ID: 1126711059

View in Genome Browser
Species Human (GRCh38)
Location 15:51456633-51456655
Sequence GGTGCTCCTGAATATCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126711059_1126711063 9 Left 1126711059 15:51456633-51456655 CCCTGAGGATATTCAGGAGCACC 0: 1
1: 0
2: 2
3: 16
4: 124
Right 1126711063 15:51456665-51456687 TTCAGAGCAGAACATAAGAATGG 0: 1
1: 0
2: 3
3: 24
4: 293
1126711059_1126711064 10 Left 1126711059 15:51456633-51456655 CCCTGAGGATATTCAGGAGCACC 0: 1
1: 0
2: 2
3: 16
4: 124
Right 1126711064 15:51456666-51456688 TCAGAGCAGAACATAAGAATGGG 0: 1
1: 0
2: 1
3: 22
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126711059 Original CRISPR GGTGCTCCTGAATATCCTCA GGG (reversed) Intronic
902288707 1:15423052-15423074 GGTGCTCCTGCACAGCCCCACGG + Intronic
903302012 1:22385951-22385973 GGGGCACATGCATATCCTCACGG + Intergenic
907193634 1:52668806-52668828 CCTGCTCCTGACTAACCTCAAGG + Intronic
908847589 1:68340494-68340516 TGTGCTTCTTAATATCCTCCAGG - Intergenic
918705221 1:187652140-187652162 GGGGTTCCTGGATAACCTCATGG + Intergenic
921757889 1:218880758-218880780 GGTGCTCCTCTAAAACCTCAGGG + Intergenic
922436734 1:225614675-225614697 GGGGCTCCTGGATAGCTTCAGGG - Intronic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1066454594 10:35561885-35561907 GGTGCTGGTGACTATCCACATGG - Intronic
1068770751 10:60818108-60818130 GGTGATCCAGAAAATCTTCAAGG + Intergenic
1070157984 10:73848059-73848081 GGTCATCCTGTATATCCTCCTGG - Exonic
1072474757 10:95749639-95749661 TGTCCTCCCGAATATCCACATGG - Intronic
1073151119 10:101312284-101312306 AGAGCTCTTGAATATTCTCAAGG + Intergenic
1073873820 10:107898328-107898350 GGTGTTTCTGAATGTTCTCAAGG - Intergenic
1075048395 10:119164386-119164408 GGGACTCCTGAATGTACTCAAGG + Intronic
1075215508 10:120529254-120529276 GATGCTGCTGAATATCCTGCAGG + Intronic
1075823908 10:125337198-125337220 AGTGCTCCTCAAAATCCTCAAGG + Intergenic
1079078850 11:17399977-17399999 AGTGCTCCTGCATCTCCTCTGGG - Intronic
1082179288 11:49099137-49099159 GGAGCTTCTGAGTATCCTAAAGG - Intergenic
1083556262 11:63631011-63631033 GGTGCTGCTGAAGAGCCTGAGGG - Intronic
1084209382 11:67614052-67614074 GGTGCTTCTGAACAGGCTCAGGG + Intergenic
1084386078 11:68843424-68843446 GGAGCTCCTGATTATCCTGTAGG + Intronic
1084600681 11:70143625-70143647 GGTGTTTCTGAATCTCCCCAGGG - Intronic
1086126574 11:83355094-83355116 GGTGCTCCTAAACAGCCTGAGGG - Intergenic
1090488346 11:127135264-127135286 GCTGCTCCTGAGAATACTCAGGG + Intergenic
1091535937 12:1409568-1409590 GTTGTTCCTGAGTATCCTCAGGG + Intronic
1092873045 12:12823913-12823935 GGTGCTGCAGAATATCATAAAGG - Exonic
1096910502 12:54979039-54979061 GGTGCTCCTGACTGTCCTCATGG + Intronic
1101975598 12:109355370-109355392 AGTGCACCTGAATCACCTCAGGG + Intronic
1103973278 12:124685807-124685829 GGTGCTCCTGGGTATACTCTGGG + Intergenic
1107021664 13:35758643-35758665 GCTGCCCGTGAATATTCTCAGGG + Intergenic
1108042170 13:46349332-46349354 GCTGCTCCTGAATTTCCTAATGG + Exonic
1109738113 13:66513625-66513647 GGTGCAGCTGAATATTCTCTTGG + Intronic
1112608498 13:100931659-100931681 GGGGCTCCTGGATAGCCTCCAGG + Intergenic
1115140070 14:30160569-30160591 GGTGGTGCTGAACATCCTCAGGG + Intronic
1116227669 14:42172380-42172402 GGAGCTGCTGATTCTCCTCAAGG - Intergenic
1119506363 14:75176426-75176448 GGTCCTTGTGAATCTCCTCACGG + Exonic
1119653156 14:76397792-76397814 GGGGCTTCTGAATAACCTCGAGG + Intronic
1120740509 14:88104257-88104279 CATGCTCCTGAATATCCTTCGGG - Intergenic
1121346303 14:93138133-93138155 TGTGCTTCTGAATCTCCTCTAGG - Intergenic
1122691139 14:103532682-103532704 GGTGCTCCTGGAACTCCTCCCGG - Exonic
1126220518 15:46207881-46207903 GTTGCACCTGAATATGCTCTAGG + Intergenic
1126711059 15:51456633-51456655 GGTGCTCCTGAATATCCTCAGGG - Intronic
1126850666 15:52795102-52795124 GGTGCGCCTGAAGATCGTCCTGG - Intergenic
1127166776 15:56251817-56251839 GGTTATCCTGAATTTCCCCAAGG - Intronic
1127601030 15:60537190-60537212 GGTGCTCCTGAAGTCCCTCCAGG - Intronic
1127684004 15:61324004-61324026 GATGCCCTTGAATATCATCAAGG + Intergenic
1128381333 15:67115189-67115211 GGTGCTCCTGGAAGTGCTCATGG - Intronic
1128808334 15:70551543-70551565 TGGGCCCCTGAATAACCTCATGG - Intergenic
1133557776 16:6922121-6922143 GGTGCTCCTGAAGTTGCACAGGG - Intronic
1133611259 16:7435567-7435589 GGTCCTGCTGAAAAGCCTCATGG - Intronic
1135185406 16:20311237-20311259 GGTCCTCCTGACTGTCCTCCTGG - Exonic
1135527590 16:23226072-23226094 GTAACTCCTGAAGATCCTCAAGG + Intergenic
1135795966 16:25442778-25442800 TGTGCTACTGAATGTTCTCATGG - Intergenic
1136396170 16:29993667-29993689 GGAGCGCCTGAGTATCCTCCGGG - Exonic
1138830342 16:60367390-60367412 GAAGCTCCTGAATAGTCTCAGGG + Intergenic
1143939457 17:10524772-10524794 GGTGTTCCTGTAGTTCCTCAGGG + Exonic
1152682089 17:81673724-81673746 GGTGCTCCTCACTTTCCACACGG - Exonic
1153975406 18:10264276-10264298 GGTGCTCCTGCTTATCCCCACGG - Intergenic
1155399477 18:25422262-25422284 TCTGGACCTGAATATCCTCAGGG - Intergenic
1155773949 18:29735606-29735628 CCTGCTCCTGAATGACCTCAGGG - Intergenic
1159928764 18:74291815-74291837 TGTGCTTCTGAATCTCCTCTAGG + Exonic
1162795855 19:13087320-13087342 AGTCCTCCTGAAGAACCTCACGG + Intronic
1165771887 19:38385075-38385097 GGTCCTCCTTGATACCCTCAGGG + Intronic
1167765643 19:51480436-51480458 TGTATTCCTGAACATCCTCAGGG - Exonic
926059124 2:9794320-9794342 TGTGCTCCTGACTGTCCTCTGGG - Intergenic
926789085 2:16551850-16551872 GGTGCACCTGAATTTACTCCTGG - Exonic
929944000 2:46356771-46356793 GGTTCTCACGAATCTCCTCATGG - Exonic
931617737 2:64177635-64177657 GCTGGTCCTGAATTTCCACATGG + Intergenic
933975445 2:87505548-87505570 GGTTCTGCTGAAAATTCTCATGG - Intergenic
936318381 2:111445265-111445287 GGTTCTGCTGAAAATTCTCATGG + Intergenic
940475626 2:154158699-154158721 GTTTCTCCTGAATATCCACATGG + Intronic
945866231 2:215179116-215179138 CGTGCTCCTGAATAACCACTGGG - Intergenic
947100251 2:226613047-226613069 CTTGCTCCTGAATATCCACTGGG - Intergenic
948292284 2:236834756-236834778 GGTGGCCCTGCACATCCTCAGGG - Intergenic
1170036546 20:11995883-11995905 GGTGCTCCTGGAAATCCTCCTGG + Intergenic
1173258387 20:41411442-41411464 GGAGCTCCTGAAGATGCTCATGG - Intronic
1174137909 20:48393218-48393240 GGGGCTCCTGAAACTCCACAGGG - Intergenic
1181178242 22:21049837-21049859 ACAGCTCCTGAATATGCTCAGGG - Intronic
1182569168 22:31223326-31223348 AGTTATCTTGAATATCCTCATGG + Intronic
1182661272 22:31926967-31926989 GTGACTCCTGAATATCCTCCTGG + Intergenic
1184310896 22:43641910-43641932 TATGCTCCTGAATCTCCTCAGGG - Intronic
950010385 3:9718660-9718682 AGTGCTCCTGACTATCCTTGGGG - Intronic
950569034 3:13788600-13788622 GAAGCTCCTGATTATCCTCTGGG - Intergenic
956379691 3:68652720-68652742 CTTGCTCCTGATTATCCTCATGG - Intergenic
956878013 3:73482685-73482707 AGTGCCCTTGGATATCCTCAGGG + Intronic
959881649 3:111450221-111450243 GTTGCTCCTGAATGACCTTAGGG + Intronic
964237032 3:154543647-154543669 TGCTCTCCTGAATATCCCCAAGG + Intergenic
966504680 3:180686240-180686262 AGTGCTCCTGAATACTGTCAAGG - Intronic
969408833 4:7014726-7014748 GGCCCTCCTGAATTCCCTCAAGG + Intronic
970452239 4:16180987-16181009 GGTGCACCTGAAAATCCACATGG - Intronic
983497644 4:168461183-168461205 GGGGCCCCTGGATAGCCTCAGGG - Intronic
985131648 4:186744640-186744662 TGTGCTCCTGAATGTCCTGAAGG - Intergenic
985567167 5:624953-624975 GGTCCTGCTGAATGTGCTCACGG - Intronic
986860142 5:11917982-11918004 GGTGCTCCTGGATAACAGCAGGG - Intergenic
987627513 5:20421191-20421213 CCTGCTCCTGAATATGCTGATGG - Intronic
987965060 5:24861899-24861921 GTAGCTCCTGAATCTCCCCATGG - Intergenic
992220405 5:74566528-74566550 GCTGCTGCTGAATAGCATCAAGG - Intergenic
995869785 5:116732666-116732688 GTTGCTTCTGAATTTCCTTATGG - Intergenic
996263421 5:121503372-121503394 AGTCTTCCTAAATATCCTCAGGG - Intergenic
996881370 5:128300185-128300207 GGTGCTTCTGAATTTCAACAAGG + Intronic
997146471 5:131439595-131439617 AGTCCTCCTGCATCTCCTCAAGG - Exonic
998570424 5:143251964-143251986 GGTGCTCCATGATATCCTCAGGG + Intergenic
1000287845 5:159843078-159843100 GTTGTCCCTCAATATCCTCAGGG - Intergenic
1002139375 5:177129642-177129664 GCTATTCCTGAATATCCTCCAGG + Intergenic
1003324143 6:5080009-5080031 GGTGATCCTAAATATTCCCATGG - Intergenic
1006581069 6:35078345-35078367 GGGGCTCCAGAATATGCACAGGG - Intronic
1011993720 6:93557816-93557838 GGTGCTCATTAATATCTACATGG - Intergenic
1012968225 6:105698546-105698568 GGTTCTCCTGAATATTTTAATGG - Intergenic
1013787947 6:113803764-113803786 GGAGCAACTGAATATCCACATGG - Intergenic
1015341012 6:132100681-132100703 TGTGTTCCTCAATATCCTAAGGG + Intergenic
1019161262 6:170068273-170068295 GGTGCTCCTGACCTTCCTCGAGG - Intergenic
1019161279 6:170068333-170068355 GGTGCTCCTGACCTTCCTCGAGG - Intergenic
1019802232 7:3096574-3096596 GGTTTTCCTGAATATCATCAGGG + Intergenic
1023446715 7:40239379-40239401 GGTGCTCTTGAATATTTTAAGGG - Intronic
1030680656 7:112430489-112430511 AGTGCTTCTGAAAATCCCCAAGG - Intronic
1032165549 7:129541992-129542014 GGTGCTCCTCAGGACCCTCAAGG - Intergenic
1037133607 8:15436126-15436148 GGGTTTCCTGACTATCCTCATGG + Intronic
1037695238 8:21217677-21217699 TGGGCTCCTGGATAGCCTCAGGG - Intergenic
1043273239 8:78360667-78360689 GCTGCTTCTGAAGAACCTCAAGG + Intergenic
1047634314 8:126743899-126743921 GGTGCTCGGGAATATCTTCAAGG + Intergenic
1049174458 8:141182996-141183018 GGGTCGCTTGAATATCCTCAGGG + Intronic
1049235976 8:141512522-141512544 TGGGCTCCTGAGTATCCCCATGG + Intergenic
1050357590 9:4797578-4797600 GGTGCTGCTAAATATCCTACAGG + Intronic
1059269584 9:113063428-113063450 GGTTCTCGTGAATATACCCACGG + Intergenic
1059270717 9:113068875-113068897 GGTTCTCGTGAATATACCCACGG + Intergenic
1059271851 9:113074322-113074344 GGTTCTCGTGAATATACCCACGG + Intergenic
1059272985 9:113079769-113079791 GGTTCTCGTGAATATACCCACGG + Intergenic
1059274121 9:113085211-113085233 GGTTCTCGTGAATATACCCACGG + Intergenic
1059672592 9:116505813-116505835 GGTGCTCCTGAGGATGCTCCAGG + Intronic
1061097709 9:128469386-128469408 GGTGCTCCTGCACATCCTCAGGG - Intronic
1061543448 9:131290426-131290448 GGTGCTCATGAATCTGCTCCTGG + Exonic
1185880517 X:3736005-3736027 GCTGGCCCTCAATATCCTCAGGG - Intergenic
1188706128 X:33333493-33333515 GCTGCTCAGGAACATCCTCATGG + Intronic
1188743210 X:33810938-33810960 GGTGCTCTTGCACATTCTCAAGG - Intergenic
1192495914 X:71616628-71616650 GGTGCTGGTGGACATCCTCATGG - Exonic
1194072725 X:89347771-89347793 CGTGCTCCTGAATAACTTCCAGG - Intergenic
1194918644 X:99735583-99735605 GGTGCTGCTGAATATGCACAAGG + Intergenic
1197626074 X:128803940-128803962 TGTCCTCCTGAATATCCTATTGG + Intergenic
1200726964 Y:6683511-6683533 CGTGCTCCTGAATAACTTCCAGG - Intergenic
1200728116 Y:6699286-6699308 CGTGCTCCTGAATAACTTCCAGG - Intergenic
1200784637 Y:7249347-7249369 GCTGGCCCTCAATATCCTCATGG + Intergenic