ID: 1126724524

View in Genome Browser
Species Human (GRCh38)
Location 15:51618135-51618157
Sequence CTTTTGGCCAGGGGAATCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126724524_1126724531 14 Left 1126724524 15:51618135-51618157 CCCTTGATTCCCCTGGCCAAAAG 0: 1
1: 0
2: 0
3: 9
4: 127
Right 1126724531 15:51618172-51618194 CTGAATTCCCACTTAAATGCTGG 0: 1
1: 0
2: 2
3: 6
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126724524 Original CRISPR CTTTTGGCCAGGGGAATCAA GGG (reversed) Intronic
900409436 1:2506133-2506155 CCTGTGGCCAGGGGAGTCAGGGG + Intergenic
900613177 1:3553046-3553068 CTGGTGGCCAGGGGCCTCAAAGG + Intronic
900678095 1:3900943-3900965 CTGTTAGCCAGGGGATGCAAGGG - Intergenic
903562641 1:24239708-24239730 CTTCAGTCCAGGGGAATCCAAGG - Intergenic
903847322 1:26286026-26286048 CTCTTTGCCAGGGGACTCATTGG - Exonic
903986043 1:27229495-27229517 CTTTCTGTAAGGGGAATCAATGG - Intergenic
906151025 1:43587907-43587929 CTTCTGGTCAGGGGAGTCCAAGG + Intronic
910213137 1:84814244-84814266 CCTTTAGCCAGTGGCATCAAGGG + Intronic
919169422 1:193935121-193935143 CTTCTGCACAGGGAAATCAATGG + Intergenic
920248885 1:204608991-204609013 CTCTTGCCCTGGGGAAGCAAAGG + Intergenic
921430564 1:215060249-215060271 GTATTGGCCAGAGGAGTCAAGGG + Intronic
921741641 1:218691925-218691947 ATTTTCTCCAGGGGAATAAAAGG - Intergenic
1063989436 10:11544153-11544175 GTTTTGGCCAGGTGAATTGAGGG - Intronic
1064575603 10:16743014-16743036 GTGAAGGCCAGGGGAATCAAAGG + Intronic
1067329906 10:45305567-45305589 CTTTTGGCAATGGGAAGCCATGG - Intronic
1069732396 10:70625854-70625876 CTTTTGGCCAAGGGGATCCTAGG + Intergenic
1071197183 10:83175265-83175287 CTCTTGGCCAGGGGTAGCAGTGG - Intergenic
1078272115 11:9805545-9805567 CTTTTGTGGAGGGGAATAAAAGG + Intronic
1078449643 11:11430910-11430932 CTTTTGGTCAGAGGAATGATGGG - Intronic
1084844672 11:71889654-71889676 GTTTTGGCCAGGGCAGACAAAGG - Intronic
1091034929 11:132224405-132224427 CTTTTCTCTAGGGGAATGAATGG + Intronic
1093930454 12:24950286-24950308 CTGTTGGTCAGGTGAATGAATGG + Intergenic
1094272292 12:28630168-28630190 CTTGTGCCCAGGGGAATCTGGGG - Intergenic
1099231486 12:80030897-80030919 CTTTGGGGCAGGGAAATCCACGG + Intergenic
1100650229 12:96579129-96579151 CTTTTTGCATGGGAAATCAAAGG + Intronic
1100952269 12:99864339-99864361 CTTTTAGCCATGAAAATCAAAGG + Intronic
1101285839 12:103311345-103311367 CTATTGGCCTGGGTAATCACTGG - Intronic
1101926034 12:108972085-108972107 CTTTAGGGCAAGAGAATCAATGG + Intronic
1103244454 12:119444625-119444647 CTTGTGGCCATGAGAAGCAATGG - Intronic
1104743766 12:131197274-131197296 ATTGTGGCCAGGGGAATGCAGGG + Intergenic
1104790571 12:131479439-131479461 ATTGTGGCCAGGGGAATGCAGGG - Intergenic
1112614098 13:100985668-100985690 CTGTTGGCCAGGGGAAGCCCAGG + Intergenic
1115071361 14:29326420-29326442 CTTTTGGCAAGCAGAATCATTGG - Intergenic
1115843421 14:37498183-37498205 CTTTTGGGGAGGGGAAAAAATGG + Intronic
1126053708 15:44710592-44710614 TTTATGGACAGGGGAAACAAAGG - Intronic
1126724524 15:51618135-51618157 CTTTTGGCCAGGGGAATCAAGGG - Intronic
1127497629 15:59527686-59527708 TTGTTGGCCAGGGGAGTCCAGGG + Intergenic
1131312431 15:91303084-91303106 CCTTTGCCAAGGGGAATGAACGG + Intergenic
1134138735 16:11698144-11698166 CTTTCGGCCAGGGGATTAAAAGG + Exonic
1135465848 16:22684204-22684226 CTCTTGCCCAGGGGGATGAATGG + Intergenic
1136646854 16:31628087-31628109 CTTTTGGCCAGATTAAGCAAAGG + Intergenic
1136658327 16:31728190-31728212 CTTTTGGCCAGATTAAGCAAAGG - Intronic
1137298436 16:47121374-47121396 ATTTTTGCCAGGTGACTCAAAGG + Intronic
1137499356 16:48998400-48998422 CCTCTGGCCAGGGAAGTCAAAGG + Intergenic
1137948190 16:52756064-52756086 CTTCTGGCAAGTGGAGTCAATGG - Intergenic
1141923014 16:87148643-87148665 CTTCTGCCCAGGGGAAACCAAGG + Intronic
1143642591 17:8207609-8207631 CTTCTGGCCAGGGGCAGCTAAGG + Exonic
1146108258 17:30062795-30062817 CTTTGGCCCAAGGGAATGAAGGG - Intronic
1146466177 17:33088545-33088567 TTTTTGGCCAGGGGATGCTAAGG - Intronic
1149249618 17:54753552-54753574 GTATTGGCCATAGGAATCAATGG - Intergenic
1153588372 18:6647194-6647216 CTGCTGGCCAGGCTAATCAAAGG + Intergenic
1154297112 18:13161038-13161060 ATTTTGGCAAGGGTAATCCAGGG + Intergenic
1161196887 19:2991832-2991854 CTTCTGGCCAGGGACCTCAAGGG + Exonic
1162767520 19:12928847-12928869 CCTGTGGCCAGGGGAAGGAAGGG + Exonic
1166781344 19:45345150-45345172 CTCTGGGCCAGGGGATCCAAGGG + Intronic
1167345784 19:48944838-48944860 CTTTCCGACAGGGGAATCACAGG - Exonic
930219176 2:48728249-48728271 CTTTCGTCCAGGGGAAGGAATGG - Intronic
936154376 2:110038711-110038733 TTTTTGACCAGAGGAATAAAAGG + Intergenic
936190307 2:110332703-110332725 TTTTTGACCAGAGGAATAAAAGG - Intergenic
941887711 2:170546546-170546568 GTTTTGGGCAGGAGAAGCAAAGG + Intronic
942786122 2:179705014-179705036 GTTTAGGCCAGGGGAAAAAAAGG - Intronic
1169312349 20:4554951-4554973 CTAATGGCCAAGAGAATCAATGG + Intergenic
1170503881 20:17003878-17003900 CTTTGGGCCAGGGGTAGGAAAGG + Intergenic
1173219465 20:41120082-41120104 CTGTTTGCCAAGTGAATCAATGG + Intronic
1179044482 21:37832318-37832340 CTTTTGTCCCGGGGGATAAAGGG + Intronic
1181429470 22:22869866-22869888 CTATTGGTCAGTGGAATGAATGG + Intronic
1182371378 22:29813533-29813555 CTTTTGGCAACAGGAATTAAAGG - Exonic
949923852 3:9025213-9025235 CTTGTGGCCAGGGGAAGCCAGGG - Intronic
949935732 3:9114066-9114088 GCTTTGGCCAGGGGACTCAATGG - Intronic
951356659 3:21675325-21675347 TTTTATGCCACGGGAATCAAGGG - Intronic
952175493 3:30858323-30858345 GTTTAGGACAGGGGAATGAAAGG + Intronic
954935115 3:54319386-54319408 CTCTTACCCAGGGAAATCAAGGG - Intronic
955432724 3:58865559-58865581 CTTTGGGCCAGTGAACTCAACGG + Intronic
956130033 3:66044375-66044397 CTTTTGGTCTGAGGAACCAAGGG + Intergenic
957581075 3:82074116-82074138 GTTTTGGCCTGGGAAATAAAGGG + Intergenic
957836127 3:85592501-85592523 CTTTTGCCCACAGGAATCATAGG + Intronic
957836727 3:85603550-85603572 TTTTTCCCCAGGGGAAACAAAGG + Intronic
957844751 3:85717493-85717515 GTTCTGGCCAGGGCAATCAGGGG - Intronic
959114563 3:102161443-102161465 CTTTAGGCCAGGATCATCAATGG + Intronic
959619307 3:108382867-108382889 CTTTAGGCGAAAGGAATCAAAGG - Intronic
963351110 3:144152101-144152123 TTTTTGGCCAGTGGAAGTAATGG - Intergenic
965239082 3:166170890-166170912 TTTCTAGCCAGGGCAATCAATGG - Intergenic
967143260 3:186582272-186582294 CTTTTGGCCATGACATTCAAAGG - Intronic
968309682 3:197673239-197673261 CTTTGAGGCAGAGGAATCAAGGG + Intronic
968662422 4:1804254-1804276 CTCTGGGCCAGGGGCATCCATGG + Intronic
971268687 4:25117205-25117227 CTGTTGGCCACGGGTATCAAAGG + Intergenic
971785022 4:31090063-31090085 CATTTGGCCACCGAAATCAAAGG - Intronic
980795828 4:137681321-137681343 TATTTGGCCAGCAGAATCAATGG - Intergenic
980817702 4:137969312-137969334 GTTTTGGCTAAGGGAATCTATGG - Intergenic
983387594 4:167084986-167085008 CTTTTGTCCAGAGGGATCCAGGG + Intronic
984300784 4:177914710-177914732 GCTTTGGTGAGGGGAATCAAAGG - Intronic
986714129 5:10510386-10510408 CTTTTGGGAAGGGGATGCAACGG + Intronic
986873246 5:12075635-12075657 CTTTTGGCTTGAAGAATCAAAGG + Intergenic
988410019 5:30875099-30875121 CTATTGGCAAGGGAAGTCAATGG - Intergenic
990058460 5:51616032-51616054 CTATTGACCCTGGGAATCAAGGG + Intergenic
1001938863 5:175727115-175727137 CATTTGGCCAAGGAAATCTAGGG - Intergenic
1002028641 5:176412621-176412643 TGTTTGGCCTGGGGACTCAAGGG + Intronic
1002858468 6:1058597-1058619 CTGTTGACCAGGGGACACAAAGG + Intergenic
1003050722 6:2778662-2778684 CTCTTGGCCTGGGGAATCTTGGG - Intronic
1003192887 6:3889775-3889797 CTCTTGGCCAGGGGTATCCCAGG + Intergenic
1006246391 6:32740783-32740805 TTTTTGACCAGGGCAATTAAAGG - Intergenic
1006749258 6:36366438-36366460 CTTTTGGGCAGGGCAATCCTGGG - Exonic
1008703245 6:54127044-54127066 CATTTGACCAGAGGAATCAAGGG - Intronic
1008714385 6:54271239-54271261 CTTTGGGCAAGGGGATTCAGAGG - Intergenic
1010044732 6:71427999-71428021 CTTTTTTCCAGGGGAAGTAAGGG - Intergenic
1013413564 6:109904292-109904314 ATTTTGACCTGGGGAATCCAAGG - Intergenic
1013658975 6:112275229-112275251 CTTTTGGCCAGTGAAATCTGAGG - Intergenic
1017595165 6:156020642-156020664 CCTGTGGCCAGGGGCATCAGGGG + Intergenic
1021534688 7:21689918-21689940 CTGCTGGCCAGGGCAATGAATGG - Intronic
1022873041 7:34499324-34499346 CTTGTGGCCAAGGAAGTCAATGG + Intergenic
1023971935 7:44998278-44998300 CTGTTGGCCTGGGGAAGCAAGGG - Intergenic
1024275658 7:47674644-47674666 ATTTTAGGCAGGGGAATCATAGG + Intergenic
1033017521 7:137687061-137687083 CTTTGGCTCAGGGGAATCAATGG - Intronic
1034047636 7:147946889-147946911 CTTAGGGACAGGGGAATCACAGG + Intronic
1035143856 7:156792813-156792835 CGATTGCCCAGGGGAATCCATGG + Intronic
1036747970 8:11423653-11423675 CATGTGGCCAGGGGAGACAATGG + Exonic
1038900418 8:31836428-31836450 CCTTTGGAGAGGGGAATCAATGG - Intronic
1042110444 8:65375952-65375974 CTCTTGGCCAGTGGGAACAAGGG + Intergenic
1046080176 8:109362225-109362247 CTTTTGGCGAAAGGAATCAATGG - Intergenic
1046583050 8:116116963-116116985 CTGTTGGCCAAGGTAATAAAAGG + Intergenic
1046697585 8:117359204-117359226 CTTTTGGCCATGGGATTTTAGGG + Intergenic
1047303156 8:123632386-123632408 CATTTGGCCTGGGGAAGCAGGGG - Intergenic
1047475836 8:125228491-125228513 ATTTTGACCAGCAGAATCAAGGG + Intronic
1047943376 8:129848924-129848946 CCTTTGGCCAAAGGAATTAAAGG + Intronic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1050802120 9:9628544-9628566 CTTTTGCCAAGGGGAGTGAAAGG - Intronic
1058985232 9:110203764-110203786 CTTCTGGCAAAGTGAATCAAGGG - Intronic
1059692310 9:116697893-116697915 CTATTGGCCAGTAGCATCAATGG + Exonic
1061747819 9:132753175-132753197 CTTTTGTCCTGGGGAATCTGAGG + Intronic
1186869561 X:13757116-13757138 CCTTGGGCCTGGGGAATCAGAGG - Intronic
1190262067 X:48803529-48803551 CTTAAGACCAGGGGATTCAAGGG + Intronic
1193524392 X:82572052-82572074 ATTTTTGCCAGGGGAAAGAAAGG - Intergenic
1195559375 X:106266075-106266097 CTTGTGGCCTGGGGTAGCAAGGG - Intergenic
1196877690 X:120169943-120169965 CTTGTGGCCAGGGGTGTCAGTGG - Intergenic
1198038201 X:132822280-132822302 CTCTGGGCCAGGGGAAGAAAGGG - Intronic
1199320103 X:146427850-146427872 TTTTTGGCCAGAGCAATGAAAGG - Intergenic
1199702450 X:150392542-150392564 CCTCTGGGCAGGGGAATCAGAGG + Intronic