ID: 1126717401

View in Genome Browser
Species Human (GRCh38)
Location 15:51533602-51533624
Sequence GTGCACACCTTGACATCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126717401 Original CRISPR GTGCACACCTTGACATCACT TGG (reversed) Intronic
901758325 1:11454900-11454922 GCTCACACCTTGACTTCAGTTGG - Intergenic
902490198 1:16775836-16775858 GTGCACACCTGGCCTTCTCTGGG + Intronic
902662741 1:17916738-17916760 GTCCACACCAGGACATCACAGGG + Intergenic
905515599 1:38559689-38559711 CCGCACACCTTGCCATCCCTGGG + Intergenic
908817302 1:68047467-68047489 GTGCACCCCTTTACGTCACAGGG - Intronic
913982167 1:143530685-143530707 ATGCACACCTGGCCACCACTGGG + Intergenic
923530240 1:234806694-234806716 GTGCACACCTGGCCTTCTCTGGG - Intergenic
1066302356 10:34108237-34108259 GTGCCCATCTTGACAGCACCCGG + Intergenic
1066381680 10:34907088-34907110 GTGGACACCATGACAAAACTAGG - Intergenic
1087847527 11:102990239-102990261 GTGGACACCTGTACATCCCTGGG + Intergenic
1089815132 11:121166135-121166157 GTGCTCACCTGGGAATCACTAGG + Intronic
1090942164 11:131396424-131396446 GTGTACACCTTCACACCTCTCGG + Intronic
1094387213 12:29908047-29908069 CCTCACACCTTGCCATCACTGGG - Intergenic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1104267262 12:127245085-127245107 GAACAAAACTTGACATCACTGGG - Intergenic
1110925191 13:81142111-81142133 GTGCTCCCCTTGAAAGCACTAGG - Intergenic
1115666741 14:35558729-35558751 CTGAACAGCTTGACAGCACTAGG - Intronic
1122392649 14:101400604-101400626 GTTCACACCTGGCGATCACTGGG - Intergenic
1122599364 14:102913653-102913675 GTGCACACCGGGCCATCACCTGG + Intergenic
1123709758 15:22979214-22979236 CTGCAGATCTAGACATCACTTGG + Intronic
1126717401 15:51533602-51533624 GTGCACACCTTGACATCACTTGG - Intronic
1143857273 17:9861178-9861200 GTGCACACCTGGAGAACACAGGG + Exonic
1147646148 17:42035291-42035313 GTGATCACCTTGGCATCTCTTGG + Intronic
1151033783 17:70774165-70774187 ATGGACACCTTGACAACATTAGG + Intergenic
1158021251 18:52844817-52844839 CTTCACTCATTGACATCACTGGG - Intronic
1160627952 18:80225870-80225892 GAGCACACCTAGTCATCTCTGGG + Intronic
1165322849 19:35096915-35096937 GGGAGCACCTTGTCATCACTGGG - Intergenic
1168219103 19:54947635-54947657 AGGCTCACCTTGACATCACCTGG + Exonic
928953977 2:36842421-36842443 GGGCTCTCCTTTACATCACTGGG + Intergenic
929978415 2:46656606-46656628 GTACACACCTTGAAATTCCTGGG + Intergenic
941323155 2:164080730-164080752 GAGCACAACTTGACATTAGTGGG - Intergenic
1170207977 20:13820067-13820089 GTGCACACCGTGACACCTGTTGG + Exonic
1172995481 20:39067184-39067206 GTGCACACTTTGACTAGACTAGG + Intergenic
1175285701 20:57835328-57835350 GTGCACTCCCTGACCTCACTGGG - Intergenic
1179724126 21:43332333-43332355 GTAGACACAATGACATCACTCGG + Intergenic
1179784096 21:43719885-43719907 GTGGGCACCGTGACCTCACTCGG - Intronic
1182902283 22:33908460-33908482 GTGCACAGCTTGACAGGTCTAGG + Intronic
1184842626 22:47061325-47061347 CTGCACACCTGGGCATCTCTGGG - Intronic
1185423500 22:50748721-50748743 GTGCCCACCTAGACATCCCGAGG + Intergenic
961629167 3:128283713-128283735 GTCCACACCTTGGCAGAACTGGG + Intronic
969172428 4:5375056-5375078 GCGCTCACATTGACCTCACTCGG - Intronic
969200440 4:5600058-5600080 GGGCATCCCTTCACATCACTTGG + Intronic
969242033 4:5905530-5905552 GCACACACCTTTACGTCACTGGG + Intronic
970249172 4:14095941-14095963 GTGCAAGTCTTGACATCTCTGGG + Intergenic
970648821 4:18155472-18155494 GTGAACACCTTGAAAGAACTTGG + Intergenic
981398508 4:144283411-144283433 CTGCAGACCTTGACTTCTCTTGG - Intergenic
987499301 5:18686632-18686654 GTGCACAACTTGCCAACTCTTGG - Intergenic
988736241 5:34024181-34024203 GTGTACACATTGAAAGCACTTGG - Intronic
991470905 5:66968086-66968108 GAGCACGCCTTGCCATCAATAGG + Intronic
993463303 5:88212582-88212604 TTGCTCACCTTGACCTCACAAGG - Intronic
996582295 5:125044867-125044889 GTGCCCATCTAGGCATCACTTGG - Intergenic
997020308 5:129992849-129992871 GTACACAACTTGACATAACATGG - Intronic
997198533 5:131995456-131995478 GAGCCCACCCTGCCATCACTGGG - Intronic
999658687 5:153835618-153835640 TTGCAAACCTTGAAATCAATGGG + Intergenic
1002818635 6:701750-701772 CTGCACACCATCACATCAGTGGG - Intergenic
1004162692 6:13229031-13229053 GTTCTTTCCTTGACATCACTTGG - Intronic
1007304941 6:40896614-40896636 GTGCACTCCATGACCTCCCTTGG + Intergenic
1010057242 6:71581138-71581160 CTGCACAGCTTTAAATCACTGGG + Intergenic
1012631613 6:101476810-101476832 GTGCTTAGCTTGACATCACTTGG - Intronic
1015457307 6:133441502-133441524 GTGCACACCTGGACAACAGAGGG + Intronic
1019612653 7:1944793-1944815 GGGCACACCCTGACGTCACCTGG - Intronic
1021708081 7:23387864-23387886 GTCCAGTCCTTGACAACACTTGG - Intronic
1023741737 7:43287304-43287326 GTGCACCCCCAGACATCTCTGGG - Intronic
1026395599 7:69950698-69950720 CAGCATACCTTGACATTACTTGG - Intronic
1027510966 7:79079239-79079261 GTGCTTACCATGACAGCACTTGG - Intronic
1029859062 7:103549660-103549682 GTGTTCACATTAACATCACTTGG - Intronic
1029870289 7:103683994-103684016 CTGCAAACCTTGAGAACACTGGG - Intronic
1031872877 7:127106582-127106604 GTGGACATCGTGACAGCACTGGG - Exonic
1033144020 7:138855468-138855490 ATCCACACCATGACATCAGTTGG - Intronic
1034772293 7:153791884-153791906 GTCCCCACCTTAAAATCACTTGG - Intergenic
1039016170 8:33151519-33151541 GTGCATACTTTCACATAACTTGG + Intergenic
1042226019 8:66514881-66514903 CTGCACACTTTGAAAGCACTGGG + Intronic
1044704824 8:94998590-94998612 GTCCTCACCTTGATGTCACTAGG - Intronic
1055832207 9:80393884-80393906 ATGGACACCTTGAGATCACAGGG + Intergenic
1062687285 9:137820461-137820483 GTTCACTCCTAGACATCATTAGG - Intronic
1192571549 X:72210377-72210399 TTTCACACCTTGCCAACACTTGG - Intronic
1201580288 Y:15503995-15504017 GTTCACACTTTCACATCGCTGGG - Intergenic