ID: 1126712117

View in Genome Browser
Species Human (GRCh38)
Location 15:51470624-51470646
Sequence CAGAGTTAACACATGTAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 252}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126712114_1126712117 7 Left 1126712114 15:51470594-51470616 CCCTCATGTGTATGCACAGCAAG 0: 1
1: 0
2: 0
3: 22
4: 236
Right 1126712117 15:51470624-51470646 CAGAGTTAACACATGTAAAGAGG 0: 1
1: 0
2: 2
3: 27
4: 252
1126712115_1126712117 6 Left 1126712115 15:51470595-51470617 CCTCATGTGTATGCACAGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 143
Right 1126712117 15:51470624-51470646 CAGAGTTAACACATGTAAAGAGG 0: 1
1: 0
2: 2
3: 27
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126712117 Original CRISPR CAGAGTTAACACATGTAAAG AGG Intronic
903548180 1:24140336-24140358 CAGACTCAACACATGTACATAGG - Intronic
903561320 1:24230223-24230245 AAGATTTAACACATGGAATGAGG + Intergenic
903689919 1:25166327-25166349 TAGAGTTAACCAATTTAAAGTGG - Intergenic
906436294 1:45799593-45799615 CAGAGCAAACACATCTAAAATGG + Intronic
907302424 1:53496695-53496717 ATGAGTTAACATATGTCAAGTGG + Intergenic
908003038 1:59700365-59700387 CTGAGTTAATTCATGCAAAGTGG - Intronic
909259604 1:73470260-73470282 CAGGTTTAACCCATATAAAGAGG + Intergenic
909351446 1:74658088-74658110 ATGAGTTAACAGATGTAGAGTGG + Intronic
909673844 1:78216939-78216961 CACAGTTAAAACAGGTAAAGAGG + Intergenic
910498206 1:87857190-87857212 ATGAGTTAATACTTGTAAAGGGG - Intergenic
911467112 1:98269536-98269558 CAGAGGTAATACATGTCAAATGG - Intergenic
915629906 1:157145002-157145024 CAGAGTTACCACAAGTAACTGGG - Intergenic
916423455 1:164658799-164658821 AACAGATAACATATGTAAAGTGG - Intronic
917219654 1:172715377-172715399 CAGAATTAACAGTTGTAAACAGG + Intergenic
917272359 1:173291487-173291509 CACAGTTAAAGCATGTTAAGAGG + Intergenic
917952541 1:180055327-180055349 ATGAGGTAACATATGTAAAGTGG + Intronic
918363787 1:183785356-183785378 AAAAGTTAACACATGAAAAAGGG - Intronic
918377975 1:183928371-183928393 CAAATTTAAGACATTTAAAGTGG - Exonic
923294002 1:232575297-232575319 CTGGGTTAACACTTGTAAACTGG - Intergenic
923312149 1:232745507-232745529 CATTTCTAACACATGTAAAGTGG - Intergenic
923964327 1:239119851-239119873 CATATTTAACACATGTAAAATGG - Intergenic
924659772 1:246005637-246005659 CATAGTTTAAGCATGTAAAGGGG + Intronic
1062906389 10:1182526-1182548 CAGAGTTAAGACCTGTGACGTGG - Exonic
1063278378 10:4597008-4597030 CTTAGATAACACATGTAGAGGGG - Intergenic
1063588366 10:7373230-7373252 CAGAGAGATCACATGGAAAGAGG - Intronic
1063922852 10:10949159-10949181 CGGAGGGAACACATGTATAGAGG - Intergenic
1065124013 10:22555354-22555376 ATGAGTTCACACATGTAAAAAGG + Intronic
1066192071 10:33065209-33065231 CAGACTTAAAATATGTAAAGAGG - Intergenic
1069281519 10:66660387-66660409 TAGAGTTATCACAAGTTAAGAGG - Intronic
1070268078 10:74924120-74924142 CAGAGGTAACAGAAGTAAAGGGG + Intronic
1071129195 10:82371782-82371804 CAGAGATCACACAAGGAAAGAGG + Intronic
1072483896 10:95835766-95835788 CAGAGTAAACACACAAAAAGTGG - Intronic
1073379745 10:103068910-103068932 CAAACTGAACACGTGTAAAGTGG + Intronic
1073850172 10:107606369-107606391 AAGCACTAACACATGTAAAGAGG + Intergenic
1074711529 10:116182073-116182095 CAGATTTAACATATGTAACTGGG + Intronic
1077751224 11:4972102-4972124 CAGAATTATCACATATCAAGTGG + Intronic
1079091190 11:17481493-17481515 GAGATTTAAAACACGTAAAGTGG - Intergenic
1082151109 11:48739808-48739830 CAGAGAGAACACATGGACAGAGG + Intergenic
1082261804 11:50081984-50082006 TAAAGTTAAAAAATGTAAAGGGG - Intergenic
1084949070 11:72654784-72654806 ATGAGTTAAGAAATGTAAAGGGG - Intronic
1085482708 11:76836124-76836146 CAGATTAAAGACATGGAAAGCGG + Intergenic
1086253184 11:84842300-84842322 CAGTTTTAACATCTGTAAAGTGG - Intronic
1088300703 11:108355402-108355424 CAGAGCAAACACATGTAATCAGG + Exonic
1088549334 11:110995417-110995439 CAGAGTTCACCCAAGTAAAATGG + Intergenic
1091975864 12:4824434-4824456 CAGAGGCGACTCATGTAAAGGGG + Intronic
1094217346 12:27957403-27957425 CAGAGTAAACACGTGTCATGGGG - Intergenic
1095163917 12:38949171-38949193 TAGAATTAACACATAGAAAGGGG + Intergenic
1095267495 12:40177167-40177189 CAAACTTAAAATATGTAAAGAGG + Intergenic
1095483515 12:42659772-42659794 CAAACTTAAAACATGTAAAGAGG - Intergenic
1097142784 12:56916749-56916771 CAGACTTAATATATGTAAGGAGG - Intergenic
1097722383 12:63037101-63037123 CAGAGTTATTTCATGTAAAATGG - Intergenic
1097884873 12:64718847-64718869 CAAAGTCAGCACATGTAAACTGG + Intronic
1098490958 12:71077342-71077364 AAAAATTAACACATGTAAAATGG + Intronic
1100920071 12:99473676-99473698 CATAGTTAACACAGGTAACAGGG - Intronic
1101261731 12:103039144-103039166 CAGAATAAACACAAGGAAAGAGG - Intergenic
1101651005 12:106677095-106677117 CTGAGATAATACATGTAAAGTGG + Intronic
1103167981 12:118786954-118786976 CTGAGTTATCACCTGTAAAATGG - Intergenic
1103579644 12:121904981-121905003 CACAGTTCACCCATTTAAAGTGG + Intronic
1104165943 12:126229956-126229978 CAGAGTAAACAGAAGTACAGGGG + Intergenic
1104603331 12:130168580-130168602 CAGGGTCTTCACATGTAAAGTGG - Intergenic
1105589382 13:21776850-21776872 CAGTGTTCCCACATGGAAAGGGG - Intergenic
1106203393 13:27564847-27564869 AAGAGTAAACACTTGGAAAGAGG - Intronic
1108171755 13:47749183-47749205 CAGAGAAAACACATTAAAAGTGG + Intergenic
1110291916 13:73817560-73817582 CAAACTTAAAACATGTATAGAGG - Intronic
1110929467 13:81196511-81196533 AAAAGTTAACTAATGTAAAGTGG - Intergenic
1111480884 13:88824734-88824756 CTGAGTTAAAACATATGAAGTGG + Intergenic
1112225630 13:97537137-97537159 CAGACTTAAAATATGTAAGGAGG - Intergenic
1112643697 13:101305980-101306002 AAGAGGAAACACATGTAAAAGGG + Intronic
1112917465 13:104569264-104569286 CAGAGTTAGCAGGTGTAAACGGG - Intergenic
1113322467 13:109248632-109248654 CAAAGTTAAAATATGTAAGGAGG + Intergenic
1114667231 14:24386201-24386223 TAGAATTAAAACATGTAAAGTGG - Intergenic
1114743155 14:25118993-25119015 AAGAGTATACACATGTGAAGAGG - Intergenic
1114821270 14:26022094-26022116 CAGAGTTAAAACATTTACAAAGG + Intergenic
1115040322 14:28916656-28916678 CATAGTTAATACATATTAAGTGG - Intergenic
1117267983 14:54110576-54110598 CAAAGTTAACACCAGTAATGAGG - Intergenic
1117512405 14:56466216-56466238 TAGAGTTCACACATGAGAAGTGG + Intergenic
1118112708 14:62740065-62740087 CAGAATTCACACATTTAAACAGG + Intronic
1119331186 14:73795199-73795221 AACAGTTAACAAAAGTAAAGCGG + Intergenic
1120410039 14:84142827-84142849 CTGAGTTAAAACAGGTAAACAGG + Intergenic
1121285265 14:92730209-92730231 CAGACCTGACCCATGTAAAGAGG - Intronic
1121440400 14:93945225-93945247 CAGAGTGAACACACGGGAAGTGG - Intronic
1122289328 14:100671484-100671506 CTGAGCTACCACAGGTAAAGTGG + Intergenic
1125162105 15:36656689-36656711 CAGAGCTGACACATGAAAAATGG - Intronic
1125881927 15:43202649-43202671 CAGGGTAGACACATGGAAAGAGG + Intronic
1126712117 15:51470624-51470646 CAGAGTTAACACATGTAAAGAGG + Intronic
1126973693 15:54149413-54149435 AAGGGTTAACAGATGTAAACAGG + Intronic
1127441329 15:59011753-59011775 TAGAGATAAGACATTTAAAGAGG - Intronic
1131710707 15:95052998-95053020 CAGAGATGACACAAGTAAATGGG - Intergenic
1132366409 15:101260812-101260834 CTGAGTTAACAAATGCTAAGTGG - Intergenic
1133718172 16:8469169-8469191 CAGAGCAGACACATGGAAAGAGG - Intergenic
1137470033 16:48745980-48746002 CCTAGTTAACACATCTAAGGAGG - Intergenic
1137747511 16:50834016-50834038 CAGAGTAAACAAATACAAAGAGG - Intergenic
1138019516 16:53465581-53465603 CAGAGTTCCTACATGTGAAGAGG + Exonic
1142768966 17:2082921-2082943 CTGAGTTAATACATGAAAAATGG - Intronic
1143436567 17:6932428-6932450 CACAGCTGACAGATGTAAAGAGG + Intronic
1144236811 17:13269528-13269550 CAAAGAGAACACATGTCAAGAGG - Intergenic
1145203217 17:20966041-20966063 CTGAGTTAACATATGGAAGGGGG - Intergenic
1145772134 17:27500862-27500884 TGGAGTCAACCCATGTAAAGGGG - Intronic
1147268776 17:39251876-39251898 CAGAATAAACAGATGTAAAGTGG + Intergenic
1148004863 17:44418788-44418810 CAGAATTAACTCATGTAAAAAGG + Intronic
1148354574 17:46967344-46967366 GAGAGTTAATACATGAACAGAGG + Intronic
1149170644 17:53806901-53806923 AAGAGCTAATACATGTAAATGGG + Intergenic
1150609309 17:66720950-66720972 GAGAATGAACACATTTAAAGTGG + Intronic
1150651654 17:67014233-67014255 GAGAGCGAACACATGTGAAGTGG + Intronic
1151001827 17:70385786-70385808 GAGAGTTAATACATGCAAATTGG + Intergenic
1154056941 18:11021940-11021962 CAGAGTCACCACGTGTGAAGGGG + Intronic
1155388413 18:25306954-25306976 CAGATTTAACACAAGCAAAAAGG + Intronic
1157796764 18:50582037-50582059 CAGATTTCTCATATGTAAAGTGG + Intronic
1157932580 18:51839682-51839704 AAGAGTTAAAACATGAAAACAGG + Intergenic
1159786421 18:72720272-72720294 GAGAGATAACAAATGCAAAGAGG - Intergenic
1160907604 19:1458982-1459004 CAGAGTTTGAAGATGTAAAGTGG - Intronic
1165622720 19:37261902-37261924 GAGAGTGACCACATGTGAAGGGG - Intergenic
926519566 2:13894721-13894743 CAGTTTTAACACATGTGCAGGGG - Intergenic
927311167 2:21633263-21633285 CAGAGGTAAAAGATGTAAACCGG + Intergenic
927983639 2:27392055-27392077 CAAACTTAACACATGTAATCAGG + Intronic
928796338 2:35025537-35025559 CTGAGCTAACACATGAAAAAGGG + Intergenic
929235928 2:39605551-39605573 CAGAGCTAGCACATGTATTGAGG - Intergenic
930573483 2:53115895-53115917 CAGAGTTCAAACATTGAAAGTGG - Intergenic
930698939 2:54439887-54439909 CAGAGTAAACAAATGTCCAGTGG - Intergenic
930699366 2:54444130-54444152 CAGAGTCCCCACCTGTAAAGTGG + Intergenic
930774387 2:55158215-55158237 CAGAGATAACACATGCACACAGG - Intergenic
932006148 2:67929090-67929112 CAGATTTATCACATGCACAGGGG + Intergenic
932873082 2:75423403-75423425 CACAGTTCAAACATGTAAATTGG + Intergenic
932919012 2:75888655-75888677 CAGAGTTGAGTCATTTAAAGTGG - Intergenic
933222666 2:79708479-79708501 AAGATTTAAGACATTTAAAGTGG - Intronic
933484637 2:82903505-82903527 CAAAGTAAACACAAGTAAAACGG - Intergenic
937049777 2:118879034-118879056 CAGAGCAGACACAGGTAAAGAGG + Intergenic
937790325 2:125953520-125953542 CAGACTTAAAATATGTAAGGAGG + Intergenic
938127402 2:128684555-128684577 CAGAATCAACACATAGAAAGGGG - Intergenic
939164218 2:138622651-138622673 CAAACTTAAAACATGTAAGGAGG - Intergenic
939675653 2:145069123-145069145 CATAATGAACACATATAAAGAGG + Intergenic
940041541 2:149366844-149366866 CAAAGTTAAAACTTGTAAAGGGG - Intronic
941102979 2:161318094-161318116 CAGAGTTAACCAATACAAAGTGG - Intronic
941761002 2:169243330-169243352 CAGTGTTAACACATGGACACAGG - Intronic
942516912 2:176764023-176764045 CCGAGATCACACATGTCAAGAGG + Intergenic
944468881 2:200031899-200031921 CACAGCTAACACAAGTGAAGAGG + Intergenic
945944849 2:215985119-215985141 CACAGTTAACATATGCAAAGTGG + Intronic
946166661 2:217868665-217868687 CAGTGTTCTCACCTGTAAAGTGG - Intronic
946639250 2:221765806-221765828 CAGTCTTAACACATTTAAAGTGG + Intergenic
948269050 2:236659783-236659805 CAGAGTTGACACACGTAATTAGG - Intergenic
948275473 2:236704932-236704954 CAGAGTTATCATCTGTAAAATGG - Intergenic
1168863473 20:1063370-1063392 GAGAGTTAACACACCCAAAGTGG + Intergenic
1168885928 20:1255517-1255539 TATAGTTAACACATTTAGAGAGG - Intronic
1169347129 20:4837641-4837663 CAAAATTAAAACATGTAAACTGG + Intergenic
1169827932 20:9790358-9790380 TTGAGATAACACATGAAAAGAGG + Intronic
1169984256 20:11424487-11424509 CAGAGGTAACACTAGTACAGTGG - Intergenic
1170063870 20:12289383-12289405 CTGAGTTAACACATGGCAGGAGG + Intergenic
1170117094 20:12872268-12872290 ATGAGTTAACATATGTAAAGTGG + Intergenic
1172555996 20:35842008-35842030 CTGAGTTCCCTCATGTAAAGTGG - Intronic
1173356997 20:42302817-42302839 CAGAGTAAACAAATGCAAATGGG + Intronic
1173503736 20:43571397-43571419 AAGAGATAACACTTTTAAAGGGG + Intronic
1174881331 20:54282450-54282472 CAGAGTAAACAGAGGTAAAGAGG - Intergenic
1175556388 20:59861014-59861036 CAGACTTATAACATGTAAAGAGG - Intergenic
1177660476 21:24076247-24076269 ATGACTTAAGACATGTAAAGGGG - Intergenic
1178524334 21:33313505-33313527 CAGACTTAAAATATGTAAGGAGG + Intergenic
1180624938 22:17188137-17188159 TAGAAATAATACATGTAAAGTGG + Intronic
949463322 3:4317794-4317816 TTGAGTTAACACATGCAAAGGGG + Intronic
951221900 3:20077484-20077506 CAGAGTAAACACATTTCATGTGG - Intronic
952660580 3:35841741-35841763 CAGAGTTAACACATTTAGAAAGG + Intergenic
952725211 3:36576405-36576427 TAGTATTAACACATCTAAAGAGG - Intergenic
955584710 3:60463780-60463802 CAGTGTTAACTTATGTAAAATGG + Intronic
956104594 3:65804562-65804584 CAAATTTAAAATATGTAAAGAGG - Intronic
956135575 3:66095352-66095374 CAGAGTTAACTCATTCAAACTGG + Intergenic
956358055 3:68415714-68415736 CAGAGAGAACACATGTAAAGGGG - Intronic
956364505 3:68485337-68485359 CACTGTTAACACATGTAGTGTGG - Intronic
956506423 3:69945114-69945136 CACTGTTAACACAAGTAAACTGG - Intronic
956999317 3:74866930-74866952 AAGAATTTACACATGTAAACTGG + Intergenic
957648221 3:82963268-82963290 CAGAGTTAAGAAATGTAGAAAGG - Intergenic
958075434 3:88670497-88670519 CAGTTTTCACACCTGTAAAGGGG + Intergenic
958589115 3:96131366-96131388 CTCAGTTAACAAATGTGAAGTGG - Intergenic
958985352 3:100774345-100774367 CAGAGTAAACACATGTGGGGTGG + Intronic
960408635 3:117293529-117293551 CAGAGCTAGCACATGTCTAGTGG - Intergenic
962169618 3:133087319-133087341 CAGCGTTATCACATCTAAATAGG - Intronic
964514113 3:157488756-157488778 CAGACTTTACACATGTAAAGTGG + Intronic
965529098 3:169753112-169753134 CAGAGTTAACACCAGGAAAAAGG + Intergenic
966166756 3:177028077-177028099 CAGAGCTAAGACATTTAAAAAGG + Intronic
967672912 3:192260551-192260573 CAGAATTTACACATGTGATGTGG + Intronic
969268514 4:6082077-6082099 CACAGCCAACACATGTGAAGGGG + Intronic
969530495 4:7727742-7727764 CAGTTTTCTCACATGTAAAGTGG - Intronic
971440843 4:26683351-26683373 ATGAGTTAACTCTTGTAAAGTGG + Intronic
974703285 4:65479245-65479267 CAGGTTTTTCACATGTAAAGTGG - Intronic
975267687 4:72390414-72390436 CAGTTTTCACACATGTAAAATGG - Intronic
978294757 4:107191971-107191993 CACACTTAAAACATGTAAGGAGG + Intronic
979417202 4:120457876-120457898 CAGAGTGAACACAAATCAAGAGG + Intergenic
980258648 4:130417921-130417943 AAGAGTTAATACATGAAAAATGG - Intergenic
980948016 4:139342139-139342161 CAGAGTTAACATACATAAAGAGG - Intronic
984512013 4:180690732-180690754 CAGAATTAAAACATGTGCAGTGG + Intergenic
985185963 4:187315984-187316006 TGGAGTTAACACAGGTGAAGAGG - Intergenic
988054827 5:26081117-26081139 CAGATTTCACACAGGAAAAGAGG + Intergenic
988349211 5:30079173-30079195 ATGAGATAATACATGTAAAGTGG + Intergenic
988695192 5:33614850-33614872 ATGAGTAAACACATGGAAAGTGG + Intronic
990167510 5:53010922-53010944 GAGATTTGACACATGTAAAGGGG + Intronic
991395552 5:66201156-66201178 CAAACTTAACATGTGTAAAGAGG + Intergenic
993667746 5:90722063-90722085 GAGAGTTACCATATGTAATGTGG + Intronic
994017676 5:94987201-94987223 CTGAGTTAAGACATGCAAAGTGG - Intronic
994365327 5:98909639-98909661 CAGAGTTAACAAATATGATGAGG - Intronic
995231849 5:109773699-109773721 CAGAGATTACAAATGTAAAAAGG + Intronic
996044676 5:118857852-118857874 TAGAATTAACACTTGAAAAGTGG + Intronic
997167559 5:131677049-131677071 AAGAGATAATACATGTAAAATGG - Intronic
997859906 5:137406796-137406818 CAGTGTTCACACCTGTAAAATGG + Intronic
998314667 5:141172107-141172129 AAGAGTTAAGACCTGGAAAGTGG + Intergenic
998979639 5:147687815-147687837 ATGAGTTAATACATGTACAGTGG - Intronic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
999826676 5:155280281-155280303 CCGAGTTAACAGAGGTAGAGAGG + Intergenic
1000154744 5:158539411-158539433 CAGAGCTAACAGAAGGAAAGAGG - Intergenic
1000880665 5:166693306-166693328 TAGAGTTAACACAATTATAGTGG + Intergenic
1001463807 5:171943812-171943834 AAGAGTTGCCACTTGTAAAGAGG + Intronic
1007273295 6:40654725-40654747 AAGGGTTAATACAGGTAAAGTGG + Intergenic
1007307878 6:40921288-40921310 ATGAGTTAACACATGTGGAGTGG - Intergenic
1008280765 6:49593052-49593074 TACAGTTTACACATGTGAAGTGG + Intergenic
1008464586 6:51816536-51816558 CAGACTTAAAATATGTAAGGAGG - Intronic
1008583315 6:52925817-52925839 CAGAGTTACTAGATTTAAAGGGG - Intergenic
1009426657 6:63521490-63521512 CATAAACAACACATGTAAAGAGG + Intergenic
1011947164 6:92920394-92920416 CAGAGTAAACATATTTGAAGTGG + Intergenic
1011949569 6:92948246-92948268 CAGAATTATGACATGTTAAGTGG - Intergenic
1012798110 6:103789653-103789675 TCAAATTAACACATGTAAAGAGG - Intergenic
1013268657 6:108525191-108525213 CAGACTTAACAGAGGTCAAGCGG + Exonic
1014317249 6:119883303-119883325 AAGAGTAAAGACATGTCAAGAGG - Intergenic
1014619125 6:123643996-123644018 GAGAGTGAATACATGTTAAGAGG - Intergenic
1017217701 6:151929444-151929466 CAGAGTTATTACATTTAAAGTGG + Intronic
1017737315 6:157377210-157377232 CAAACTTAAAATATGTAAAGAGG + Intergenic
1018505903 6:164468318-164468340 CAGGATTACCACATGTAAAATGG + Intergenic
1028216457 7:88139480-88139502 CAGAGTTATCAAATTTAAATAGG - Intronic
1028563839 7:92205810-92205832 CATATTTAACACATTTAAATGGG - Intronic
1028742802 7:94295661-94295683 CAGAGTTATCAGAGGTACAGAGG - Intergenic
1030562612 7:111109645-111109667 CTGAGTTATCACCTGTAAAGTGG + Intronic
1030975341 7:116115081-116115103 TAGAGGTATCACATGTAACGTGG + Intronic
1032644486 7:133807248-133807270 CAGTTTTATCACATGTAAAATGG + Intronic
1032660432 7:133977936-133977958 CAAACTTAAAACATGTACAGAGG - Intronic
1032690780 7:134284426-134284448 TAGATTTAACACATTTAAAATGG + Intergenic
1034244625 7:149635078-149635100 TTGAGTTATCACATGTAAATCGG + Intergenic
1036394719 8:8359786-8359808 CGCAGTTAACAAATTTAAAGAGG + Intronic
1036532992 8:9614022-9614044 CTGAGTGATCACATGCAAAGGGG - Intronic
1037467395 8:19173454-19173476 CAAACTTAAAATATGTAAAGAGG + Intergenic
1037680010 8:21089403-21089425 TTGAGTTAATACCTGTAAAGTGG - Intergenic
1039389279 8:37164041-37164063 CAGAGTTGAAAGATGGAAAGAGG + Intergenic
1039422953 8:37460197-37460219 CAGTTTTTACACCTGTAAAGTGG + Intergenic
1040011741 8:42666853-42666875 CAAATTCAACACATGTAAAATGG + Intergenic
1040654824 8:49495316-49495338 TAGAGTTTTCACATGTAAAAAGG - Intergenic
1040872474 8:52114726-52114748 CAGAGCTAACACAAGGCAAGTGG - Intronic
1041008792 8:53521470-53521492 CAGATTTACCAGATTTAAAGGGG + Intergenic
1041026265 8:53689821-53689843 CACAATGAACACATGTACAGAGG - Intergenic
1042641601 8:70941502-70941524 CAGAGTTAGCACATCTGAAGAGG + Intergenic
1043692319 8:83169496-83169518 TAGAGATAAGACATTTAAAGAGG + Intergenic
1044099597 8:88117370-88117392 CAAAGTTTACACATGTAATTTGG + Intronic
1044257931 8:90087746-90087768 CAGAGATAAAATATGAAAAGTGG - Intronic
1045469946 8:102503430-102503452 CACACTTATCACATGTCAAGTGG + Intergenic
1046025621 8:108719868-108719890 CAGTGTTTACACATATAAAGTGG - Intronic
1048155989 8:131952242-131952264 ATGAGTTAATTCATGTAAAGTGG - Intronic
1048272952 8:133043999-133044021 CAGAGTTAGTTCATGGAAAGTGG - Intronic
1048415828 8:134226720-134226742 CAAACTTAAAATATGTAAAGAGG - Intergenic
1049326474 8:142024041-142024063 CAGAGTTCTCACCTGAAAAGTGG + Intergenic
1051008323 9:12377743-12377765 AAGACTTAGCACATTTAAAGAGG - Intergenic
1051865555 9:21676953-21676975 CAAACATAAAACATGTAAAGAGG + Intergenic
1052380779 9:27768478-27768500 CAGAATTTACAGATGGAAAGTGG - Intergenic
1052500983 9:29289697-29289719 CAAACTTAAAACATGTAAGGAGG + Intergenic
1055694368 9:78867798-78867820 CAGTTTTTACATATGTAAAGTGG - Intergenic
1057389461 9:94630615-94630637 CTGAGTTGATACAGGTAAAGTGG + Intronic
1059651642 9:116320993-116321015 CTGAGATGAGACATGTAAAGTGG + Intronic
1059877473 9:118651246-118651268 CAGAGTTAATACCAGGAAAGGGG - Intergenic
1061499702 9:130994778-130994800 CAGAGTTAACAGATTTAGACAGG - Intergenic
1187298322 X:18024330-18024352 CAGCGTTATCACTTGTAATGCGG + Intergenic
1188317768 X:28695781-28695803 TAGAGTTTACACATGTAAGCTGG + Intronic
1189567972 X:42263307-42263329 CAGAATGAACACATATAAAGAGG - Intergenic
1190367579 X:49711227-49711249 CAGATTTATCACACATAAAGTGG + Intergenic
1190774399 X:53541167-53541189 ATGAGTTAAAACATGTATAGTGG - Intronic
1191171992 X:57457792-57457814 CAGAGGTAACACAAATAAATGGG + Intronic
1191853382 X:65602789-65602811 CAGAGTTAACACTTGATAAATGG + Intronic
1192052507 X:67738571-67738593 GAGAGTTAACATATTTAAAATGG - Intergenic
1192192615 X:69001074-69001096 CAGAGGAAACAGATGCAAAGTGG + Intergenic
1193754560 X:85391924-85391946 CAAACTTAACATATGTAAGGAGG - Intergenic
1194350885 X:92824397-92824419 CGGAGGGAACACATGCAAAGTGG - Intergenic
1194504035 X:94710521-94710543 AAGAGGGAACACATGCAAAGTGG - Intergenic
1194966241 X:100291694-100291716 CAGAGAAAACACATTTAAAGGGG + Exonic
1195956841 X:110340210-110340232 ATGAGATAACGCATGTAAAGTGG + Intronic
1196270734 X:113707631-113707653 CAAACTTAAAATATGTAAAGAGG - Intergenic
1197823395 X:130564013-130564035 CTGAGTTAACACATATGAACTGG + Intergenic
1197933794 X:131720327-131720349 TAGAGGGAACGCATGTAAAGCGG + Intergenic
1199299604 X:146197572-146197594 CAGAGTGTTCTCATGTAAAGAGG - Intergenic
1199431437 X:147765057-147765079 CAGAGCTGACTCATCTAAAGTGG - Intergenic
1199494313 X:148436294-148436316 ATGAGGTAACACATGTAAAGTGG + Intergenic
1200376720 X:155788636-155788658 CAGAGGTAAGCTATGTAAAGGGG - Intergenic