ID: 1126706749

View in Genome Browser
Species Human (GRCh38)
Location 15:51413490-51413512
Sequence AGGGAGAGGACAGTAATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126706736_1126706749 18 Left 1126706736 15:51413449-51413471 CCACAGTGGCCCCATGCACAGAG No data
Right 1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG No data
1126706735_1126706749 24 Left 1126706735 15:51413443-51413465 CCAATGCCACAGTGGCCCCATGC No data
Right 1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG No data
1126706739_1126706749 7 Left 1126706739 15:51413460-51413482 CCATGCACAGAGAGAATCTGTCC No data
Right 1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG No data
1126706738_1126706749 8 Left 1126706738 15:51413459-51413481 CCCATGCACAGAGAGAATCTGTC No data
Right 1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG No data
1126706737_1126706749 9 Left 1126706737 15:51413458-51413480 CCCCATGCACAGAGAGAATCTGT No data
Right 1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126706749 Original CRISPR AGGGAGAGGACAGTAATTGT GGG Intergenic
No off target data available for this crispr