ID: 1126728333

View in Genome Browser
Species Human (GRCh38)
Location 15:51655589-51655611
Sequence CCATCCCTCCGGATCCGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126728333_1126728339 -9 Left 1126728333 15:51655589-51655611 CCCTGCCGGATCCGGAGGGATGG No data
Right 1126728339 15:51655603-51655625 GAGGGATGGAAGTCAGCGGCAGG 0: 39
1: 126
2: 141
3: 117
4: 280
1126728333_1126728340 -2 Left 1126728333 15:51655589-51655611 CCCTGCCGGATCCGGAGGGATGG No data
Right 1126728340 15:51655610-51655632 GGAAGTCAGCGGCAGGTCTGTGG No data
1126728333_1126728341 1 Left 1126728333 15:51655589-51655611 CCCTGCCGGATCCGGAGGGATGG No data
Right 1126728341 15:51655613-51655635 AGTCAGCGGCAGGTCTGTGGCGG No data
1126728333_1126728345 24 Left 1126728333 15:51655589-51655611 CCCTGCCGGATCCGGAGGGATGG No data
Right 1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG No data
1126728333_1126728343 17 Left 1126728333 15:51655589-51655611 CCCTGCCGGATCCGGAGGGATGG No data
Right 1126728343 15:51655629-51655651 GTGGCGGCGGCAAACAGCAATGG No data
1126728333_1126728344 20 Left 1126728333 15:51655589-51655611 CCCTGCCGGATCCGGAGGGATGG No data
Right 1126728344 15:51655632-51655654 GCGGCGGCAAACAGCAATGGTGG No data
1126728333_1126728342 4 Left 1126728333 15:51655589-51655611 CCCTGCCGGATCCGGAGGGATGG No data
Right 1126728342 15:51655616-51655638 CAGCGGCAGGTCTGTGGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126728333 Original CRISPR CCATCCCTCCGGATCCGGCA GGG (reversed) Intergenic
No off target data available for this crispr