-238986308 CGTGCGGGGGAGGGGTCGGCTGG + Intergenic
948691878 2:239711406-239711428 AAGGAGGAGGAGGGGCTGGCAGG - Intergenic
948694489 2:239726343-239726365 CCTGGGGAAGAGGTGCTGGAGGG - Intergenic
949026404 2:241768306-241768328 CCTGGGGAGCAGGCGCTGGGTGG + Exonic
1171372046 20:24668548-24668570 CCTGGGGAGGCGGGGATGCCTGG - Intergenic
1172056073 20:32155204-32155226 CTTGCTGGGGAGGGGCTGGAAGG - Intronic
1172904695 20:38360417-38360439 CCTGAGGAGGGGGCACTGGCTGG - Intronic
1173559590 20:43993418-43993440 CATGGGGAGGTGGGGCTGACAGG + Intronic
1173918386 20:46726182-46726204 CCAGCCGAGGAGGGGCTGAGGGG - Exonic
1174468035 20:50732000-50732022 CTTGCCGAGGAGGGGGTGGCGGG + Intronic
1174804748 20:53594690-53594712 CTTGCAGAGGAGGGGGCGGCGGG - Intronic
1175162676 20:57020736-57020758 CCTGCAGGGGAGGAGCTGGGAGG - Intergenic
1175291520 20:57879042-57879064 CTTGCTGGGGAGGGTCTGGCTGG + Intergenic
1175402480 20:58708392-58708414 CCTGGGCAGGAGGGGCTGGCAGG + Intronic
1175403833 20:58714864-58714886 CCTATGGAGGACAGGCTGGCTGG - Intronic
1175883586 20:62274708-62274730 CCTGGGGAGAAGGAGCTGGAGGG + Intronic
1175893373 20:62325091-62325113 CAGGCGGATGAGGGGCAGGCAGG + Intronic
1175903418 20:62368697-62368719 CAAGTGGGGGAGGGGCTGGCTGG + Intergenic
1175908253 20:62392325-62392347 ACTGGAGAGGAGAGGCTGGCAGG + Intronic
1175953383 20:62595810-62595832 CCTGCTGTGGAGGGGCTGGCGGG + Intergenic
1175995814 20:62811948-62811970 CCTGGTGGGGAGGAGCTGGCTGG - Intronic
1176069016 20:63216368-63216390 CCTGGCGGGAAGGGGCTGGCGGG + Intergenic
1176117937 20:63441186-63441208 CCTGCGGGGGAGGTGAGGGCGGG + Intronic
1176146535 20:63567974-63567996 CCTGGGGAGGTGGTGGTGGCAGG + Intronic
1176287491 21:5026024-5026046 CATGGGGAGGAGCGGCTGGATGG - Intronic
1176547262 21:8207349-8207371 CCCGAGGAGGAGCGGCTGGCGGG + Intergenic
1176555167 21:8251558-8251580 CCCGAGGAGGAGCGGCTGGCGGG + Intergenic
1176566213 21:8390396-8390418 CCCGAGGAGGAGCGGCTGGCGGG + Intergenic
1176574087 21:8434582-8434604 CCCGAGGAGGAGCGGCTGGCGGG + Intergenic
1176625374 21:9087671-9087693 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1176733293 21:10521210-10521232 CTTGCAGAGGAGGGGGCGGCGGG + Intergenic
1176867884 21:14063861-14063883 CCTGAGGAGGATGGCCTGTCTGG - Intergenic
1177157348 21:17512980-17513002 CCTGCCGAGCGGGGGCTGGGAGG + Exonic
1178493614 21:33070074-33070096 CCTGCGGGGCAGCGGGTGGCGGG - Intergenic
1179571858 21:42283205-42283227 CCTTCTGAGGGGGGGATGGCGGG + Intronic
1179712439 21:43271148-43271170 CCTGCGGAGGAGGATGTGGAGGG + Intergenic
1179869690 21:44237451-44237473 CATGGGGAGGAGCGGCTGGATGG + Intronic
1179948914 21:44698605-44698627 CCTGCCAAGTGGGGGCTGGCTGG + Intronic
1179949078 21:44699611-44699633 CAGGCGCAGCAGGGGCTGGCCGG - Intronic
1180054912 21:45352732-45352754 GAGGCCGAGGAGGGGCTGGCGGG - Intergenic
1180158587 21:45989334-45989356 CCTGCCAGGGAGGGGCTGGGTGG + Intronic
1180825169 22:18856655-18856677 CCTGGGGAGGGGGTGGTGGCAGG - Intronic
1180854537 22:19037807-19037829 GCTGCTGAGGAGGGGCCGGGAGG + Exonic
1180891378 22:19291550-19291572 CCGGCGGAGGCGCGGCTGACAGG + Intronic
1181187561 22:21117892-21117914 CCTGGGGAGGGGGTGGTGGCAGG + Intergenic
1181211637 22:21292601-21292623 CCTGGGGAGGGGGTGGTGGCAGG - Intergenic
1181325201 22:22039659-22039681 CATGCTGAGGAGGGGCTGGTAGG - Intergenic
1181397870 22:22634285-22634307 CCTGGGGAGGGGGTGGTGGCAGG + Intergenic
1181651537 22:24261773-24261795 CCTGGGGAGGGGGTGGTGGCAGG - Intergenic
1181705838 22:24648966-24648988 CCTGGGGAGGGGGTGGTGGCAGG + Intergenic
1182125922 22:27815814-27815836 CAAGGGGAGGAAGGGCTGGCAGG - Intergenic
1182501597 22:30752043-30752065 ACGGCTGAGGAAGGGCTGGCAGG - Intronic
1182697320 22:32205977-32205999 CCTGCGGTGGAGGGGTGGGTTGG + Intergenic
1182735122 22:32527918-32527940 CTTGCGGAGGTGGGCGTGGCTGG + Exonic
1183062430 22:35344440-35344462 GCTGCGGAAGCTGGGCTGGCCGG - Intronic
1183089139 22:35509538-35509560 GCAGCGGAGGTGGGGCTGGGAGG + Intergenic
1183376953 22:37471017-37471039 ACTGGGGAGTAGGGGCTGGCCGG - Intronic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1183535720 22:38399235-38399257 CTTGCAGAGGAGGGGGCGGCGGG - Intergenic
1183877660 22:40797827-40797849 GCTGCGGAGGAAGGGCTGGCCGG - Intronic
1183987016 22:41575559-41575581 GCTGAGGAGGAGGGACTGGCCGG - Exonic
1184066403 22:42124167-42124189 CCTGCTGAGCAGGAGGTGGCAGG + Intergenic
1184068871 22:42136319-42136341 CCTGCTGAGCAGGAGGTGGCAGG + Intergenic
1184250919 22:43259873-43259895 CCTGAGGAGAAGAGGCTGGAGGG - Intronic
1184407397 22:44307962-44307984 TGGGCTGAGGAGGGGCTGGCTGG - Intronic
1184422386 22:44389569-44389591 CCTGGGCAGGAGGAGCTGGTGGG + Intergenic
1184455007 22:44605078-44605100 CCTGGGGAGGAGGGGCATGAGGG + Intergenic
1184555637 22:45231528-45231550 CCTGGGGAGGGGGTGGTGGCAGG - Intronic
1184645088 22:45891166-45891188 ACCGCGGAGGTGGGGCCGGCGGG - Intergenic
1184654280 22:45933331-45933353 CCAGAAGAGGAGAGGCTGGCAGG - Intronic
1184663811 22:45977320-45977342 CCTGGGGAGGGGGGGCCGGGGGG - Intergenic
1184770444 22:46594104-46594126 GATGCTGGGGAGGGGCTGGCAGG - Intronic
1184770460 22:46594148-46594170 GCAGCTGGGGAGGGGCTGGCGGG - Intronic
1185272952 22:49937037-49937059 CCTGAGGAGGATGGGATGGTGGG - Intergenic
1185291784 22:50030993-50031015 TCTGTGCAGGAGGGGCTGGTCGG + Intronic
1203215316 22_KI270731v1_random:2831-2853 CCTGGGGAGGGGGTGGTGGCAGG + Intergenic
1203252135 22_KI270733v1_random:123634-123656 CCCGAGGAGGAGCGGCTGGCGGG + Intergenic
1203260189 22_KI270733v1_random:168717-168739 CCCGAGGAGGAGCGGCTGGCGGG + Intergenic
1203275314 22_KI270734v1_random:82558-82580 CCTGGGGAGGGGGTGGTGGCAGG - Intergenic
949394745 3:3602759-3602781 CCTGTGGAGGAAGGAGTGGCAGG + Intergenic
950011317 3:9726057-9726079 TCTGAGGAGGAGGGCTTGGCAGG + Intronic
950024815 3:9812993-9813015 CTTGCGCCGGAGGGGCTGGGTGG + Exonic
950496002 3:13334994-13335016 CCTGCGGGGCAGGGGCTGCAGGG - Intronic
950590856 3:13935009-13935031 CCTGAGAAGGAGGAACTGGCCGG + Intergenic
950712056 3:14819831-14819853 CCTGAGAAGGAGGAGCTGGCCGG + Exonic
951527952 3:23671776-23671798 GCTGAGGAGGAGGCGCTGCCAGG - Intergenic
952508991 3:34035409-34035431 CCTGAGGGGCTGGGGCTGGCTGG + Intergenic
953040732 3:39252902-39252924 CCTGGGGAGGAGTGGCTGGGAGG + Intergenic
953419997 3:42747024-42747046 GCTGCGGGGGTGGGGGTGGCAGG + Intronic
953754287 3:45633194-45633216 CCTGTGGAGGGGAGGGTGGCGGG - Intronic
953791545 3:45951531-45951553 CCTGTGGAGTAAGGGCTGGCAGG - Intronic
953800733 3:46020765-46020787 CCCGCAGATGAGAGGCTGGCGGG + Exonic
954378025 3:50205168-50205190 CCGCGGGAGGAGGGGCTGGTCGG - Intergenic
954809706 3:53240433-53240455 TCTGCAGAGGAAGGGCTTGCTGG - Intronic
956761270 3:72447118-72447140 TCGGCGGAGGCGGCGCTGGCGGG - Intergenic
957016469 3:75069879-75069901 CCAGAGGAGCAGGGGGTGGCGGG - Intergenic
959085731 3:101849398-101849420 CATCCGGAGGAGGGGCTGGGAGG + Intronic
959419325 3:106111790-106111812 CCTACGGACGGGCGGCTGGCCGG + Intergenic
960720704 3:120622393-120622415 CCCCTGGAGGAGGGACTGGCAGG + Intergenic
961610316 3:128132245-128132267 CCTGCGGTGATGAGGCTGGCCGG - Intronic
962746640 3:138401983-138402005 CCGCTGGAGGAGGGCCTGGCAGG - Intronic
963017331 3:140838384-140838406 CCTGGGGATGAGGGGCTTGGAGG + Intergenic
963162139 3:142161733-142161755 GCTGCAGAGGTGGGGCTGGGTGG + Intergenic
965099341 3:164276943-164276965 TCTGTGGAGGTGGGGCTTGCTGG - Intergenic
966182229 3:177197647-177197669 CGCGCGGGGGAGGGGCCGGCGGG + Intergenic
966843321 3:184106505-184106527 CCTGCGGAGGCAGAGCTGACAGG + Exonic
968446198 4:653529-653551 CGGGCGGAGGAAGGGCTGGTCGG + Intronic
968522745 4:1041481-1041503 CCTCCGGGGGAGGAGCTGACAGG - Intergenic
968551620 4:1226343-1226365 CCTGGGGAGGAGGAGGGGGCAGG + Intronic
968573474 4:1354319-1354341 CCAGCGGAGGAGAGGCCGGGGGG + Intronic
968582640 4:1402186-1402208 CCCGGGGAGAAGGGGCTGCCTGG - Intergenic
968636815 4:1684965-1684987 CCTGCAGAGGAGAGGGTGGCGGG + Intergenic
968758481 4:2428690-2428712 CCTGAGAAGGAGTGGCTGCCAGG - Intronic
968905278 4:3447972-3447994 CCTGCGGGGAAGGTGCTGCCGGG - Exonic
968922016 4:3527242-3527264 TCTGGGGAGAAGGGGCTGGGTGG - Intronic
969398521 4:6938550-6938572 CCTGGGGAGGGGGAGCTGCCAGG - Intronic
969444048 4:7234062-7234084 CCTGGGGAGATGGGGCTGCCAGG - Intronic
969483301 4:7458204-7458226 CGGGGGGAGGCGGGGCTGGCAGG + Intronic
969551207 4:7868651-7868673 GCATCTGAGGAGGGGCTGGCAGG + Exonic
969561441 4:7950677-7950699 CCTGAGGAGGATGGGTTGGAGGG - Intergenic
969568772 4:7995842-7995864 GGTGCCGAGGAGGGGCTGGGAGG - Intronic
969717906 4:8877336-8877358 CCTGAGGAGGAGGAGATGGGAGG + Intergenic
974110843 4:57523799-57523821 CCTGTGGTGGAGGGGCTGCTGGG - Intergenic
974715957 4:65669509-65669531 CCTGGGGCGGAGGGGCTAGGCGG - Intronic
975732789 4:77354048-77354070 CCTGTGGAGAAGGAACTGGCAGG + Intronic
975734379 4:77367144-77367166 CCTGTGGAGAAGGAACTGGCAGG + Intronic
976560804 4:86498234-86498256 CCTGCAGAGCAAGGCCTGGCAGG + Intronic
976762869 4:88569105-88569127 CCTGTGGTGGTGGGGCTAGCTGG + Intronic
981259357 4:142701284-142701306 CCTACTGTGGAGAGGCTGGCAGG - Intronic
985111936 4:186555312-186555334 CCCGCGGAGCACGGGCTGGGAGG + Exonic
985150944 4:186946368-186946390 CCTGCGGTGGCGGGGCAGGGGGG + Intergenic
985576114 5:674264-674286 CCTGCTGAGGAGCAGCTGCCAGG + Intronic
985621928 5:960345-960367 CCTGCTGAGAAGGGGTTGCCAGG - Intergenic
985693522 5:1326766-1326788 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693553 5:1326969-1326991 CCTGTGGAGGAGGAGCTGGATGG - Intronic
985693565 5:1327027-1327049 CCTGTAGAGGAGGAGCTGGGTGG - Intronic
985693572 5:1327056-1327078 CCTGTCGAGGAGGAGCTGGGTGG - Intronic
985693603 5:1327259-1327281 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693616 5:1327346-1327368 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693621 5:1327375-1327397 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693635 5:1327462-1327484 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693646 5:1327520-1327542 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693682 5:1327752-1327774 CCTGTAGAGGAGGAGCTGGGTGG - Intronic
985693755 5:1328245-1328267 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693760 5:1328275-1328297 CCTGTAGAGGAGGAGCTGGATGG - Intronic
991505012 5:67315589-67315611 TGTGCGGAAGTGGGGCTGGCTGG + Intergenic
992105913 5:73448661-73448683 TCAGCTGAGGAGGGGGTGGCGGG + Intergenic
997340569 5:133141319-133141341 GGTGGGGAGGAGGGGCAGGCAGG + Intergenic
997471030 5:134116926-134116948 CCAGTGCAGGTGGGGCTGGCAGG + Intronic
998136365 5:139676471-139676493 CCTGGGGAGGAGGGCTTGGGGGG - Intronic
998137016 5:139679191-139679213 CCTGCAGAGTAGGGCCTGGGTGG - Intronic
998165397 5:139839783-139839805 CCTGCGGTGGGGTGGCTGGGGGG + Intronic
998851501 5:146355281-146355303 ACTGGGGAGGAGCGGTTGGCGGG - Intergenic
999695991 5:154189626-154189648 CCCGAGGAGGAGCCGCTGGCTGG + Intronic
999726868 5:154445422-154445444 CATGCGGAGGAGGTGATGGGGGG - Intergenic
1002082068 5:176743261-176743283 CCCCCGGAGGAGGGGCAAGCAGG - Intergenic
1002924759 6:1599029-1599051 CCTGGGGAGCAGAGGCTGCCTGG - Intergenic
1002927672 6:1614369-1614391 TCTGTGGAGTAGGGGGTGGCGGG + Intergenic
1003735871 6:8877020-8877042 CCTGCGCAGGAGGTGCTGCTTGG - Intergenic
1004268983 6:14177072-14177094 GCTGGGGAGAAGTGGCTGGCAGG + Intergenic
1004350000 6:14882647-14882669 CCTGGGGAGCAGGAGCTGTCAGG + Intergenic
1005838210 6:29723612-29723634 CCTCCGGAGGAGGGTCTGGCGGG + Intronic
1005905732 6:30260375-30260397 CCTGCGGAGGAGGCGCCTGTCGG - Intergenic
1006296778 6:33173373-33173395 CCTGGGAAGGATGGGCTGCCGGG - Exonic
1006337365 6:33427752-33427774 CCTGCTCAGGAGGGGATGGTGGG + Intronic
1006640622 6:35487917-35487939 ACTGGGGAGGAGGAGCTGACAGG - Intronic
1007345705 6:41228227-41228249 CCAGGGGAGGAGGGGCAGCCAGG - Intergenic
1007431726 6:41780654-41780676 CCAGCCGGGGAGGGGCGGGCGGG + Intronic
1007525289 6:42487214-42487236 CCTGAGCAGGAGGGTCTGACTGG - Intergenic
1007712715 6:43834899-43834921 CCTGTGGAGGGAGGGCTGCCTGG - Intergenic
1007780108 6:44247747-44247769 CCGGTGGAGGAGGGGCGGGGAGG + Intronic
1011626352 6:89286734-89286756 GCTGCAGAGGAGGGGCTGTGTGG + Intronic
1012490709 6:99780091-99780113 CTTGTGCAGGTGGGGCTGGCTGG + Intergenic
1013117748 6:107115381-107115403 GCTGAGGGGGAGGGGCGGGCCGG - Intergenic
1017000915 6:149996422-149996444 CCTGCAGAGGAGGAGGGGGCAGG + Intergenic
1017626669 6:156356382-156356404 CCTCCTCAGGAGGGGCTGCCTGG + Intergenic
1017728209 6:157290803-157290825 CCTGCAGAGGGGAGGCTGGCAGG - Exonic
1018144917 6:160877079-160877101 CCTACCTAGGAGGGGCTGGCAGG - Intergenic
1018239944 6:161763847-161763869 CGTGTGGAGGAAGGGCAGGCAGG - Intronic
1019274709 7:169939-169961 CGGGCTGAGGAGGGGCTGGCAGG - Intergenic
1019286105 7:223946-223968 CCTGGGGTGGAGGGCCGGGCAGG - Intronic
1019301612 7:307046-307068 CCTGGAGAGGAGGGGCAGTCAGG - Intergenic
1019561621 7:1662161-1662183 TCTGCTGAGGATGGCCTGGCTGG - Intergenic
1019577679 7:1745421-1745443 CCGGCGGAGGCGGGGGCGGCGGG - Exonic
1019616435 7:1964997-1965019 CCCACTGGGGAGGGGCTGGCGGG - Intronic
1019701718 7:2477518-2477540 CCTGCGGATGGGGGACTGGAGGG - Intergenic
1019802216 7:3096356-3096378 CCTGCGAAAGAGAGGCTGCCTGG + Intergenic
1020037531 7:4973932-4973954 GCTGCGGAGGAGGGACCGGGGGG - Intergenic
1020096911 7:5374481-5374503 CCTGCTGGGAAGGGGCCGGCAGG + Exonic
1020162305 7:5781737-5781759 ACTGCGGAGGAGGGACCGGGGGG + Exonic
1021274729 7:18636284-18636306 CCAGGGCAGGGGGGGCTGGCAGG - Intronic
1021374862 7:19894035-19894057 CCTGCTGAGGAGTGGGGGGCTGG + Intergenic
1021969269 7:25951069-25951091 CCGGCGCTGGAGGGGCAGGCTGG - Intergenic
1022534514 7:31087496-31087518 CTCTCTGAGGAGGGGCTGGCTGG - Intronic
1023715391 7:43038611-43038633 ACGGAGCAGGAGGGGCTGGCTGG - Intergenic
1023875203 7:44283004-44283026 TCCATGGAGGAGGGGCTGGCCGG - Intronic
1024216656 7:47254383-47254405 CCTGCGGGGGAGGGGGTGAGCGG - Intergenic
1025021666 7:55485250-55485272 CCTGTGGAGGAGAAGCTGGTGGG - Intronic
1025036118 7:55593364-55593386 ACACTGGAGGAGGGGCTGGCCGG + Intergenic
1025607093 7:63047325-63047347 CCAGATGAGGTGGGGCTGGCTGG - Intergenic
1026360878 7:69599757-69599779 CCGGCGGCGGCGGGGCTGGCCGG + Exonic
1026767865 7:73171847-73171869 CCTGCCAAGGAGGGCCTGCCTGG - Intergenic
1027044333 7:74981555-74981577 CCTGCCAAGGAGGGCCTGCCTGG - Intronic
1027079308 7:75220803-75220825 CCTGCCAAGGAGGGCCTGCCTGG + Intergenic
1027839084 7:83284301-83284323 CCTGGGCAGGAGGGGCTTGGGGG - Intergenic
1029272700 7:99386370-99386392 CCAGCTGGGGAGGGGCTGGCAGG + Intronic
1029348114 7:99993302-99993324 CCTGCGTATTAGGGGATGGCTGG - Intergenic
1029388536 7:100259384-100259406 CCTGCCAAGGAGGGCCTGCCTGG + Intronic
1029510722 7:100993246-100993268 CCTGAGGTGGTGGTGCTGGCAGG - Exonic
1029511213 7:100996495-100996517 CCTGAGGTGGTGGTGCTGGCAGG - Exonic
1029511439 7:100997917-100997939 CCTGAGGTGGTGGTGCTGGCAGG - Exonic
1029511941 7:101001166-101001188 CCTGAGGTGGTGGTGCTGGCAGG - Exonic
1029512495 7:101004907-101004929 CCTGAGGTGGTGGTGCTGGCAGG - Exonic
1031886767 7:127252461-127252483 CCAGGGGGCGAGGGGCTGGCCGG - Intronic
1032263316 7:130353421-130353443 CCAGGAGAGGAGGTGCTGGCTGG - Intronic
1032291249 7:130591413-130591435 CCTCCGGACGGGCGGCTGGCCGG - Intronic
1032500360 7:132395290-132395312 GCTGAGGACAAGGGGCTGGCTGG + Intronic
1034198758 7:149267370-149267392 CCTGGGCAGGAGTGGGTGGCTGG + Intronic
1034509577 7:151522728-151522750 CCTGCTGAGGAGAAGCTGACTGG - Intergenic
1034556562 7:151854083-151854105 ACTGCAGAGCAAGGGCTGGCTGG - Intronic
1035199116 7:157248800-157248822 GCTCCGCAGGAGGGGCTGCCGGG - Intronic
1036664678 8:10730718-10730740 CTGGCGGCGGAGGGGCGGGCCGG - Intronic
1036932737 8:12972288-12972310 CCCGTGGAGGCGGGGCTGGCCGG + Intronic
1037771349 8:21801934-21801956 CCTGCAGATGAGGGTGTGGCAGG + Intronic
1037947264 8:22997203-22997225 GCTGCAGAGGATGGGCTGGGGGG + Intronic
1039888871 8:41671252-41671274 CCTTTGAAGGAGGGGCTGGTGGG - Intronic
1039910706 8:41824867-41824889 GCTGCAGAGCTGGGGCTGGCTGG + Intronic
1040076978 8:43246690-43246712 CCTGCGGCGGAGGAGCGGGGCGG + Intergenic
1040310987 8:46236744-46236766 CCTGGGGAGGGGGGGCTGCTGGG + Intergenic
1040355878 8:46617695-46617717 CGTGCAGAGGCGGGGCTCGCGGG + Intergenic
1040599567 8:48870401-48870423 CCTGCGCGGGAGGGGCGGCCGGG + Intergenic
1041304919 8:56448110-56448132 CCTGCGTAGGCTGGGCTTGCGGG + Intergenic
1043303389 8:78762548-78762570 CGCGCGGGGGAGGGGCGGGCGGG + Intronic
1044115504 8:88328661-88328683 CGAGCGGGGGAGAGGCTGGCGGG + Intergenic
1044306465 8:90645931-90645953 GCCGCGGCGGAGGGGCTGGCCGG - Exonic
1045055549 8:98364927-98364949 ACTCCGGAGGAGGGGATGACTGG - Intergenic
1047182607 8:122603999-122604021 CCTGCGGAGGTGGGGTAGGGAGG - Intergenic
1049003851 8:139842642-139842664 CCCATGGAGGAGGGGCTGGCAGG + Intronic
1049149803 8:141027249-141027271 CCTGGGGGAGAGGGGCTGGGAGG - Intergenic
1049196977 8:141321012-141321034 GCTGGGGTGCAGGGGCTGGCTGG + Intergenic
1049245025 8:141557800-141557822 CCTGCCGGGGAGGGGCTGCAAGG + Intergenic
1049288303 8:141788444-141788466 CATGCTGGGGAGGGGGTGGCTGG - Intergenic
1049499216 8:142952554-142952576 CCTGTGGCTGAGGGGGTGGCTGG + Intergenic
1049643625 8:143726591-143726613 CCCGCGGAGGAGGGGCCGAGCGG - Exonic
1049732329 8:144185030-144185052 GCTGAGGAGGAGGGGGAGGCAGG + Intronic
1049762053 8:144336198-144336220 CCTGCGGAGCCGGGGCTTGGGGG + Exonic
1049782656 8:144435935-144435957 CCGGAGGAGGAGTGCCTGGCCGG - Exonic
1053149230 9:35732299-35732321 CCTGCCAGGGAGGGGCTGCCGGG - Exonic
1053656589 9:40222946-40222968 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1053885040 9:42637271-42637293 CCTCAGGAGGAGGGCCTGTCTGG + Intergenic
1053906944 9:42852168-42852190 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1054224061 9:62444722-62444744 CCTCAGGAGGAGGGCCTGTCTGG + Intergenic
1054357008 9:64071393-64071415 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1054368694 9:64369168-64369190 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1054528025 9:66153339-66153361 CCTGAGAAGGAGGGCCTGTCTGG + Intergenic
1054781960 9:69174091-69174113 CCTGCCGGGGAAGGGCTCGCCGG - Intronic
1055090810 9:72364229-72364251 CCTGCAGGCGAAGGGCTGGCCGG - Intronic
1055539852 9:77291837-77291859 CATGAGGAGGAGGGGCAGGATGG - Intronic
1055565949 9:77568667-77568689 CCTGAGGAGGAAAGGCTGACTGG + Intronic
1055876819 9:80953536-80953558 TCTGGGCAGGACGGGCTGGCAGG - Intergenic
1056338721 9:85603016-85603038 CCTTCGGTGGTGGGGCTAGCCGG - Intronic
1057128966 9:92640256-92640278 TCTGCGGAGGAGAGGCTGCTGGG - Intronic
1057152667 9:92808784-92808806 CCAGCAGAGGAGGAGCTGGGCGG + Intergenic
1057353633 9:94318944-94318966 CCTGGGGAGGAGAGGTTGGCCGG + Exonic
1057654118 9:96938648-96938670 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1059245325 9:112844833-112844855 CCTGTGGGGAAGGGGCGGGCAGG - Intronic
1059411475 9:114135044-114135066 CCTGAAGGGGAGGGGCTGTCAGG + Intergenic
1060105137 9:120868838-120868860 CCTCGGGAGGCGGGCCTGGCGGG - Intronic
1060230573 9:121822493-121822515 CCTGCAGAGGAATGGCAGGCAGG - Exonic
1060281470 9:122218565-122218587 TCTGTGGAGGATGGGTTGGCAGG - Intronic
1060347054 9:122826639-122826661 CCTGCAGAGGCTGAGCTGGCAGG - Exonic
1060658397 9:125388363-125388385 GCTGGGGAGGAGGTGCTGGGAGG - Intergenic
1061033833 9:128102577-128102599 CCTGTGGAAGAGGAGGTGGCTGG - Intronic
1061303419 9:129719209-129719231 CCTGCGGAGGTTGGGGGGGCGGG - Exonic
1061306647 9:129736376-129736398 CCTGCTGGGGAGCGGCTGCCTGG - Intergenic
1061773269 9:132944314-132944336 CCTGGGGAGGAGAGGCGAGCCGG - Intronic
1061804214 9:133129091-133129113 TCTGCCGGGGAGGGGCTGGGTGG - Intronic
1061805088 9:133133353-133133375 CCCGAGGAGGTGGTGCTGGCAGG + Intronic
1061917270 9:133761851-133761873 CCAGGGGAGGAGGGAATGGCTGG - Intergenic
1062164548 9:135100827-135100849 CCAGCAGAGGAGGTGCTGGTAGG + Intronic
1062318227 9:135978450-135978472 GCTGCTGAGGAGGGGATGGGGGG - Intergenic
1062341296 9:136094965-136094987 CCCGCGGAGGGGGGCCGGGCGGG - Intronic
1062361610 9:136190890-136190912 CCTGTGCAGGAGAGGCTAGCGGG + Intergenic
1062442405 9:136576635-136576657 CCAGCGGAGGCTGGGCTGTCAGG + Intergenic
1062457521 9:136646606-136646628 CCGGAGCAGGAAGGGCTGGCGGG - Intergenic
1062594958 9:137295416-137295438 CCTGGGGCCGAGGGGCTGGCAGG + Intergenic
1062595433 9:137297012-137297034 GCCACGGTGGAGGGGCTGGCAGG - Intergenic
1062620396 9:137417888-137417910 CCCGTGGGTGAGGGGCTGGCGGG + Intronic
1062624504 9:137436702-137436724 CCTCCGGAGGAGATGCTGGTGGG - Exonic
1203748548 Un_GL000218v1:58132-58154 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1203468538 Un_GL000220v1:106784-106806 CCCGAGGAGGAGCGGCTGGCGGG + Intergenic
1203476359 Un_GL000220v1:150756-150778 CCCGAGGAGGAGCGGCTGGCGGG + Intergenic
1203561172 Un_KI270744v1:59888-59910 CCTGAGAAGGAGGGCCTGTCTGG + Intergenic
1186640385 X:11449253-11449275 CTTGCGAAGGTGGGGATGGCAGG - Intronic
1187026593 X:15441666-15441688 CCTGAGGATGAGGGGGAGGCAGG + Intronic
1187245002 X:17546083-17546105 CCTGAGGAGGAAGTGCTGCCTGG + Intronic
1187900803 X:24025443-24025465 CCCAGGGAGGCGGGGCTGGCCGG + Intronic
1189534715 X:41923876-41923898 GCTGCCGAGGCGGGGCTGGTTGG + Intergenic
1189539687 X:41972709-41972731 CCTGAGGAGGGGGTGCTGGCTGG + Intergenic
1190325584 X:49205081-49205103 CCTGCTGGGGAGGGGAGGGCAGG + Exonic
1192172879 X:68867719-68867741 CCTCTGGAGGATGGGCTGGTAGG - Intergenic
1192318169 X:70067628-70067650 CTTGAGGAAGAGGGTCTGGCTGG + Intergenic
1192359924 X:70433012-70433034 CCTGGGGAGGAGGGGGAGGGTGG - Exonic
1192435256 X:71139383-71139405 CCTGGGGAGAAGGGCCTGGATGG + Intronic
1192855115 X:75000615-75000637 CCTGTGGTGGAGAGGCTTGCTGG + Intergenic
1195595354 X:106682867-106682889 CCTGTGGTGGTGGGGCTTGCTGG - Intergenic
1197079790 X:122398358-122398380 CCTGCTGTGGTGGGGGTGGCAGG - Intergenic
1197854754 X:130902923-130902945 CCTGCAGAGGTGGAGCTGGGTGG + Intronic
1199980525 X:152918099-152918121 CCAGAGGAGGAGGGGCGGGGAGG - Exonic
1200232350 X:154450316-154450338 CACGGTGAGGAGGGGCTGGCAGG + Exonic
1201145392 Y:11062320-11062342 CCTGCTGGGGAGTGGGTGGCAGG - Intergenic
1201161892 Y:11173102-11173124 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic