ID: 1126704917

View in Genome Browser
Species Human (GRCh38)
Location 15:51397683-51397705
Sequence TTGTTTTAATAGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 401}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126704910_1126704917 -3 Left 1126704910 15:51397663-51397685 CCCAGGCTCTGTGACCAGATTTG 0: 1
1: 0
2: 3
3: 37
4: 221
Right 1126704917 15:51397683-51397705 TTGTTTTAATAGAGGGAGGAGGG 0: 1
1: 0
2: 1
3: 37
4: 401
1126704907_1126704917 16 Left 1126704907 15:51397644-51397666 CCAAACTCTTGGTCTGCTCCCCA 0: 1
1: 0
2: 1
3: 18
4: 219
Right 1126704917 15:51397683-51397705 TTGTTTTAATAGAGGGAGGAGGG 0: 1
1: 0
2: 1
3: 37
4: 401
1126704911_1126704917 -4 Left 1126704911 15:51397664-51397686 CCAGGCTCTGTGACCAGATTTGT 0: 1
1: 0
2: 0
3: 25
4: 246
Right 1126704917 15:51397683-51397705 TTGTTTTAATAGAGGGAGGAGGG 0: 1
1: 0
2: 1
3: 37
4: 401
1126704909_1126704917 -2 Left 1126704909 15:51397662-51397684 CCCCAGGCTCTGTGACCAGATTT 0: 1
1: 0
2: 1
3: 21
4: 236
Right 1126704917 15:51397683-51397705 TTGTTTTAATAGAGGGAGGAGGG 0: 1
1: 0
2: 1
3: 37
4: 401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126704917 Original CRISPR TTGTTTTAATAGAGGGAGGA GGG Intronic
900683781 1:3933785-3933807 TTTTTTTAATAGAGAGAGACAGG - Intergenic
903187719 1:21638572-21638594 TTGTTTAAAGAGAAAGAGGACGG - Intronic
903980290 1:27181695-27181717 TTGTTTAAAAAGAGGGATGTCGG + Intergenic
904124754 1:28230318-28230340 CTGTTTTCATAGAGTGAAGAGGG - Intronic
905592609 1:39177615-39177637 TTGTGTTCATAGAGGAAGGTAGG + Intronic
905889190 1:41509209-41509231 TTTTTTAAAAAGAGAGAGGATGG - Exonic
906288872 1:44606368-44606390 TAGTTTTAAGAGAAGGAGGAAGG + Intronic
906729003 1:48065102-48065124 TTATTTTAATAGAGAGTGGCAGG + Intergenic
908019119 1:59881557-59881579 TTGTTTAAATGGTGGCAGGAGGG + Intergenic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
909620772 1:77664146-77664168 TTGTTTAAATAGAATGATGATGG - Intronic
909753056 1:79188659-79188681 TCATTTTACTACAGGGAGGAAGG + Intergenic
909931926 1:81506332-81506354 TTGTTTTAAATGAGGGTGGAGGG + Intronic
910629343 1:89340071-89340093 TTTTTTTAATAGAGACAGGGAGG + Intergenic
910751904 1:90640179-90640201 TTGCTTTAATAGACGGAGGCAGG - Intergenic
911243860 1:95495575-95495597 TTGCTTTAATTAAGGGAGGGAGG + Intergenic
911370905 1:96993631-96993653 TTGTGCTAATAGACTGAGGAGGG - Intergenic
911680501 1:100710017-100710039 TTCTTTTAATAGACTGAGGAGGG + Intergenic
912106946 1:106290767-106290789 TTTTGCTATTAGAGGGAGGAAGG + Intergenic
912725434 1:112055269-112055291 TTTTTTTAATGCAGGGAGAAAGG + Intergenic
913351385 1:117864323-117864345 CTGTTTTAATAGGGGAATGATGG + Exonic
914941953 1:152030912-152030934 TTTTTTTAAGAGAGAGAGAATGG - Intergenic
915109850 1:153556419-153556441 TTGGCTAAGTAGAGGGAGGAAGG + Intergenic
915431410 1:155869693-155869715 TTGTATTAGAAGAGGGACGAGGG + Intronic
916179106 1:162069383-162069405 TTGTTTTTGGAGAGGGGGGAGGG - Intergenic
917442699 1:175081015-175081037 TTGTTTTGGTAGAGGGATGCAGG + Intronic
917492674 1:175511442-175511464 TTGATTTGATAGAGGAATGATGG + Intronic
918652912 1:186987901-186987923 TTGTTTCAGTTGAGGAAGGAAGG + Intronic
919454808 1:197808590-197808612 TTGTTCTAATAGTTTGAGGATGG + Intergenic
919465354 1:197918034-197918056 TTGGTTTAACAGAGGGCGCAGGG - Intronic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
921580049 1:216885828-216885850 TTGTTTTATCTGAGGGAGGGAGG - Intronic
921641678 1:217562191-217562213 GTGTTTTAAAAAAGGGAGGGGGG - Intronic
921767613 1:218990711-218990733 TTGTCTTAATGGAAGGAGAAAGG - Intergenic
922085883 1:222346481-222346503 TGGTTTAACTAGAGGTAGGAAGG + Intergenic
922204363 1:223433639-223433661 TTTTTTTAATAGAGGAATAAGGG + Intergenic
922318974 1:224467943-224467965 ATGATTTAATAGAGGAAGGACGG - Intronic
923134075 1:231102198-231102220 ATGTTTTATTTGAGGGTGGATGG - Intergenic
923590998 1:235319704-235319726 TTTTTTAAAAAAAGGGAGGACGG + Intronic
1063603557 10:7503668-7503690 TACTATTAATAAAGGGAGGATGG + Intergenic
1063670070 10:8093132-8093154 TTTTTTTAATAGAGAGAGACAGG - Intergenic
1064065840 10:12180861-12180883 TTGGTGAACTAGAGGGAGGAAGG - Intronic
1064937438 10:20693749-20693771 TTGGTTTGTTGGAGGGAGGAAGG + Intergenic
1065251902 10:23823837-23823859 TTGTTTTAAAAAGGGGTGGAAGG + Intronic
1065896509 10:30167425-30167447 TTTTTTTAAAAAAGGGAGGCCGG - Intergenic
1067019437 10:42782189-42782211 TTTTTTTAAGAGAGAGAGGTAGG + Intergenic
1067196698 10:44126020-44126042 CTTTCTTAATAGATGGAGGAGGG + Intergenic
1067480243 10:46591029-46591051 TAGATTTATTAGAGGGAGCATGG + Intronic
1067614494 10:47750771-47750793 TAGATTTATTAGAGGGAGCATGG - Intergenic
1068030200 10:51697513-51697535 TTTTTTTAATTGAGGGTGGGGGG - Exonic
1068107289 10:52634695-52634717 TATTTTTAATAGTGGGGGGAGGG - Intergenic
1068132444 10:52911678-52911700 TTATTTTTATAGAGACAGGAGGG + Intergenic
1068539007 10:58270387-58270409 TTTTTTTAATAGAGGCAGCTTGG + Intronic
1071629899 10:87210742-87210764 TAGATTTATTAGAGGGAGCATGG - Intergenic
1071806973 10:89133223-89133245 TTGATTTAAGGGAGGGGGGAGGG - Intergenic
1072005770 10:91245386-91245408 TTGTTTTAAGAGAGGAAAGGAGG + Intronic
1072228325 10:93390708-93390730 TTGTTTTAGTGGAGGGATGTTGG + Intronic
1073206451 10:101771855-101771877 TGGTTTAAAAAGAGGGTGGAAGG - Intronic
1073369415 10:102973818-102973840 TTGTTTTAAAAAAGGGGGGGGGG - Intronic
1074781284 10:116804141-116804163 TCGTTTTTTTGGAGGGAGGAGGG - Intergenic
1075283314 10:121160247-121160269 TTGTTTTAATAAAGTGGAGATGG - Intergenic
1077937689 11:6806419-6806441 GTGGGTTACTAGAGGGAGGAGGG - Intergenic
1079231799 11:18655542-18655564 TTCTTTTAAAAAAGGGAGGGGGG - Intergenic
1079640602 11:22800208-22800230 TTGTTCTTATGGAGGGATGAGGG + Intronic
1079684444 11:23339956-23339978 CTGTTTCAAGAGAGAGAGGAAGG - Intergenic
1080649015 11:34208361-34208383 TTCCTTTATTAGAGGGAAGAGGG + Intronic
1081728303 11:45348862-45348884 TAGTATTAATAGAAGGAGCAAGG + Intergenic
1081954045 11:47074027-47074049 TTTTTTTAATAGAAGAAGAAAGG - Intronic
1083338587 11:61944077-61944099 TTATTTTGAAGGAGGGAGGAAGG - Intergenic
1084292105 11:68179295-68179317 TTCTATTAAGGGAGGGAGGACGG - Intronic
1086180842 11:83949807-83949829 TTATTTTTTTAGAGGCAGGAAGG - Intronic
1087752070 11:102017966-102017988 TTGTTTTAATAGGGGAAAAAAGG - Intergenic
1088856587 11:113760679-113760701 TTTTTTTTTTAGAGGGGGGAGGG - Intronic
1089133623 11:116231950-116231972 TTGTTTAAATAGAATGAGAATGG - Intergenic
1089474616 11:118748731-118748753 TTTTTTTAATAGGGGTGGGAGGG - Exonic
1090568713 11:128024299-128024321 TTGTTTTATCAAAGGGAAGAAGG + Intergenic
1090925591 11:131247242-131247264 TTGTTTTAAAAGGGGGATGGGGG + Intergenic
1091414430 12:268898-268920 TTTTTTTAATGGAGGGAATACGG - Intergenic
1091424709 12:377010-377032 TTGTTTTAGAAAAGGGAGGAAGG - Intronic
1091696316 12:2630500-2630522 CTGTTGAAATAGTGGGAGGAGGG + Intronic
1091734808 12:2911951-2911973 TTTTTTTAAGAGATGGAGGGTGG - Intronic
1092373508 12:7936364-7936386 TGGTTTTAAGAGAGGGGGGAGGG - Intergenic
1094556816 12:31509084-31509106 TTTTTCTGATGGAGGGAGGAAGG - Intronic
1096031659 12:48421532-48421554 TTTTTTTTTTAGATGGAGGATGG + Intergenic
1097281707 12:57848700-57848722 TTGTTTTAATGATGGGAGGTGGG - Intergenic
1098387231 12:69932348-69932370 TTGTTTTCAGAGAGGCAGGGAGG + Intronic
1099019745 12:77388826-77388848 TTGTTTTAATGATGGGAGGGTGG + Intergenic
1099853437 12:88134259-88134281 TTGTTGGAGGAGAGGGAGGATGG - Intronic
1100102354 12:91124339-91124361 TTGTTTCAATAGTGCGAAGAAGG - Intergenic
1100981384 12:100165482-100165504 TAGTTTAAATGGTGGGAGGAAGG - Intergenic
1101520740 12:105479762-105479784 TTGTTGTAACAGAGGGAGCAGGG + Intergenic
1102582196 12:113896779-113896801 TTGTTGTAATAGAGCCAGAAAGG - Intronic
1104193351 12:126505362-126505384 TAGATTAAATAGATGGAGGATGG + Intergenic
1105652845 13:22399449-22399471 TTTTTTTTAAAGAGGGAGAAAGG + Intergenic
1106181412 13:27372604-27372626 TTGTTTTCAGAGAGAGAGGAAGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107500050 13:40964517-40964539 TTTTTTTAATTGAGACAGGATGG + Intronic
1108487977 13:50946598-50946620 TTGTTTTAAAAGTAGGAGAAGGG + Intronic
1109349114 13:61154085-61154107 TTGTCTTAGAAGATGGAGGAAGG + Intergenic
1109401568 13:61836696-61836718 TTTTTTTAATAGAAAGATGAAGG + Intergenic
1109555296 13:63966355-63966377 TTATTTTAATTGGGGGAAGACGG + Intergenic
1112047926 13:95616348-95616370 TTGTTTTCATAGATGGAGAAAGG - Intronic
1113224821 13:108147845-108147867 ATGATTGAATAGATGGAGGATGG - Intergenic
1114346491 14:21801091-21801113 TTATTTTGAGAGAGGGATGAAGG - Intergenic
1114856030 14:26445122-26445144 TTGTTTTGCTATAGGGAGGCTGG - Intronic
1115539935 14:34411096-34411118 TTATTTAAATAGAGTGAAGAAGG + Intronic
1115629803 14:35232971-35232993 CTGTTGTAAAAGAGGAAGGAGGG - Intronic
1115749818 14:36477868-36477890 TTTATTTTATAGATGGAGGAGGG - Intronic
1115910145 14:38247275-38247297 TTGTTTCAAAAGGGGAAGGAAGG - Intergenic
1116786545 14:49294712-49294734 TTGGTTTAATTAAGGGTGGATGG - Intergenic
1117521580 14:56556867-56556889 ATGTTCTAATAGAGGGATGAAGG - Intronic
1117793130 14:59362028-59362050 TTTTTTTAATGTAGGGAGTAGGG + Intronic
1118054370 14:62063854-62063876 GTGTGTTAATAAAGGGATGAAGG + Intronic
1118174792 14:63427605-63427627 TTTTTTTAATAGAGAGATGGGGG - Intronic
1118210850 14:63764514-63764536 TTTTTTTAAGAGATGGAGGCGGG - Intergenic
1118510328 14:66464915-66464937 TAATTTAAATAGATGGAGGAAGG - Intergenic
1118790533 14:69087762-69087784 TTATTTTAAAAGATGGAGGAAGG + Intronic
1120358523 14:83464525-83464547 TTGTTTTAATTGAGGAAATAGGG - Intergenic
1120613986 14:86678831-86678853 TTGTTTTTATAGACAGAGAAGGG + Intergenic
1120913078 14:89685487-89685509 TTCTTTTATAAAAGGGAGGAGGG + Intergenic
1124560232 15:30766694-30766716 TTTTTTTTTTAGAGGGAGGCTGG + Intronic
1125065231 15:35475150-35475172 TTTCTTAAATAGAGAGAGGAAGG + Intronic
1125453818 15:39836714-39836736 TTGTTCTAAGAGAAGGAGAAAGG + Intronic
1126704917 15:51397683-51397705 TTGTTTTAATAGAGGGAGGAGGG + Intronic
1127371874 15:58349056-58349078 TTGTTTTGATGGAGGGAACAAGG + Intronic
1127927225 15:63558559-63558581 TTGTTTTAATAAAGAGCGGGGGG - Intronic
1128384734 15:67139410-67139432 ATGATTTCATTGAGGGAGGAGGG - Intronic
1128759473 15:70206100-70206122 TTATTTTCAGAGAGGAAGGATGG + Intergenic
1129946623 15:79543946-79543968 TTGGTTTTAGTGAGGGAGGATGG - Intergenic
1131611680 15:93970969-93970991 TTTTTTTAATAGAGGAAATAAGG + Intergenic
1132042254 15:98535305-98535327 TAGTTTTAGTAGAGGGGGGGAGG - Intergenic
1133610131 16:7425734-7425756 ATTTGTTAAAAGAGGGAGGAGGG - Intronic
1133917179 16:10119736-10119758 TAGTTCTAATCGAGGGCGGAGGG - Intronic
1133966804 16:10537603-10537625 GTGTCTCAATAGAGAGAGGAGGG - Intronic
1134365531 16:13574225-13574247 TTATTTAAATAGAGGGATGAGGG - Intergenic
1135122373 16:19777582-19777604 ATCTTCAAATAGAGGGAGGAAGG + Intronic
1135243498 16:20832737-20832759 TTGCTTCAATAGAGAGAGGAAGG - Intronic
1135405630 16:22195561-22195583 TTTTTTTAATGGAAGGGGGAAGG - Intergenic
1135751311 16:25060685-25060707 TTGTTTTGGTAGAGGGAGAAAGG + Intergenic
1137875921 16:51996708-51996730 TGGTTTAAAGAGGGGGAGGAGGG - Intergenic
1138971658 16:62151494-62151516 CTGGTCTAATAGAGGAAGGAAGG - Intergenic
1139451426 16:67030280-67030302 TTATTCTAATAGAGAGGGGAGGG + Intronic
1140903713 16:79392972-79392994 TTCTTTTAAGAGAGGGCGGCAGG - Intergenic
1141155545 16:81594120-81594142 TTGTCTCAAAAAAGGGAGGAGGG - Intronic
1144026706 17:11283440-11283462 GTGCTTTAATAGAGGCAGGATGG - Intronic
1145193769 17:20869177-20869199 GTGTTTTGATAGATGGAGGGGGG + Intronic
1145298258 17:21611962-21611984 GTGTTTTGATAGATGGAGGGGGG - Intergenic
1145351992 17:22091404-22091426 GTGTTTTGATAGATGGAGGGGGG + Intergenic
1146066827 17:29642596-29642618 CTGTTTTTATAGATGGGGGATGG - Intronic
1146082500 17:29793639-29793661 TTTTTTTAAAAAACGGAGGAAGG + Intronic
1146508348 17:33424709-33424731 TTGTTGAAAGAGAGGAAGGAAGG - Intronic
1146938621 17:36828040-36828062 TTGTTTTTTTGGAGGGGGGAGGG + Intergenic
1148092635 17:45031782-45031804 ATGTCTTAATAGAGTCAGGATGG - Intronic
1148590898 17:48816277-48816299 TTGTTTTAAGAGATGGAGGTGGG - Intronic
1148728687 17:49816575-49816597 TTTTTTTAATACAAGGGGGAAGG - Intronic
1149518966 17:57303958-57303980 CTGAATTACTAGAGGGAGGAGGG + Intronic
1149998969 17:61420341-61420363 TTGTTTGTATGGAGGGAGGTGGG - Intergenic
1150021384 17:61617437-61617459 TTGTTTTAATAAAAGGAGAAAGG + Intergenic
1151022397 17:70632456-70632478 ATGTCATAAAAGAGGGAGGAGGG + Intergenic
1153629983 18:7060458-7060480 TTGTTTTGATTAGGGGAGGAGGG + Intronic
1155081182 18:22411392-22411414 TTGTTCTAATAGAGGGACTGGGG + Intergenic
1155383128 18:25246618-25246640 TTACTTTAAGAGAGGGTGGAGGG - Intronic
1155803172 18:30134550-30134572 TTGTTTTAATAGATGGAATAAGG - Intergenic
1158813619 18:61067811-61067833 TTGTTTGAATACAGGGAAAAAGG - Intergenic
1159012356 18:63069923-63069945 TTGTCTGAAGATAGGGAGGAGGG - Intergenic
1159100504 18:63952814-63952836 ATGTTTTTATAAATGGAGGAAGG - Intronic
1162200612 19:9017258-9017280 TTGTTTTAACTGAGAGAGAAGGG + Intergenic
1164830462 19:31316191-31316213 TTGTTTTCAGGGAGGGAGGCAGG + Intronic
1165488932 19:36112199-36112221 TTGTTTTTTTTGAGGGGGGATGG - Intronic
1166154899 19:40903577-40903599 TCATTTTATTGGAGGGAGGAGGG + Intergenic
1166173173 19:41046748-41046770 TCATTTTATTGGAGGGAGGAGGG - Intergenic
1167123952 19:47536578-47536600 TTGTTTTTATGTAGGGAGGGGGG - Intronic
1167210869 19:48133383-48133405 CTGTTCTAATTGTGGGAGGAGGG - Intronic
1167809654 19:51817617-51817639 TTGATTTTATAGGGAGAGGAGGG - Intronic
1168389068 19:55991115-55991137 TTGTTTTTCTGGAGTGAGGAGGG + Intergenic
1168569051 19:57449394-57449416 TTGTTTTAGTAAATGGAGGAAGG + Intronic
926146864 2:10401633-10401655 TTGTTTGACGAGAGGCAGGAAGG - Intronic
926916643 2:17898711-17898733 TTATTTTCAGAGAGGGAGCAAGG + Intronic
927526719 2:23749556-23749578 TTTTTTTAATTGAGGGAAGGAGG + Exonic
928673661 2:33628524-33628546 TTGTTGTAGCAGAGGGAGAATGG - Intergenic
928909606 2:36406256-36406278 TTGTTCCATTGGAGGGAGGATGG + Intronic
929434611 2:41918944-41918966 TTGTTGGTATAGATGGAGGATGG + Intergenic
929595745 2:43174553-43174575 TTGTTTTCTTAAAGAGAGGAAGG - Intergenic
929905174 2:46039540-46039562 TTGTTTTAGTAGAGGGGGAGGGG + Intronic
930031764 2:47062481-47062503 ATGTCTAAATTGAGGGAGGAAGG - Intronic
930240447 2:48930667-48930689 TTGTTTTAAGACATGGAAGAAGG + Intergenic
930804160 2:55473271-55473293 TTTTTTTAAGAGATGGAGGGTGG - Intergenic
931403888 2:61957061-61957083 TAGTTTTAATTGAAGGAAGATGG + Intronic
931895962 2:66729927-66729949 TTTTCTTTATAGATGGAGGAGGG + Intergenic
932193359 2:69760346-69760368 TTGATTAAATAGAGAGAGGGAGG + Intronic
932310455 2:70735580-70735602 TTGTTAGGAAAGAGGGAGGAGGG - Intronic
932528980 2:72505565-72505587 TAGTTTTATTATAGGGAAGATGG - Intronic
933076606 2:77935810-77935832 GTGTTTCAGAAGAGGGAGGATGG + Intergenic
935720928 2:105978568-105978590 TTGTTTTGAAAGAGGGAAAATGG - Intergenic
937570582 2:123354097-123354119 GTGTTATAATGGAGGAAGGAAGG - Intergenic
938877341 2:135546231-135546253 TTTTTTGGATATAGGGAGGAAGG + Intronic
940018500 2:149132063-149132085 TTCTTTTAAAAAAGGGAGCATGG - Intronic
940470849 2:154098306-154098328 GTTTTATAATAGAAGGAGGAGGG - Intronic
940537801 2:154968759-154968781 TGCTTTTAATAGACTGAGGATGG - Intergenic
940822229 2:158368941-158368963 TTTTTTTAATACACTGAGGAAGG + Intronic
941102093 2:161308005-161308027 TTTTTTTAAAAGAGGGGGGATGG - Intergenic
942337812 2:174909275-174909297 TTGTTTTAAGTGAAGGAAGAAGG - Intronic
943657181 2:190522068-190522090 AGGAATTAATAGAGGGAGGAGGG + Intronic
944132058 2:196357419-196357441 TTGTTTGAATAAAGAGAGGGAGG - Intronic
944821341 2:203435192-203435214 TTGTTTTATTTGAGGGATAAAGG + Exonic
944997280 2:205308255-205308277 CTGTCTTAATAAAGGAAGGAAGG + Intronic
945338707 2:208623886-208623908 TTTTTTAATCAGAGGGAGGAAGG + Intronic
945633379 2:212313948-212313970 TTGTTTAAATTGTGGGATGAAGG - Intronic
945897588 2:215502002-215502024 TTGTTTTAAGGGAGAGAGGTAGG - Intergenic
946342944 2:219083595-219083617 TTATTTTGAGAGAGAGAGGAGGG + Intronic
946973552 2:225122371-225122393 CTTTTTTAATTGAGGGAGAATGG - Intergenic
947069349 2:226269463-226269485 ATGTGTTAATAGATGAAGGATGG - Intergenic
947089215 2:226491970-226491992 TTGTTTTTAGAGAAGTAGGAAGG - Intergenic
947163673 2:227240131-227240153 TGGTTTTAACAGGGGGAGAAGGG + Exonic
947551337 2:231048834-231048856 TTGTTTTAAAACAGGGAGACTGG + Exonic
1168733542 20:109447-109469 GTGGATTACTAGAGGGAGGAGGG + Intergenic
1168850775 20:975433-975455 GTGTTTTGACTGAGGGAGGATGG - Intronic
1168947568 20:1774202-1774224 TTTTTTTAATAGAAGAAGAATGG + Intergenic
1169277833 20:4245492-4245514 TTATTTGAAAAGAGAGAGGAAGG + Intronic
1170419058 20:16174272-16174294 TTGTTTTTATAGACGGAGTCTGG + Intergenic
1170484851 20:16806002-16806024 TGGTTTTAATAGAAAGAGGAAGG - Intergenic
1170974196 20:21146720-21146742 TTGTTTTTATAGTAGGAGGAAGG + Intronic
1171954844 20:31453457-31453479 TTTTTTTAATAGAGATAGGTGGG - Intergenic
1172972715 20:38885179-38885201 TTTTTTTAATATAGGGATGGGGG - Intronic
1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG + Intergenic
1175053172 20:56173595-56173617 ATACTTTAAGAGAGGGAGGAGGG + Intergenic
1175346330 20:58279401-58279423 TTTTTTTAATATAAAGAGGATGG + Intergenic
1175777320 20:61661535-61661557 CTTTTTTAATAGCTGGAGGAAGG + Intronic
1176047465 20:63100369-63100391 TTGTTTTAACAGAATGGGGAGGG + Intergenic
1176049215 20:63107828-63107850 TTGTTTTACTTGAGGGAAGGTGG + Intergenic
1176720227 21:10386717-10386739 TTATTTAAATAGAAGGAAGAAGG + Intergenic
1177057367 21:16323398-16323420 TATTTTTATTATAGGGAGGATGG + Intergenic
1177125198 21:17185250-17185272 CTGGGTTTATAGAGGGAGGAAGG - Intergenic
1177828959 21:26115456-26115478 TTGTTTTAATTCAGGGAGACAGG - Intronic
1177867955 21:26535522-26535544 TCGTTTGAATAGAGCAAGGAAGG + Intronic
1178812030 21:35893168-35893190 ATGATTCAATAGAGGTAGGAGGG + Intronic
1179417692 21:41211413-41211435 TTGTTTTTATAAAGGGAGGGGGG - Intronic
1179503911 21:41827291-41827313 TTTTTTTAAAAAAGGGACGAAGG + Intronic
1180301426 22:11039477-11039499 TTATTTAAATAGAAGGAAGAAGG + Intergenic
1180743343 22:18069135-18069157 TTTTTTTCAGAGAGGAAGGAGGG - Intergenic
1182032742 22:27172706-27172728 TTGTTATAAAAGATGGGGGAAGG - Intergenic
1182228431 22:28818152-28818174 TTGTTTTAAAAATGGGAGGCAGG + Intergenic
1182530120 22:30948996-30949018 TTGTTTTGTTTGAGGGAGGGTGG - Intronic
1182919355 22:34065131-34065153 TTGTTTTATTGCAGTGAGGATGG - Intergenic
949456057 3:4240002-4240024 TTATTTCAATAGATGGAGAAAGG - Intronic
949932478 3:9089699-9089721 TTCTGTTAGTAGAAGGAGGAAGG - Intronic
950865753 3:16187904-16187926 TTGTTTTCACTGAGGGAGAATGG - Intronic
951509471 3:23485510-23485532 TTGTTTTAATAGGGGAAGAAAGG - Intronic
951712220 3:25594826-25594848 TTTTTTTTTTAGAGGGGGGAGGG - Intronic
952404762 3:32995662-32995684 TTGTTTTTAAGGAGGGAGAAAGG - Intergenic
955373903 3:58378041-58378063 GTTTTTTGCTAGAGGGAGGAGGG - Intronic
955427199 3:58804280-58804302 TTGTTTCAATAAAAGGAGAAAGG - Intronic
955530431 3:59867048-59867070 TGGTTGTAAAAGAGGGTGGAGGG - Intronic
955574927 3:60350624-60350646 TTGGTGGAATACAGGGAGGAAGG - Intronic
955873832 3:63468895-63468917 TTTTTTTAAAAAAAGGAGGAAGG + Intronic
956040504 3:65140234-65140256 TTGTTTGTGGAGAGGGAGGAAGG + Intergenic
956490354 3:69764911-69764933 TTGTTTTAACAGTGGGAGTCTGG + Intronic
956618077 3:71192993-71193015 GTGTTTTAAGTGGGGGAGGAGGG - Intronic
956748321 3:72327129-72327151 GTGGTTGAATAGATGGAGGATGG - Intergenic
957000279 3:74876377-74876399 TTTTTTTAATAGAGATAGGGAGG - Intergenic
959980309 3:112508535-112508557 TTGTTTTAAGAGAGGAAGGAAGG + Intergenic
959988927 3:112608945-112608967 TTGTTTTTTAAAAGGGAGGAGGG - Intronic
960092324 3:113653589-113653611 TTTTTTTAATAGATGGAGTCTGG - Exonic
962012471 3:131405816-131405838 TTGGTTTATTAGAGAGAAGAGGG - Intergenic
962299274 3:134223557-134223579 TTGTTTATAAAAAGGGAGGAGGG + Intronic
962669778 3:137693221-137693243 ATGTTTTAAAAGATGGAGGCAGG + Intergenic
963648056 3:147942659-147942681 TTGTTTTGTTTGAGGGAGGATGG + Intergenic
964130249 3:153279009-153279031 CAGTTTCAAGAGAGGGAGGAGGG - Intergenic
964154375 3:153566270-153566292 TGGCTTTAATAGAGGTAGAATGG + Intergenic
964335888 3:155653981-155654003 TTGATTCAAAAGAGAGAGGAAGG - Intronic
965085412 3:164089550-164089572 TAGTTTTCATAGAGGAAAGAAGG - Intergenic
966824899 3:183955281-183955303 TTATTTTAATAGAGTGAGGTTGG + Intronic
966995942 3:185280707-185280729 CTGTTTTAATAGAAGGGGCAGGG + Intronic
967825577 3:193874723-193874745 ATGTTGTAATAGAGGTAGCAGGG + Intergenic
969392681 4:6901742-6901764 TTGTTTTAATGGTGGTGGGAGGG - Intergenic
970138246 4:12950306-12950328 TTGTTTTATGGGAGGGAGGAGGG + Intergenic
970518202 4:16856140-16856162 TTTGTTTAATAAAGGGTGGATGG - Intronic
971816325 4:31495536-31495558 TGGTTTTAAGAGAGAGAAGAAGG - Intergenic
972181326 4:36470353-36470375 TTGTTTGTATAAAGAGAGGAAGG - Intergenic
972695604 4:41442787-41442809 GTGATACAATAGAGGGAGGAAGG - Intronic
972726906 4:41752406-41752428 TTATTTTAATAGAGGCGGGTGGG + Intergenic
974476634 4:62389778-62389800 TTGTTTTTGTATAGTGAGGAAGG + Intergenic
975387960 4:73780746-73780768 CTGTGTTGATAGAGGTAGGAAGG + Intergenic
978946295 4:114501999-114502021 TTGTTTTAAAGCATGGAGGAGGG - Intergenic
979729262 4:124003941-124003963 ATTTTTGAACAGAGGGAGGAAGG + Intergenic
980059341 4:128111984-128112006 TTTTTTTAAGAGACAGAGGATGG - Intronic
980379801 4:131997984-131998006 TTTTTTTAAAAAAAGGAGGAAGG + Intergenic
980920668 4:139083353-139083375 TTGTTTTTTTAGGGGGAGAATGG - Intronic
983022250 4:162692238-162692260 TTGTTATAAAAGAGGGAGTTTGG + Intergenic
983307964 4:166018077-166018099 TGGTTTTCATACAGAGAGGAGGG + Intronic
983429136 4:167625570-167625592 TTGTTTATATAGAATGAGGAGGG - Intergenic
983884805 4:172968505-172968527 CTTTTTTTGTAGAGGGAGGAGGG - Intronic
983999908 4:174227200-174227222 TTGTTTAAATTGAGACAGGATGG + Intergenic
984197150 4:176671933-176671955 TTCTTTTAAAAGGGGAAGGAGGG + Intergenic
984987263 4:185343512-185343534 TTCTTTTATTTGAGAGAGGAGGG + Intronic
985426408 4:189835645-189835667 GTGTGTTGATAGAGGGTGGAGGG - Intergenic
985842521 5:2319229-2319251 TTGTTGCAATAGAGGCATGAGGG + Intergenic
986181383 5:5396042-5396064 TTGTTTTAATGGTGAGAGAAGGG + Intergenic
986429549 5:7667784-7667806 TCTTCTTAATAGAGGGAGGGAGG - Intronic
987875878 5:23680656-23680678 GTGTTTTAGGAGATGGAGGAGGG + Intergenic
988675915 5:33432990-33433012 TGTTTTTAATAGAGGTAGGAAGG + Intergenic
989476146 5:41875400-41875422 ATGTTTAAATTGAGGGAGAATGG - Intergenic
990252875 5:53934612-53934634 TTCTATTAATAGATGGAGAATGG - Intronic
991318042 5:65333982-65334004 TTTTTTTAATAAAGGTAGAATGG - Intronic
992799543 5:80283451-80283473 TTTTTTTCATGGAGGGACGAGGG + Intergenic
993355533 5:86902580-86902602 TTGGTTTTACAGAAGGAGGAGGG - Intergenic
993507000 5:88721538-88721560 TTATCTTAATAGCGGGAGGGGGG - Exonic
993720633 5:91318407-91318429 TTTTTTTAATAGATGGCGGTCGG + Intergenic
994271925 5:97787803-97787825 TTTTTTTAAAATAAGGAGGAAGG - Intergenic
994449368 5:99922130-99922152 TAGTTTACATTGAGGGAGGAGGG + Intergenic
995063417 5:107835688-107835710 TTGTTTTATGAGAGGCTGGAGGG + Intergenic
995554197 5:113310885-113310907 TTTTTTTAATGAAGGAAGGATGG - Intronic
995680014 5:114705326-114705348 ATGTTTTAATAAATGGATGAAGG - Intergenic
995711258 5:115038139-115038161 CTGTTTTAATAGAAGATGGAAGG + Intergenic
997575328 5:134971248-134971270 TTTTTTTAATAGAGATGGGAGGG - Intronic
998819980 5:146049377-146049399 TTGTTTTAAAAGAGATAGGCGGG - Intronic
998841838 5:146262472-146262494 TTGATTGAATAGATGAAGGAAGG + Intronic
999389722 5:151181185-151181207 TTGTTTTAATTGAGAGGGGCAGG - Exonic
999517938 5:152319805-152319827 TTGTTTTAATAAAGTGAGATGGG + Intergenic
999610019 5:153359300-153359322 TTATTTTAACAGAGTGAGGGGGG - Intergenic
1000364665 5:160479659-160479681 CTTTTTTAATCGAGTGAGGATGG + Intergenic
1002978471 6:2110238-2110260 CTGTTCTAATTGAGGGAGGGGGG - Intronic
1003595531 6:7470940-7470962 TTGTTTCAGTAGAGAGATGAGGG - Intergenic
1003596259 6:7476808-7476830 TTGTTTCAGTAGAGAGATGAGGG + Intergenic
1004291006 6:14367288-14367310 TTGTTTTCTTTGAGGGAAGAGGG - Intergenic
1004307922 6:14517793-14517815 TTATTTTATTTGGGGGAGGACGG + Intergenic
1004964006 6:20826224-20826246 TCATGTTAATACAGGGAGGAGGG + Intronic
1005486416 6:26304734-26304756 TTGTTTTAATGCGGGGAGGTTGG + Intergenic
1006473294 6:34240079-34240101 TTGGTATAATTGAGGGAGGGAGG - Intronic
1007819484 6:44550518-44550540 TTGTTTTGGGAGAGGGAAGACGG - Intergenic
1008478139 6:51955201-51955223 TTTTTTTAAAAAAGGGAGGGAGG + Intronic
1008954495 6:57200029-57200051 TTTTTTTAAAAAAGGGTGGAGGG - Intronic
1010401686 6:75453508-75453530 ATTTTTTAAGAGAGGGAGAAAGG + Intronic
1011028430 6:82894728-82894750 CTGTTATAATAGACAGAGGAAGG + Intronic
1011292945 6:85795479-85795501 TTGTTTTAATTGAAGGACAAGGG + Intergenic
1013613013 6:111812625-111812647 TTTTTTTAAGGGAGGGAGGTTGG + Intronic
1014154804 6:118098244-118098266 TTGTCTTAATTGTAGGAGGATGG - Intronic
1014776535 6:125517277-125517299 TTTTTTTTTTAGAGGGTGGAGGG + Intergenic
1015027147 6:128548738-128548760 TATTTTTAATAGAGACAGGATGG - Intergenic
1015056810 6:128912346-128912368 TTGTGTAAAAAGAGGGAGAAAGG - Intronic
1015509148 6:134020314-134020336 TTGTGTAAATAGAGGTATGAAGG - Intronic
1015721729 6:136249816-136249838 TCATTTTAAAAGAGTGAGGAGGG - Intronic
1015855429 6:137619102-137619124 TTGTTTTAAAATGGGAAGGATGG + Intergenic
1016157003 6:140823194-140823216 ATATATTAATAGAGGGAAGAGGG - Intergenic
1016614074 6:146027535-146027557 GTCGTTTGATAGAGGGAGGAGGG - Intergenic
1017574093 6:155782323-155782345 GTGTTTTAGTAGAAGGAGCATGG + Intergenic
1017689257 6:156946685-156946707 TTGTTGGAATAGAGGGAGGGAGG + Intronic
1018851340 6:167642446-167642468 TGCATTTAATTGAGGGAGGATGG - Intergenic
1019268747 7:134110-134132 TTGTTCTAAGGTAGGGAGGAGGG + Intergenic
1019907358 7:4074925-4074947 TTTTTTTAATAAAGTTAGGAAGG + Intronic
1020359111 7:7308168-7308190 TTGTTTAAATAGAGGAACCAGGG - Intergenic
1020392810 7:7676600-7676622 TTGTTTTAATAAAAGAAGGTTGG + Intronic
1021651135 7:22834672-22834694 TTATTTTAAAAGAGAGGGGAAGG - Intergenic
1022208053 7:28181371-28181393 TTGTTTTCCTAGAAGGAGCAGGG - Intergenic
1022532018 7:31072920-31072942 CTGGTTTCAAAGAGGGAGGAAGG + Intronic
1023139117 7:37083466-37083488 TTTTTTTTATAGAGTGAGTAAGG - Intronic
1025009191 7:55382222-55382244 TTGTTTTATTTCATGGAGGAGGG - Intronic
1025082790 7:55998453-55998475 TTGTTTTATTTGTGGGAGGTAGG - Intronic
1027271092 7:76519345-76519367 TTTTTTAAAAAGAGGGAAGAAGG + Intergenic
1027320855 7:77009280-77009302 TTTTTTAAAAAGAGGGAAGAAGG + Intergenic
1027379452 7:77590858-77590880 TTTTTTTAATAGATGGAGGCCGG - Intronic
1028203555 7:87990962-87990984 TTATTTTAAAAGAGGGAGAAAGG - Intronic
1028260455 7:88658117-88658139 TTTTTTTAATACTGGGAGGTGGG - Intergenic
1030195438 7:106848614-106848636 TTGTTTTAAGGAATGGAGGATGG + Intergenic
1030710501 7:112743378-112743400 TTTTTTTAAGGCAGGGAGGAGGG - Intergenic
1030834311 7:114264443-114264465 TTGTTTAAATAGGGGTGGGAGGG - Intronic
1032728137 7:134611288-134611310 TGGATTTAACAGAGGGAAGAAGG - Intergenic
1033026071 7:137773928-137773950 TTGTTGTGATAGAAGGAGCATGG - Intronic
1034211818 7:149370354-149370376 TTTTTTTAATGGAGTGAGGTAGG + Intergenic
1037527814 8:19744526-19744548 TGGATTTAATAGGGGCAGGAAGG - Intronic
1038176872 8:25188184-25188206 TTGTTTGGTTAGATGGAGGAAGG + Intronic
1038525674 8:28271077-28271099 TTGTCTCTAGAGAGGGAGGAAGG - Intergenic
1039954671 8:42197738-42197760 TGGTTTTTATGGAGGGAAGATGG - Intronic
1039982114 8:42416613-42416635 TTTTTTTGATAGCGGGAGGGAGG - Exonic
1039987806 8:42462578-42462600 TTTTTTTAATGGAGAGAGCAAGG - Intronic
1042172594 8:66006668-66006690 TTTTTTTAAAAGTGGGAGCAGGG - Intergenic
1042746772 8:72116937-72116959 TGGTTTAAATAAAGGGATGATGG - Intronic
1043087704 8:75855923-75855945 TTGTTTACATAAAGAGAGGATGG + Intergenic
1043547745 8:81334369-81334391 TTTTTTTAGTAGAGGCAGGCAGG + Intergenic
1043547757 8:81334468-81334490 TTTTTTTAGTAGAGGCAGGCAGG + Intergenic
1043872447 8:85449124-85449146 TTGTTTTTATAGCTGAAGGATGG + Intergenic
1044188094 8:89280734-89280756 GTGTTTTAGGAGATGGAGGAGGG - Intergenic
1044220620 8:89664804-89664826 GTGGTATAATAGAGGTAGGATGG - Intergenic
1044429116 8:92087965-92087987 TTGTTTAAATAAAGGTAGGTAGG - Intronic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1045334973 8:101192855-101192877 TAATTTCAGTAGAGGGAGGAGGG + Intronic
1045439322 8:102193983-102194005 TTGTTTTAAAAGGGGGAGGCTGG + Intergenic
1045901804 8:107290763-107290785 TTATTTTAAAAAAGGGAGGAGGG + Intronic
1045948151 8:107820602-107820624 TGGTTTTATTAGATGGAGGCTGG + Intergenic
1045957360 8:107924383-107924405 TTCTTTGAAAAGAGAGAGGAGGG + Intronic
1046456237 8:114466435-114466457 TTGTTTTATTAGAATGATGAAGG + Intergenic
1046770676 8:118113306-118113328 TTGTTTTAATAAAGCAGGGAAGG + Intergenic
1047360485 8:124164515-124164537 TTGAATTAACAAAGGGAGGAGGG - Intergenic
1048617668 8:136095651-136095673 TTGCATTAATAGATGGATGATGG + Intergenic
1049057569 8:140250884-140250906 TTGTTTTAAAAGATAGAAGAAGG + Intronic
1049991505 9:996039-996061 TGGTTTCTATAGAGGGAGGGTGG + Intergenic
1052463502 9:28798561-28798583 TGGTTTGAGAAGAGGGAGGAAGG + Intergenic
1052904628 9:33822809-33822831 TTGTTTTTTTAGGGGGAAGAGGG - Intronic
1052994785 9:34546186-34546208 TCATTTTATTAGAGGGAGGTGGG + Intergenic
1053466841 9:38314756-38314778 TTTTTTTAATAAAGGGAGAAAGG - Intergenic
1053518731 9:38754831-38754853 TTGTTTGAATGGAGGGAGGGAGG - Intergenic
1054163008 9:61691566-61691588 TTGTTTTTATACAGGGAGTTGGG + Intergenic
1056480213 9:86995774-86995796 TTATTTATACAGAGGGAGGAGGG - Intergenic
1056506964 9:87266633-87266655 TTGTCATAATAGAGGCAGTATGG - Intergenic
1056617029 9:88177601-88177623 TAGTCTCAATAGAGGGAAGAAGG + Intergenic
1057213252 9:93212782-93212804 TTTGTTTAAAAGAGAGAGGAAGG + Intronic
1058353001 9:104048795-104048817 TTCTTTAAATGAAGGGAGGAAGG + Intergenic
1058527174 9:105871204-105871226 TTGCTTTAATAGAAAGAGAAAGG + Intergenic
1059149863 9:111939614-111939636 TTGTTTTAGTAGGGTGAGGGTGG - Intergenic
1060134130 9:121135267-121135289 ATGGTTTAATAGAGAGAGTATGG + Intronic
1061651305 9:132052563-132052585 TTTTTTTAAAAGAGAGAGAATGG - Intronic
1202630930 M:15660-15682 TTGTTTGGATATATGGAGGATGG - Intergenic
1185540671 X:900786-900808 TTATTTAAATAGAAGGAAGAAGG - Intergenic
1186499025 X:10036077-10036099 TTTTTTTAATGGAGGAAAGACGG - Intronic
1186611539 X:11142720-11142742 TTGGCTTAAAAGATGGAGGAAGG + Intronic
1186958329 X:14707568-14707590 TGGTTTTTTTAGAGGGTGGAGGG - Intronic
1187662768 X:21568600-21568622 TTTTTTTGATGGAGGGAAGAGGG + Intronic
1187893339 X:23957679-23957701 GTGTTTTAGTAAAGGCAGGAAGG - Intergenic
1188552148 X:31376179-31376201 CTGTTTTGTTAGAGGAAGGAAGG - Intronic
1188568046 X:31548860-31548882 TTGTTTAAATAGAAGGACTAGGG + Intronic
1188906243 X:35795163-35795185 TTATTTTAAAATTGGGAGGAAGG - Intergenic
1189529692 X:41866551-41866573 TTATATTTATAGAGGAAGGAAGG + Intronic
1190409863 X:50125797-50125819 TTGTTTTTCAAGGGGGAGGATGG + Intergenic
1190472940 X:50800805-50800827 TAATTTTAAGGGAGGGAGGAGGG + Intronic
1192054182 X:67756612-67756634 CTGTTTTAAGGGAGGAAGGAAGG - Intergenic
1193021014 X:76793390-76793412 TTTTTTTTTTAAAGGGAGGATGG - Intergenic
1194354205 X:92860655-92860677 TTTTTATAATAAAGGGATGATGG - Intergenic
1195603319 X:106773173-106773195 TTTTTTTAATAGTGGAAGAAAGG - Intronic
1196518530 X:116643469-116643491 TTGTTTTCATAGAAGCAGAAGGG - Intergenic
1196524038 X:116709985-116710007 TTATGTTAATAGAGGCAGAAAGG - Intergenic
1196815047 X:119658249-119658271 TGGTTTTATTGGAGGGAGGGGGG + Intronic
1197693765 X:129529336-129529358 TTGTTTAAAAAGAGGCCGGAGGG + Intergenic
1198153261 X:133932075-133932097 CTGTTTTAATAAAGAGAGGTGGG - Intronic
1200662555 Y:5977676-5977698 TTTTTATAATAAAGGGATGATGG - Intergenic
1201560745 Y:15313824-15313846 TTGGCTTAATAGAGTAAGGATGG - Intergenic
1201628436 Y:16041361-16041383 TTATTTTAATAGATGCAGAAAGG - Intergenic
1201791547 Y:17846512-17846534 TTGTTTTAAAAGAGGGGTCAGGG + Intergenic
1201810007 Y:18059477-18059499 TTGTTTTAAAAGAGGGGTCAGGG - Intergenic
1202353155 Y:24016164-24016186 TTGTTTTAAAAGAGGGGTCAGGG + Intergenic
1202517624 Y:25653951-25653973 TTGTTTTAAAAGAGGGGTCAGGG - Intergenic