ID: 1126709796

View in Genome Browser
Species Human (GRCh38)
Location 15:51443353-51443375
Sequence GCTGCTGGTGCCAGCCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126709787_1126709796 20 Left 1126709787 15:51443310-51443332 CCGGTCTGGAGTCTGGGGTTACA No data
Right 1126709796 15:51443353-51443375 GCTGCTGGTGCCAGCCAGCCAGG No data
1126709794_1126709796 -10 Left 1126709794 15:51443340-51443362 CCTGGAGCCTGAGGCTGCTGGTG No data
Right 1126709796 15:51443353-51443375 GCTGCTGGTGCCAGCCAGCCAGG No data
1126709792_1126709796 -6 Left 1126709792 15:51443336-51443358 CCAGCCTGGAGCCTGAGGCTGCT No data
Right 1126709796 15:51443353-51443375 GCTGCTGGTGCCAGCCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126709796 Original CRISPR GCTGCTGGTGCCAGCCAGCC AGG Intergenic
No off target data available for this crispr